Clone Information

BLAST Search Result

Clone Name	rbags9d17
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AY106344.1\| Zea mays PCO068917 mRNA sequence	92	3e-15
2	gb\|AC096689.5\| Oryza sativa chromosome 3 BAC OSJNBa0027J18 genom...	64	7e-07
3	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	64	7e-07
4	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	64	7e-07
5	gb\|AY375531.1\| Bacteriophage 44RR2.8t, complete genome	44	0.62
6	gb\|AC140855.14\| Botryllus schlosseri clone subsf-564g21, complet...	44	0.62
7	gb\|AC111220.6\| Rattus norvegicus Chr BAC CH230-122K11 (Children'...	44	0.62
8	gb\|AC109037.6\| Rattus norvegicus 18 BAC CH230-178G23 (Children's...	44	0.62
9	gb\|AY962392.1\| Aeromonas phage 31, complete genome	44	0.62
10	gb\|AC158924.6\| Mus musculus chromosome 18, clone RP23-109P21, co...	42	2.4
11	emb\|BX950851.1\| Erwinia carotovora subsp. atroseptica SCRI1043, ...	42	2.4
12	ref\|NM_116813.3\| Arabidopsis thaliana nucleotide binding AT4G074...	40	9.7
13	ref\|NM_185753.1\| Oryza sativa (japonica cultivar-group), mRNA	40	9.7
14	gb\|AY441133.1\| Armigeres subalbatus ASAP ID: 40675 mitochondrial...	40	9.7
15	gb\|AC099728.6\| Mus musculus chromosome 7, clone RP23-417I5, comp...	40	9.7
16	gb\|AC146241.4\| Pan troglodytes BAC clone RP43-31L17 from 7, comp...	40	9.7
17	ref\|NM_015393.2\| Homo sapiens DKFZP564O0823 protein (DKFZP564O08...	40	9.7
18	emb\|CR956613.2\|RP43043M20 Pan troglodytes chromosome X BAC RP43-...	40	9.7
19	gb\|AC091754.4\| Papio anubis clone RP41-384C24, complete sequence	40	9.7
20	gb\|AC116723.13\| Mus musculus chromosome 3, clone RP23-266J14, co...	40	9.7
21	gb\|AC142305.1\| Pan troglodytes BAC clone RP43-130P22 from 7, com...	40	9.7
22	gb\|AC140950.1\| Pan troglodytes BAC clone RP43-58I22 from 7, comp...	40	9.7
23	gb\|AC122162.32\| Medicago truncatula clone mth2-16g15, complete s...	40	9.7
24	gb\|AC146581.1\| Oryza sativa (japonica cultivar-group) Nipponbare...	40	9.7
25	emb\|BX928746.6\| Zebrafish DNA sequence from clone RP71-84D19 in ...	40	9.7
26	emb\|AL390318.20\| Human DNA sequence from clone RP11-142L16 on ch...	40	9.7
27	emb\|AL162425.15\| Human DNA sequence from clone RP11-523L1 on chr...	40	9.7
28	gb\|AC134819.1\| Homo sapiens chromosome 5 clone CTD-2027D15, comp...	40	9.7
29	emb\|AL078459.8\|HSA123M24 Human DNA sequence from clone RP4-621F1...	40	9.7
30	emb\|AL109609.5\|HSJ556A22 Human DNA sequence from clone RP4-556A2...	40	9.7
31	gb\|AY133764.1\| Arabidopsis thaliana clone U18908 unknown protein...	40	9.7
32	gb\|AY080667.1\| Arabidopsis thaliana unknown protein (At4g07410) ...	40	9.7
33	emb\|AL161505.2\|ATCHRIV17 Arabidopsis thaliana DNA chromosome 4, ...	40	9.7
34	emb\|AL603917.5\| Mouse DNA sequence from clone RP23-107J13 on chr...	40	9.7
35	gb\|DQ285630.1\| Oryza sativa (indica cultivar-group) putative nit...	40	9.7
36	emb\|CR859059.1\| Pongo pygmaeus mRNA; cDNA DKFZp469D161 (from clo...	40	9.7
37	emb\|CR858861.1\| Pongo pygmaeus mRNA; cDNA DKFZp469D194 (from clo...	40	9.7
38	emb\|BX936343.9\| Zebrafish DNA sequence from clone CH211-51C14 in...	40	9.7
39	gb\|AC148346.12\| Medicago truncatula clone mth2-25m19, complete s...	40	9.7
40	emb\|BX470113.8\| Zebrafish DNA sequence from clone DKEY-246M15 in...	40	9.7
41	gb\|AC018728.6\| Homo sapiens chromosome 7 clone RP11-206N24, comp...	40	9.7
42	gb\|AC110760.3\| Homo sapiens BAC clone RP11-44F21 from 4, complet...	40	9.7
43	gb\|AC113386.2\| Homo sapiens chromosome 5 clone RP11-350H19, comp...	40	9.7
44	gb\|AC115687.1\| Genomic sequence for Oryza sativa, Nipponbare str...	40	9.7
45	gb\|AC092656.1\| Homo sapiens BAC clone RP11-455G16 from 4, comple...	40	9.7
46	gb\|AC091867.3\| Homo sapiens chromosome 5 clone CTD-2365E22, comp...	40	9.7
47	gb\|AC019089.6\| Homo sapiens BAC clone RP11-370L14 from 4, comple...	40	9.7
48	gb\|AC010614.8\| Homo sapiens chromosome 19 clone CTD-2518G19, com...	40	9.7
49	gb\|AC094100.2\| Homo sapiens chromosome 5 clone RP11-27E19, compl...	40	9.7
50	gb\|AC055120.5\| Homo sapiens BAC clone RP11-336N6 from 4, complet...	40	9.7
51	gb\|AC008944.7\| Homo sapiens chromosome 5 clone CTD-2323D3, compl...	40	9.7
52	gb\|AC018763.6\| Homo sapiens chromosome 5 clone CTD-2305C23, comp...	40	9.7
53	gb\|AC006936.17\|AC006936 Drosophila melanogaster, chromosome 3R, ...	40	9.7
54	gb\|AC020732.4\|AC020732 Homo sapiens BAC clone RP11-556H16 from X...	40	9.7
55	emb\|AL845281.5\| Mouse DNA sequence from clone RP23-476B1 on chro...	40	9.7
56	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	40	9.7
57	gb\|AC016132.4\|AC016132 Drosophila melanogaster, chromosome 3R, r...	40	9.7
58	gb\|AC078842.2\|AC078842 Homo sapiens chromosome 7 clone RP11-102G...	40	9.7
59	dbj\|AP004401.5\| Oryza sativa (japonica cultivar-group) genomic D...	40	9.7
60	dbj\|AK026200.1\| Homo sapiens cDNA: FLJ22547 fis, clone HSI00356	40	9.7
61	dbj\|AK025205.1\| Homo sapiens cDNA: FLJ21552 fis, clone COL06322	40	9.7
62	dbj\|AK103392.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	9.7
63	emb\|AL844200.3\| Human DNA sequence from clone RP11-552P19 on chr...	40	9.7
64	dbj\|AK061432.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	40	9.7
65	gb\|AF147262.1\|F28D6 Arabidopsis thaliana BAC F28D6	40	9.7
66	gb\|AE003735.2\| Drosophila melanogaster chromosome 3R, section 73...	40	9.7
67	gb\|AE000782.1\| Archaeoglobus fulgidus DSM 4304, complete genome	40	9.7
68	emb\|AL953877.5\| Zebrafish DNA sequence from clone CH211-188M3, c...	40	9.7
69	emb\|CR450825.5\| Zebrafish DNA sequence from clone DKEY-117B24 in...	40	9.7
70	emb\|AL928797.6\| Mouse DNA sequence from clone RP23-178B19 on chr...	40	9.7

>gb|AY106344.1| Zea mays PCO068917 mRNA sequence
          Length = 672

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                       
Query: 496 acaacatccatccattgcttctctactaccagaagtgaactgtccagtaggtggccagca 555
           ||||||||||||||| |||||||||| |  | || |||||||||| |||| || ||| ||
Sbjct: 249 acaacatccatccatcgcttctctaccattaaaattgaactgtcctgtagatgcccaaca 190

                                                             
Query: 556 aacagcaccggatctttaaaggcaaagaaggtgaagttattccttttctc 605
           || ||||| || |||||||| ||||||||| ||||||| |||||||||||
Sbjct: 189 aagagcactggttctttaaacgcaaagaagttgaagttgttccttttctc 140



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 40/42 (95%)
 Strand = Plus / Minus

                                                     
Query: 109 ataacagtagtgatgatacattgtttacatatgacaaaattt 150
           ||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 588 ataacagaagtgatgatacattgtttacatgtgacaaaattt 547

to top

>gb|AC096689.5| Oryza sativa chromosome 3 BAC OSJNBa0027J18 genomic sequence, complete
             sequence
          Length = 112892

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 131/164 (79%)
 Strand = Plus / Plus

                                                                         
Query: 445   atggatcatgtcccgtatatgtgtctgtggaccggcgggccgaatcctttgacaacatcc 504
             ||||||||||| |||||||| ||||| || || || | ||| || ||||  || ||||||
Sbjct: 27288 atggatcatgtaccgtatatatgtctatgaactggtgcgccaaaaccttcaactacatcc 27347

                                                                         
Query: 505   atccattgcttctctactaccagaagtgaactgtccagtaggtggccagcaaacagcacc 564
             ||||||  ||||||||| |  ||||  ||  ||||   |||||||||| |||| ||||| 
Sbjct: 27348 atccatctcttctctaccattagaacagagttgtctgataggtggccaacaaatagcact 27407

                                                         
Query: 565   ggatctttaaaggcaaagaaggtgaagttattccttttctcttg 608
             ||||||||||| ||||||||    |||||||||||| |||||||
Sbjct: 27408 ggatctttaaaagcaaagaaatcaaagttattccttatctcttg 27451



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Plus

                                               
Query: 122   tgatacattgtttacatatgacaaaatttgcgca 155
             |||||||| ||||||| ||| |||||||||||||
Sbjct: 26979 tgatacatagtttacagatgccaaaatttgcgca 27012

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 131/164 (79%)
 Strand = Plus / Minus

                                                                            
Query: 445      atggatcatgtcccgtatatgtgtctgtggaccggcgggccgaatcctttgacaacatcc 504
                ||||||||||| |||||||| ||||| || || || | ||| || ||||  || ||||||
Sbjct: 29822173 atggatcatgtaccgtatatatgtctatgaactggtgcgccaaaaccttcaactacatcc 29822114

                                                                            
Query: 505      atccattgcttctctactaccagaagtgaactgtccagtaggtggccagcaaacagcacc 564
                ||||||  ||||||||| |  ||||  ||  ||||   |||||||||| |||| ||||| 
Sbjct: 29822113 atccatctcttctctaccattagaacagagttgtctgataggtggccaacaaatagcact 29822054

                                                            
Query: 565      ggatctttaaaggcaaagaaggtgaagttattccttttctcttg 608
                ||||||||||| ||||||||    |||||||||||| |||||||
Sbjct: 29822053 ggatctttaaaagcaaagaaatcaaagttattccttatctcttg 29822010



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 122      tgatacattgtttacatatgacaaaatttgcgca 155
                |||||||| ||||||| ||| |||||||||||||
Sbjct: 29822482 tgatacatagtttacagatgccaaaatttgcgca 29822449



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 572     taaaggcaaagaaggtgaagttat 595
               |||||||||||||||| |||||||
Sbjct: 5252160 taaaggcaaagaaggttaagttat 5252137

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 63.9 bits (32), Expect = 7e-07
 Identities = 131/164 (79%)
 Strand = Plus / Minus

                                                                            
Query: 445      atggatcatgtcccgtatatgtgtctgtggaccggcgggccgaatcctttgacaacatcc 504
                ||||||||||| |||||||| ||||| || || || | ||| || ||||  || ||||||
Sbjct: 29913595 atggatcatgtaccgtatatatgtctatgaactggtgcgccaaaaccttcaactacatcc 29913536

                                                                            
Query: 505      atccattgcttctctactaccagaagtgaactgtccagtaggtggccagcaaacagcacc 564
                ||||||  ||||||||| |  ||||  ||  ||||   |||||||||| |||| ||||| 
Sbjct: 29913535 atccatctcttctctaccattagaacagagttgtctgataggtggccaacaaatagcact 29913476

                                                            
Query: 565      ggatctttaaaggcaaagaaggtgaagttattccttttctcttg 608
                ||||||||||| ||||||||    |||||||||||| |||||||
Sbjct: 29913475 ggatctttaaaagcaaagaaatcaaagttattccttatctcttg 29913432



 Score = 44.1 bits (22), Expect = 0.62
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                  
Query: 122      tgatacattgtttacatatgacaaaatttgcgca 155
                |||||||| ||||||| ||| |||||||||||||
Sbjct: 29913904 tgatacatagtttacagatgccaaaatttgcgca 29913871



 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 572     taaaggcaaagaaggtgaagttat 595
               |||||||||||||||| |||||||
Sbjct: 5251375 taaaggcaaagaaggttaagttat 5251352

to top

>gb|AY375531.1| Bacteriophage 44RR2.8t, complete genome
          Length = 173591

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 374    tggcggtgataaaaatgaatgg 395
              ||||||||||||||||||||||
Sbjct: 142933 tggcggtgataaaaatgaatgg 142912

to top

>gb|AC140855.14| Botryllus schlosseri clone subsf-564g21, complete sequence
          Length = 39454

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 132   tttacatatgacaaaatttgcgcattttga 161
             ||||| |||||||||||||||| |||||||
Sbjct: 28706 tttacctatgacaaaatttgcgtattttga 28735

to top

>gb|AC111220.6| Rattus norvegicus Chr BAC CH230-122K11 (Children's Hospital Oakland
              Research Institute Rat (BN/SsNHsd/MCW) BAC library)
              complete sequence
          Length = 237466

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 123    gatacattgtttacatatgacaaaat 148
              |||||||||| |||||||||||||||
Sbjct: 235149 gatacattgtatacatatgacaaaat 235124

to top

>gb|AC109037.6| Rattus norvegicus 18 BAC CH230-178G23 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 208650

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 123    gatacattgtttacatatgacaaaat 148
              |||||||||| |||||||||||||||
Sbjct: 110873 gatacattgtatacatatgacaaaat 110898

to top

>gb|AY962392.1| Aeromonas phage 31, complete genome
          Length = 172963

 Score = 44.1 bits (22), Expect = 0.62
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 374    tggcggtgataaaaatgaatgg 395
              ||||||||||||||||||||||
Sbjct: 142699 tggcggtgataaaaatgaatgg 142678

to top

>gb|AC158924.6| Mus musculus chromosome 18, clone RP23-109P21, complete sequence
          Length = 254968

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 123   gatacattgtttacatatgacaaaa 147
             |||||||||| ||||||||||||||
Sbjct: 74670 gatacattgtatacatatgacaaaa 74694

to top

>emb|BX950851.1| Erwinia carotovora subsp. atroseptica SCRI1043, complete genome
          Length = 5064019

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 212    gtgaagaaaaagaatacaacg 232
              |||||||||||||||||||||
Sbjct: 761489 gtgaagaaaaagaatacaacg 761469

to top

>ref|NM_116813.3| Arabidopsis thaliana nucleotide binding AT4G07410 mRNA, complete cds
          Length = 2752

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 493  ttgacaacatccatccattgcttctcta 520
            |||||||||||||||||| | |||||||
Sbjct: 2490 ttgacaacatccatccatggtttctcta 2463

to top

>ref|NM_185753.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 321

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 345 acaacttgcttggggatggg 364
           ||||||||||||||||||||
Sbjct: 242 acaacttgcttggggatggg 223

to top

>gb|AY441133.1| Armigeres subalbatus ASAP ID: 40675 mitochondrial porin mRNA
           sequence
          Length = 721

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 208 ttcagtgaagaaaaagaata 227
           ||||||||||||||||||||
Sbjct: 69  ttcagtgaagaaaaagaata 88

to top

>gb|AC099728.6| Mus musculus chromosome 7, clone RP23-417I5, complete sequence
          Length = 205550

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 657   cttttgtaagcctcccttct 676
             ||||||||||||||||||||
Sbjct: 38670 cttttgtaagcctcccttct 38689

to top

>gb|AC146241.4| Pan troglodytes BAC clone RP43-31L17 from 7, complete sequence
          Length = 160620

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 493    ttgacaacatccatccattgcttc 516
              |||| |||||||||||||||||||
Sbjct: 156551 ttgaaaacatccatccattgcttc 156528

to top

>ref|NM_015393.2| Homo sapiens DKFZP564O0823 protein (DKFZP564O0823), mRNA
          Length = 5044

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 571  ttaaaggcaaagaaggtgaa 590
            ||||||||||||||||||||
Sbjct: 4780 ttaaaggcaaagaaggtgaa 4761

to top

>emb|CR956613.2|RP43043M20 Pan troglodytes chromosome X BAC RP43-043M20, complete sequence
          Length = 81986

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 206   acttcagtgaagaaaaagaa 225
             ||||||||||||||||||||
Sbjct: 56871 acttcagtgaagaaaaagaa 56890

to top

>gb|AC091754.4| Papio anubis clone RP41-384C24, complete sequence
          Length = 192273

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 597    ccttttctcttgttccaaatcttc 620
              ||||||||||||| ||||||||||
Sbjct: 153071 ccttttctcttgtcccaaatcttc 153048

to top

>gb|AC116723.13| Mus musculus chromosome 3, clone RP23-266J14, complete sequence
          Length = 184835

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 384    aaaaatgaatgggctgcctgcctg 407
              |||||||||||| |||||||||||
Sbjct: 122738 aaaaatgaatggcctgcctgcctg 122761

to top

>gb|AC142305.1| Pan troglodytes BAC clone RP43-130P22 from 7, complete sequence
          Length = 173535

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 493   ttgacaacatccatccattgcttc 516
             |||| |||||||||||||||||||
Sbjct: 50957 ttgaaaacatccatccattgcttc 50934

to top

>gb|AC140950.1| Pan troglodytes BAC clone RP43-58I22 from 7, complete sequence
          Length = 190084

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 493    ttgacaacatccatccattgcttc 516
              |||| |||||||||||||||||||
Sbjct: 148100 ttgaaaacatccatccattgcttc 148077

to top

>gb|AC122162.32| Medicago truncatula clone mth2-16g15, complete sequence
          Length = 108296

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 212   gtgaagaaaaagaatacaac 231
             ||||||||||||||||||||
Sbjct: 71145 gtgaagaaaaagaatacaac 71126

to top

>gb|AC146581.1| Oryza sativa (japonica cultivar-group) Nipponbare strain chromosome 3
             clone OSJNBa0021H20, complete sequence
          Length = 133079

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 572   taaaggcaaagaaggtgaagttat 595
             |||||||||||||||| |||||||
Sbjct: 75562 taaaggcaaagaaggttaagttat 75539

to top

>emb|BX928746.6| Zebrafish DNA sequence from clone RP71-84D19 in linkage group 9,
             complete sequence
          Length = 93292

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 435   ctatggatggatggatcatg 454
             ||||||||||||||||||||
Sbjct: 87787 ctatggatggatggatcatg 87806

to top

>emb|AL390318.20| Human DNA sequence from clone RP11-142L16 on chromosome 10 Contains the
              5' end of the PIP5K2A gene for
              phosphatidylinositol-4-phosphate 5-kinase type II alpha and
              one CpG island, complete sequence
          Length = 164955

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 595    ttccttttctcttgttccaaatct 618
              |||||||||| |||||||||||||
Sbjct: 155138 ttccttttcttttgttccaaatct 155161

to top

>emb|AL162425.15| Human DNA sequence from clone RP11-523L1 on chromosome 9 Contains the
             TNC gene for tenascin C (hexabrachion) (TN, HXB) and a
             novel gene, complete sequence
          Length = 177728

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   tttacatatgacaaaatttg 151
             ||||||||||||||||||||
Sbjct: 48342 tttacatatgacaaaatttg 48361

to top

>gb|AC134819.1| Homo sapiens chromosome 5 clone CTD-2027D15, complete sequence
          Length = 88419

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                         
Query: 497   caacatccatcc-attgcttctctacta 523
             |||||||||||| |||||||||||||||
Sbjct: 75694 caacatccatcccattgcttctctacta 75721

to top

>emb|AL078459.8|HSA123M24 Human DNA sequence from clone RP4-621F18 on chromosome 1p11.4-21.3
             Contains part of a novel gene, and the 3' end of the DDAH1
             gene for dimethylarginine dimethylaminohydrolase 1,
             complete sequence
          Length = 83946

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 288   gccagatggataatagcaga 307
             ||||||||||||||||||||
Sbjct: 51703 gccagatggataatagcaga 51684

to top

>emb|AL109609.5|HSJ556A22 Human DNA sequence from clone RP4-556A22 on chromosome Xp21.1-21.3
             Contains part of the DMD gene for dystrophin (muscular
             dystrophy, Duchenne and Becker types), complete sequence
          Length = 109098

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 206   acttcagtgaagaaaaagaa 225
             ||||||||||||||||||||
Sbjct: 27397 acttcagtgaagaaaaagaa 27378

to top

>gb|AY133764.1| Arabidopsis thaliana clone U18908 unknown protein (At4g07410) mRNA,
            complete cds
          Length = 2479

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 493  ttgacaacatccatccattgcttctcta 520
            |||||||||||||||||| | |||||||
Sbjct: 2402 ttgacaacatccatccatggtttctcta 2375

to top

>gb|AY080667.1| Arabidopsis thaliana unknown protein (At4g07410) mRNA, complete cds
          Length = 2768

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 493  ttgacaacatccatccattgcttctcta 520
            |||||||||||||||||| | |||||||
Sbjct: 2490 ttgacaacatccatccatggtttctcta 2463

to top

>emb|AL161505.2|ATCHRIV17 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 17
          Length = 198176

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 493    ttgacaacatccatccattgcttctcta 520
              |||||||||||||||||| | |||||||
Sbjct: 114217 ttgacaacatccatccatggtttctcta 114244

to top

>emb|AL603917.5| Mouse DNA sequence from clone RP23-107J13 on chromosome 11 Contains a
             novel gene, a glyoxalase 1 (Glo1) pseudogene and a
             pseudogene similar to part of nuclear pore membrane
             protein 121 Pom121, complete sequence
          Length = 212255

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 660   ttgtaagcctcccttctctgattt 683
             ||||| ||||||||||||||||||
Sbjct: 19285 ttgtatgcctcccttctctgattt 19262

to top

>gb|DQ285630.1| Oryza sativa (indica cultivar-group) putative nitrate-induced NOI
             protein (75-1-127BAC12.1), putative NBS-LRR disease
             resistance protein (Nbs1-Pi9), putative NBS-LRR disease
             resistance protein (Nbs3-Pi9), and NBS-LRR disease
             resistance protein (Pi9) genes, complete cds; putative
             NBS-LRR disease resistance protein (Nbs4-Pi9) pseudogene,
             complete sequence; putative NBS-LRR disease resistance
             protein (Nbs5-Pi9) gene, complete cds; putative NBS-LRR
             disease resistance protein (Nbs6-Pi9) gene, partial cds;
             and solo-long terminal repeat retrotransposon, complete
             sequence
          Length = 76272

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 589   aagttattccttttctcttg 608
             ||||||||||||||||||||
Sbjct: 12638 aagttattccttttctcttg 12657

to top

>emb|CR859059.1| Pongo pygmaeus mRNA; cDNA DKFZp469D161 (from clone DKFZp469D161)
          Length = 5035

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 571  ttaaaggcaaagaaggtgaa 590
            ||||||||||||||||||||
Sbjct: 4765 ttaaaggcaaagaaggtgaa 4746

to top

>emb|CR858861.1| Pongo pygmaeus mRNA; cDNA DKFZp469D194 (from clone DKFZp469D194)
          Length = 4337

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 571  ttaaaggcaaagaaggtgaa 590
            ||||||||||||||||||||
Sbjct: 4064 ttaaaggcaaagaaggtgaa 4045

to top

>emb|BX936343.9| Zebrafish DNA sequence from clone CH211-51C14 in linkage group 3,
              complete sequence
          Length = 160177

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 645    tgtttttgtagccttttgta 664
              ||||||||||||||||||||
Sbjct: 131893 tgtttttgtagccttttgta 131912

to top

>gb|AC148346.12| Medicago truncatula clone mth2-25m19, complete sequence
          Length = 122590

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   tgaagaaaaagaatacaacg 232
             ||||||||||||||||||||
Sbjct: 71675 tgaagaaaaagaatacaacg 71694

to top

>emb|BX470113.8| Zebrafish DNA sequence from clone DKEY-246M15 in linkage group 17,
              complete sequence
          Length = 118640

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 437    atggatggatggatcatgtc 456
              ||||||||||||||||||||
Sbjct: 115801 atggatggatggatcatgtc 115782

to top

>gb|AC018728.6| Homo sapiens chromosome 7 clone RP11-206N24, complete sequence
          Length = 181935

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 493   ttgacaacatccatccattgcttc 516
             |||| |||||||||||||||||||
Sbjct: 82475 ttgaaaacatccatccattgcttc 82498

to top

>gb|AC110760.3| Homo sapiens BAC clone RP11-44F21 from 4, complete sequence
          Length = 171632

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 571   ttaaaggcaaagaaggtgaa 590
             ||||||||||||||||||||
Sbjct: 96155 ttaaaggcaaagaaggtgaa 96136

to top

>gb|AC113386.2| Homo sapiens chromosome 5 clone RP11-350H19, complete sequence
          Length = 109953

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 565   ggatctttaaaggcaaagaa 584
             ||||||||||||||||||||
Sbjct: 98238 ggatctttaaaggcaaagaa 98257

to top

>gb|AC115687.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone
            OSJNBa0091J11, from chromosome 3, complete sequence
          Length = 181163

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 572  taaaggcaaagaaggtgaagttat 595
            |||||||||||||||| |||||||
Sbjct: 4358 taaaggcaaagaaggttaagttat 4381

to top

>gb|AC092656.1| Homo sapiens BAC clone RP11-455G16 from 4, complete sequence
          Length = 191840

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 124   atacattgtttacatatgac 143
             ||||||||||||||||||||
Sbjct: 22002 atacattgtttacatatgac 22021

to top

>gb|AC091867.3| Homo sapiens chromosome 5 clone CTD-2365E22, complete sequence
          Length = 98183

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 565   ggatctttaaaggcaaagaa 584
             ||||||||||||||||||||
Sbjct: 77727 ggatctttaaaggcaaagaa 77708

to top

>gb|AC019089.6| Homo sapiens BAC clone RP11-370L14 from 4, complete sequence
          Length = 177160

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 167    tatatgacaaaactggcact 186
              ||||||||||||||||||||
Sbjct: 127617 tatatgacaaaactggcact 127636

to top

>gb|AC010614.8| Homo sapiens chromosome 19 clone CTD-2518G19, complete sequence
          Length = 158595

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 571    ttaaaggcaaagaaggtgaa 590
              ||||||||||||||||||||
Sbjct: 100684 ttaaaggcaaagaaggtgaa 100703

to top

>gb|AC094100.2| Homo sapiens chromosome 5 clone RP11-27E19, complete sequence
          Length = 132113

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 38    aagatgcaatacttctattg 57
             ||||||||||||||||||||
Sbjct: 29944 aagatgcaatacttctattg 29963

to top

>gb|AC055120.5| Homo sapiens BAC clone RP11-336N6 from 4, complete sequence
          Length = 178524

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 124    atacattgtttacatatgac 143
              ||||||||||||||||||||
Sbjct: 123318 atacattgtttacatatgac 123299

to top

>gb|AC008944.7| Homo sapiens chromosome 5 clone CTD-2323D3, complete sequence
          Length = 109760

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                         
Query: 497   caacatccatcc-attgcttctctacta 523
             |||||||||||| |||||||||||||||
Sbjct: 55606 caacatccatcccattgcttctctacta 55633

to top

>gb|AC018763.6| Homo sapiens chromosome 5 clone CTD-2305C23, complete sequence
          Length = 119974

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 648   ttttgtagccttttgtaagcctcccttc 675
             ||||| ||| ||||||||||||||||||
Sbjct: 97441 ttttgaagcattttgtaagcctcccttc 97468

to top

>gb|AC006936.17|AC006936 Drosophila melanogaster, chromosome 3R, region 93E4-93E7, BAC clone
             BACR48I01, complete sequence
          Length = 170535

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   gtttacatatgacaaaattt 150
             ||||||||||||||||||||
Sbjct: 25156 gtttacatatgacaaaattt 25137

to top

>gb|AC020732.4|AC020732 Homo sapiens BAC clone RP11-556H16 from X, complete sequence
          Length = 181559

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 206    acttcagtgaagaaaaagaa 225
              ||||||||||||||||||||
Sbjct: 164700 acttcagtgaagaaaaagaa 164681

to top

>emb|AL845281.5| Mouse DNA sequence from clone RP23-476B1 on chromosome 2, complete
              sequence
          Length = 195228

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 245    aaataaaagccaccaaagaa 264
              ||||||||||||||||||||
Sbjct: 174870 aaataaaagccaccaaagaa 174851

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 345      acaacttgcttggggatggg 364
                ||||||||||||||||||||
Sbjct: 21757250 acaacttgcttggggatggg 21757269

to top

>gb|AC016132.4|AC016132 Drosophila melanogaster, chromosome 3R, region 93D-93D, BAC clone
              BACR34E13, complete sequence
          Length = 167475

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 131    gtttacatatgacaaaattt 150
              ||||||||||||||||||||
Sbjct: 142321 gtttacatatgacaaaattt 142302

to top

>gb|AC078842.2|AC078842 Homo sapiens chromosome 7 clone RP11-102G17, complete sequence
          Length = 173844

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 493   ttgacaacatccatccattgcttc 516
             |||| |||||||||||||||||||
Sbjct: 51290 ttgaaaacatccatccattgcttc 51267

to top

>dbj|AP004401.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0534A03
          Length = 153170

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 345   acaacttgcttggggatggg 364
             ||||||||||||||||||||
Sbjct: 74433 acaacttgcttggggatggg 74452

to top

>dbj|AK026200.1| Homo sapiens cDNA: FLJ22547 fis, clone HSI00356
          Length = 1343

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 571  ttaaaggcaaagaaggtgaa 590
            ||||||||||||||||||||
Sbjct: 1043 ttaaaggcaaagaaggtgaa 1024

to top

>dbj|AK025205.1| Homo sapiens cDNA: FLJ21552 fis, clone COL06322
          Length = 2045

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 571  ttaaaggcaaagaaggtgaa 590
            ||||||||||||||||||||
Sbjct: 1769 ttaaaggcaaagaaggtgaa 1750

to top

>dbj|AK103392.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033127M05, full
            insert sequence
          Length = 1487

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 572  taaaggcaaagaaggtgaagttat 595
            |||||||||||||||| |||||||
Sbjct: 1067 taaaggcaaagaaggttaagttat 1090

to top

>emb|AL844200.3| Human DNA sequence from clone RP11-552P19 on chromosome 1, complete
              sequence
          Length = 175707

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                          
Query: 497    caacatccatcc-attgcttctctacta 523
              |||||||||||| |||||||||||||||
Sbjct: 133249 caacatccatcccattgcttctctacta 133276

to top

>dbj|AK061432.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-H09, full
           insert sequence
          Length = 1192

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 572 taaaggcaaagaaggtgaagttat 595
           |||||||||||||||| |||||||
Sbjct: 867 taaaggcaaagaaggttaagttat 890

to top

>gb|AF147262.1|F28D6 Arabidopsis thaliana BAC F28D6
          Length = 112629

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 493   ttgacaacatccatccattgcttctcta 520
             |||||||||||||||||| | |||||||
Sbjct: 51125 ttgacaacatccatccatggtttctcta 51152

to top

>gb|AE003735.2| Drosophila melanogaster chromosome 3R, section 73 of 118 of the
             complete sequence
          Length = 255463

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   gtttacatatgacaaaattt 150
             ||||||||||||||||||||
Sbjct: 26993 gtttacatatgacaaaattt 26974

to top

>gb|AE000782.1| Archaeoglobus fulgidus DSM 4304, complete genome
          Length = 2178400

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 657     cttttgtaagcctcccttct 676
               ||||||||||||||||||||
Sbjct: 1901769 cttttgtaagcctcccttct 1901788

to top

>emb|AL953877.5| Zebrafish DNA sequence from clone CH211-188M3, complete sequence
          Length = 152080

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 435   ctatggatggatggatcatg 454
             ||||||||||||||||||||
Sbjct: 56701 ctatggatggatggatcatg 56682

to top

>emb|CR450825.5| Zebrafish DNA sequence from clone DKEY-117B24 in linkage group 11,
             complete sequence
          Length = 90653

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 570   tttaaaggcaaagaaggtga 589
             ||||||||||||||||||||
Sbjct: 74491 tttaaaggcaaagaaggtga 74510

to top

>emb|AL928797.6| Mouse DNA sequence from clone RP23-178B19 on chromosome 2, complete
             sequence
          Length = 166185

 Score = 40.1 bits (20), Expect = 9.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 68    tacacacagcacaaaggcat 87
             ||||||||||||||||||||
Sbjct: 16391 tacacacagcacaaaggcat 16372


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,868,013
Number of Sequences: 3902068
Number of extensions: 8868013
Number of successful extensions: 369342
Number of sequences better than 10.0: 70
Number of HSP's better than 10.0 without gapping: 69
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 368754
Number of HSP's gapped (non-prelim): 585
length of query: 705
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 682
effective length of database: 17,143,297,704
effective search space: 11691729034128
effective search space used: 11691729034128
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result