ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah63o15
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 109 3e-21
2ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2... 98 1e-17
3ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2... 98 1e-17
4ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll bindin... 98 1e-17
5ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) ... 98 1e-17
6gb|AY142513.1| Arabidopsis thaliana putative photosystem II type... 98 1e-17
7gb|AY045806.1| Arabidopsis thaliana putative photosystem II type... 98 1e-17
8gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 ma... 98 1e-17
9gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 ma... 98 1e-17
10gb|AY081587.1| Arabidopsis thaliana photosystem II type I chloro... 98 1e-17
11gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 98 1e-17
12gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 98 1e-17
13gb|AY065125.1| Arabidopsis thaliana photosystem II type I chloro... 98 1e-17
14gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 ... 98 1e-17
15gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 ... 98 1e-17
16gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 ... 98 1e-17
17gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, co... 98 1e-17
18gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 ... 98 1e-17
19emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
20emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
21emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
22emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
23emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Co... 98 1e-17
24emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II c... 98 1e-17
25gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 96 5e-17
26ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predic... 94 2e-16
27emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 94 2e-16
28emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 94 2e-16
29dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 94 2e-16
30dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic D... 94 2e-16
31dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 2e-16
32dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 2e-16
33emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 94 2e-16
34emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chloro... 94 2e-16
35dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clon... 94 2e-16
36gb|AY109324.1| Zea mays CL187_1 mRNA sequence 94 2e-16
37gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/... 90 3e-15
38gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genom... 86 4e-14
39gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 86 4e-14
40dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 86 4e-14
41dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 86 4e-14
42dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 86 4e-14
43dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 86 4e-14
44emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chl... 86 4e-14
45dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 4e-14
46dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 4e-14
47dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 4e-14
48dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 4e-14
49dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 4e-14
50gb|AY112240.1| Zea mays CL187_6 mRNA sequence 86 4e-14
51dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 4e-14
52dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 4e-14
53dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 86 4e-14
54gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding prot... 86 4e-14
55gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast c... 86 4e-14
56gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 86 4e-14
57dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 86 4e-14
58ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll bindin... 82 7e-13
59gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence 82 7e-13
60emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding ... 82 7e-13
61gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete se... 82 7e-13
62gb|AF339687.1| Arabidopsis thaliana putative photosystem II type... 82 7e-13
63gb|AF326864.1| Arabidopsis thaliana putative photosystem II type... 82 7e-13
64gb|AY120776.1| Arabidopsis thaliana putative photosystem II type... 82 7e-13
65gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430... 82 7e-13
66emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Co... 82 7e-13
67emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Co... 82 7e-13
68emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Co... 82 7e-13
69gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete s... 82 7e-13
70emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b... 82 7e-13
71emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II ... 82 7e-13
72gb|BT002103.1| Arabidopsis thaliana putative photosystem II type... 82 7e-13
73ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 78 1e-11
74gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 78 1e-11
75dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 78 1e-11
76emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 78 1e-11
77dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 1e-11
78dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 1e-11
79dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 1e-11
80dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 78 1e-11
81gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b ... 78 1e-11
82emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlo... 76 4e-11
83emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein 74 2e-10
84emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting... 70 3e-09
85gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II ch... 70 3e-09
86gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 68 1e-08
87emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding pr... 66 4e-08
88gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 66 4e-08
89gb|AY617091.1| Pinus strobus chloroplast light harvesting chloro... 64 2e-07
90gb|AY617090.1| Pinus monticola chloroplast light harvesting chlo... 64 2e-07
91gb|AY617089.1| Pinus lambertiana chloroplast light harvesting ch... 64 2e-07
92gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlor... 64 2e-07
93dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 64 2e-07
94gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chl... 64 2e-07
95emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll... 62 6e-07
96gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 62 6e-07
97emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b bind... 62 6e-07
98emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 62 6e-07
99dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRN... 62 6e-07
100ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BIND... 60 2e-06
101gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-bin... 60 2e-06
102gb|AY050935.1| Arabidopsis thaliana putative photosystem II type... 60 2e-06
103gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 60 2e-06
104gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 m... 60 2e-06
105gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, com... 60 2e-06
106emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Co... 60 2e-06
107gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P... 60 2e-06
108gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N... 60 2e-06
109emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophy... 60 2e-06
110gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 58 1e-05
111emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Co... 58 1e-05
112dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light... 58 1e-05
113gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-... 58 1e-05
114gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence 56 4e-05
115gb|DQ018376.1| Pinus krempfii chloroplast putative light harvest... 56 4e-05
116gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 56 4e-05
117gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 56 4e-05
118gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chl... 56 4e-05
119gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophy... 56 4e-05
120ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA 54 2e-04
121ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group... 54 2e-04
122ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group... 54 2e-04
123ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group... 54 2e-04
124ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group... 54 2e-04
125ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group... 54 2e-04
126ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group... 54 2e-04
127ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group... 54 2e-04
128dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 54 2e-04
129dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic D... 54 2e-04
130dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
131dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
132dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
133dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
134dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
135dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
136dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
137dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
138dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clon... 54 2e-04
139gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll... 54 2e-04
140gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 54 2e-04
141ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding ... 52 6e-04
142gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence 52 6e-04
143gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472)... 52 6e-04
144gb|AY128345.1| Arabidopsis thaliana photosystem II type I chloro... 52 6e-04
145gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 52 6e-04
146gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 52 6e-04
147gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 52 6e-04
148gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 52 6e-04
149gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, com... 52 6e-04
150gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete s... 52 6e-04
151emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophy... 52 6e-04
152emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophy... 52 6e-04
153gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein... 52 6e-04
154emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chloro... 50 0.002
155emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding p... 50 0.002
156emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b bindi... 50 0.002
157gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding p... 50 0.002
158gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding prot... 50 0.002
159emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 50 0.002
160gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein... 50 0.002
161gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene ... 50 0.002
162gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosyste... 50 0.002
163ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BIND... 48 0.009
164gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mR... 48 0.009
165gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 48 0.009
166gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 48 0.009
167gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 48 0.009
168gb|AY617084.1| Pinus contorta chloroplast light harvesting chlor... 48 0.009
169gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 48 0.009
170gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 48 0.009
171gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 48 0.009
172gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding prot... 48 0.009
173gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/... 48 0.009
174emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll... 48 0.009
175gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding p... 48 0.009
176gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll... 48 0.009
177gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvestin... 46 0.037
178emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 46 0.037
179dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.037
180gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding prot... 46 0.037
181emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 44 0.15
182emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Co... 44 0.15
183emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-h... 44 0.15
184gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b bin... 44 0.15
185dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-b... 44 0.15
186gb|AY786530.1| Haematococcus pluvialis chloroplast major light-h... 42 0.58
187gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting comple... 42 0.58
188gb|AF104631.3| Chlamydomonas reinhardtii light harvesting comple... 42 0.58
189gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protei... 42 0.58
190gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting ... 42 0.58
191gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting ... 42 0.58
192gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting ... 42 0.58
193gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting ... 42 0.58
194gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvestin... 42 0.58
195dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b bindi... 42 0.58
196gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvestin... 42 0.58
197dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chloro... 42 0.58
198emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC... 42 0.58
199dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene... 42 0.58
200emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 42 0.58
201emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b bin... 42 0.58
202gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvestin... 42 0.58
203gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding pro... 42 0.58
204gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 42 0.58
205gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein ge... 42 0.58
206gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mR... 42 0.58
207gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-bindi... 42 0.58
208dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvest... 42 0.58
209dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvest... 42 0.58
210dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvest... 42 0.58
211dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvest... 42 0.58
212dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvest... 42 0.58
213dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvest... 42 0.58
214dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 42 0.58
215emb|AL808032.1|CNS08CA7 BAC 30B15 of library A from Tetraodon ni... 42 0.58
216gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome... 40 2.3
217ref|XM_754456.1| Ustilago maydis 521 hypothetical protein (UM034... 40 2.3
218gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, comple... 40 2.3
219gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 40 2.3
220gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 40 2.3
221dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.3
222emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-bi... 40 2.3
223emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 40 2.3
224emb|X16535.1|GMCAB4 G.max DNA for Cab4 40 2.3
225emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for lig... 40 2.3
226emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for ligh... 40 2.3
227gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complet... 40 2.3
228gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA,... 40 2.3
229gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene ... 40 2.3
230ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll bindi... 38 9.1
231ref|NM_013115.1| Rattus norvegicus prostaglandin F receptor (Ptg... 38 9.1
232gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b... 38 9.1
233gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, com... 38 9.1
234gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence 38 9.1
235gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome... 38 9.1
236gb|AC125213.3| Mus musculus BAC clone RP23-136A14 from 7, comple... 38 9.1
237gb|AC007364.3| Homo sapiens BAC clone RP11-329H24 from 2, comple... 38 9.1
238gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete ... 38 9.1
239gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome 38 9.1
240gb|BC056343.1| Mus musculus sortilin 1, mRNA (cDNA clone MGC:739... 38 9.1
241dbj|AK147442.1| Mus musculus adult male brain UNDEFINED_CELL_LIN... 38 9.1
242gb|AC018929.12| Oryza sativa chromosome 10 BAC OSJNBa0027L23 gen... 38 9.1
243gb|S74898.1| prostaglandin F2 alpha receptor [rats, corpus luteu... 38 9.1
244gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds 38 9.1
245gb|BC034129.1| Mus musculus sortilin 1, mRNA (cDNA clone IMAGE:4... 38 9.1
246gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chl... 38 9.1
247dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 38 9.1
248gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete se... 38 9.1
249gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA... 38 9.1
250dbj|AK177805.1| Mus musculus cDNA, clone:Y0G0104F07, strand:minu... 38 9.1
251emb|BX649293.4| Mouse DNA sequence from clone RP23-360N18 on chr... 38 9.1
252dbj|AB018114.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 38 9.1
253gb|AF175279.1|AF175279 Mus musculus neurotensin receptor 3 mRNA,... 38 9.1
254gb|K00975.1|PETCAB10 Petunia major chlorophyll a/b binding prote... 38 9.1
255emb|X83856.1|RNF2ALPHA R.norvegicus mRNA for hepatocyte F2alpha ... 38 9.1
256gb|AC172744.2| Medicago truncatula chromosome 2 BAC clone mth2-3... 38 9.1
257gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 38 9.1
258ref|NM_019972.2| Mus musculus sortilin 1 (Sort1), mRNA 38 9.1
259emb|AL954144.6| Zebrafish DNA sequence from clone CH211-206L15, ... 38 9.1
260gb|U47287.1|RNU47287 Rattus norvegicus prostaglandin F2alpha rec... 38 9.1
261gb|U26663.1|RNU26663 Rattus norvegicus prostaglandin F2a recepto... 38 9.1
262emb|AL671899.11| Mouse DNA sequence from clone RP23-27B23 on chr... 38 9.1
263gb|J01253.1|PEACAB15 Pea major chlorophyll a/b-binding thylakoid... 38 9.1
264dbj|D28581.1|RATPF2AR Rattus norvegicus mRNA for prostaglandin F... 38 9.1

>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score =  109 bits (55), Expect = 3e-21
 Identities = 101/117 (86%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||| ||||||| |||||| |||| |||||||| |||||||||
Sbjct: 1673 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcagcgatgtgg 1614

                                                                     
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
            ||   ||||||||  | ||| ||||| ||||||||||||||||| || |||||||||
Sbjct: 1613 tcagcgaggttctcgagcgggcccttgccggtgacgatggcctggacgaagaagccg 1557



to top

>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.3 mRNA, complete cds
          Length = 3299

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 2549

                                                                   
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 2550 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 2604



to top

>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant
            AT2G34410.2 mRNA, complete cds
          Length = 3338

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 2549

                                                                   
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 2550 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 2604



to top

>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2)
           transcript variant AT2G34420.1 mRNA, complete cds
          Length = 1354

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 789

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 788 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 734



to top

>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant
           AT2G34420.2 mRNA, complete cds
          Length = 1312

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 806 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 747

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 746 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 692



to top

>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 829

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 733 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 679



to top

>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34420) mRNA, complete cds
          Length = 1015

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 789

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 788 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 734



to top

>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete
             sequence
          Length = 112763

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                         
Query: 67    ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
             |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 93208 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 93267

                                                                    
Query: 127   ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
             ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 93268 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 93322



 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                         
Query: 67    ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
             |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 96100 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 96041

                                                                    
Query: 127   ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
             ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 96040 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 95986



to top

>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete
             sequence
          Length = 93060

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                         
Query: 67    ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
             |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 80994 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 80935

                                                                    
Query: 127   ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
             ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 80934 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 80880



 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Plus

                                                                         
Query: 67    ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
             |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 78102 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 78161

                                                                    
Query: 127   ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
             ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 78162 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 78216



to top

>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420) mRNA, complete cds
          Length = 883

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 733 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 679



to top

>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 733 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 679



to top

>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 798

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 733 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 679



to top

>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein (At2g34420; T31E10.24) mRNA, complete cds
          Length = 969

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 730



to top

>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 730



to top

>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 730



to top

>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 1024

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 730



to top

>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 995

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 730



to top

>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds
          Length = 969

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 730



to top

>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 949

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaaaat 766

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 765 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 711



to top

>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB87ZE01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 291

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 164 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 105

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 104 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 50



to top

>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS62ZC05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 766

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 765 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 711



to top

>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS5ZF09 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 828 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 769

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 768 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 714



to top

>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB71ZG07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 919

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Plus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 91  ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 150

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 151 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 205



to top

>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding
            protein
          Length = 1405

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 98/115 (85%)
 Strand = Plus / Minus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| |||||||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 1093 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 1034

                                                                   
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 1033 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 979



to top

>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 95.6 bits (48), Expect = 5e-17
 Identities = 94/110 (85%)
 Strand = Plus / Minus

                                                                       
Query: 76  cgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaaga 135
           |||||||||||||||||||||| |||||| |||| || ||||||| || ||||||   ||
Sbjct: 850 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggagaggtggtcggcga 791

                                                             
Query: 136 ggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||||  |  || ||||| |||||||||||||||||||| |||||||||
Sbjct: 790 ggttctcgagggggcccttgccggtgacgatggcctgcacgaagaagccg 741



to top

>ref|NM_192636.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 789

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 779 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 720

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 719 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 663



to top

>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 96/113 (84%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||| ||||||| |||||| |||| || |||||||| ||||||
Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 1744

                                                                 
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||   ||||||||  | ||| ||||| ||||||||||||||||| || |||||
Sbjct: 1743 tcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaa 1691



to top

>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1664

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 1240 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 1181

                                                                     
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
            ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 1180 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 1124



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                            
Query: 69       ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
                |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 23604322 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 23604263

                                                                         
Query: 129      tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
                ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 23604262 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 23604206



 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                            
Query: 69       ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
                |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 30025128 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 30025069

                                                                     
Query: 129      tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
                ||    |||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 30025068 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 30025016



to top

>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0518F01
          Length = 154541

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                         
Query: 69    ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
             |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 67021 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 66962

                                                                      
Query: 129   tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
             ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 66961 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 66905



to top

>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full
           insert sequence
          Length = 1180

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 850 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 791

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 790 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 734



to top

>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full
           insert sequence
          Length = 1126

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 849 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 790

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 789 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 733



to top

>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 96/113 (84%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||| ||||||
Sbjct: 855 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 796

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||   ||||||||  | ||| ||||| ||||||||||||||||| || |||||
Sbjct: 795 tcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaa 743



to top

>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein
          Length = 1442

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 1279 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 1220

                                                                     
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
            ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 1219 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 1163



to top

>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full
           insert sequence
          Length = 1040

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 99/117 (84%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 857 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 798

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           || |  |||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 797 tcgagcaggttctccaaggggcccttgccggtgacgatggcctggacgaagaagccg 741



to top

>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 96/113 (84%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||| ||||||| |||||| |||| || |||||||| ||||||
Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 1744

                                                                 
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||   ||||||||  | ||| ||||| ||||||||||||||||| || |||||
Sbjct: 1743 tcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaa 1691



to top

>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein
           (CipLhcb1) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 975

 Score = 89.7 bits (45), Expect = 3e-15
 Identities = 97/115 (84%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||| ||||||| |||||| |||| |||||||| || | ||
Sbjct: 845 ttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaaggt 786

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||| |||||||| || |||||
Sbjct: 785 ggtcggcgaggttctccaatggtccctttccggtgacaatggcctggacgaagaa 731



to top

>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete
             sequence
          Length = 139771

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Plus

                                                                         
Query: 69    ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
             |||||| |||||||||||||| | ||||| |||||| ||   || |||||||||| ||||
Sbjct: 78979 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 79038

                                                                      
Query: 129   tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
             || ||||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 79039 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 79095



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                            
Query: 69       ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
                |||||| |||||||||||||| | ||||| |||||| ||   || |||||||||| ||||
Sbjct: 21808837 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 21808778

                                                                         
Query: 129      tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
                || ||||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 21808777 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 21808721



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                            
Query: 69       ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
                |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 10793775 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 10793716

                                                                         
Query: 129      tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
                ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 10793715 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 10793659



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                            
Query: 69       ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
                |||||| |||||||||||||| | ||||| |||||| ||   || |||||||||| ||||
Sbjct: 21801866 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 21801807

                                                                         
Query: 129      tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
                || ||||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 21801806 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 21801750



to top

>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                         
Query: 69    ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
             |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 17498 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 17439

                                                                      
Query: 129   tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
             ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 17438 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 17382



to top

>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                          
Query: 69     ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
              |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 130393 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 130334

                                                                       
Query: 129    tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
              ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 130333 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 130277



to top

>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding
           protein
          Length = 1126

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| ||||||| |||||| | ||||| |||||| ||   || |||||||||| ||||
Sbjct: 821 ccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 762

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           || ||||||||||  |  || ||||| |||||||||||||||||||| |||||||||
Sbjct: 761 tcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccg 705



to top

>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 843 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 784

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 783 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 727



to top

>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 788 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 732



to top

>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 850 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 791

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 790 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 734



to top

>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full
           insert sequence
          Length = 1106

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| ||   || |||||||||| ||||
Sbjct: 836 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 777

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           || ||||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 776 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 720



to top

>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full
           insert sequence
          Length = 650

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 379 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 320

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || ||| |||||
Sbjct: 319 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagcagccg 263



to top

>gb|AY112240.1| Zea mays CL187_6 mRNA sequence
          Length = 770

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| ||||||| |||||| | ||||| |||||| ||   || |||||||||| ||||
Sbjct: 469 ccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 410

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           || ||||||||||  |  || ||||| |||||||||||||||||||| |||||||||
Sbjct: 409 tcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccg 353



to top

>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 788 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 732



to top

>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full
           insert sequence
          Length = 685

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| ||   || |||||||||| ||||
Sbjct: 411 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 352

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           || ||||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 351 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 295



to top

>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 788 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 732



to top

>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA,
           nuclear gene encoding chloroplast protein, complete cds
          Length = 1027

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| ||   || |||||||||| ||||
Sbjct: 825 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 766

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           || ||||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 765 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccg 709



to top

>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding
           protein mRNA, complete cds
          Length = 997

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 95/113 (84%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||||||||||| |||||| |||| || |||||||||| ||||
Sbjct: 864 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgaggtgg 805

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||   ||||||||  |  || || || ||||||||||||||||| || |||||
Sbjct: 804 tcggcgaggttctcgatggggcctttgccggtgacgatggcctggacgaagaa 752



to top

>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||||||||||| |||||| ||   || |||||||||||||||
Sbjct: 1527 ccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcgatgtgg 1468

                                                                     
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
            ||    |||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 1467 tcggccaggttctcgatggggcccttgccggtgacgatggcctgaacgaagaagccg 1411



to top

>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 85.7 bits (43), Expect = 4e-14
 Identities = 98/117 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| |||| || |||||||||| ||||
Sbjct: 829 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 770

                                                                    
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||   ||||||||  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 769 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccg 713



to top

>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1)
           mRNA, complete cds
          Length = 1008

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 799

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 798 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 744



to top

>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence
          Length = 775

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||||||||||| |||||| |||| ||||| || || |  |
Sbjct: 627 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaat 568

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 567 ggtcggcgaggttctccaatggtccctttccggtgacgatggcttgaacgaagaa 513



to top

>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein
          Length = 2774

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| |||||||||||||||||||||| |||||| |||| ||||| || || |  |
Sbjct: 2371 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaat 2312

                                                                   
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||   ||| ||||  | ||||||||||||||||||||| ||||| || |||||
Sbjct: 2311 ggtcggcgagattctccaacggtccctttccggtgacgatagcctgaacaaagaa 2257



to top

>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence
          Length = 124732

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Plus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| | ||||| |||||||||||||| |||||| |||| |||||||| |||||||
Sbjct: 8576 ttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagcgatgt 8635

                                                                   
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||    ||||| || |  |||||||||||||| |||||||| || || |||||
Sbjct: 8636 ggtcagcaaggttttttaaaggtccctttccggtcacgatggcttgaacaaagaa 8690



 Score = 50.1 bits (25), Expect = 0.002
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 78   aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtc 130
            ||||| ||||| |||||||| |||||| |||| ||||| || |||||||||||
Sbjct: 2057 aagtttgtggcaaaggcccaagcgttgctgttgactggatcagcgatgtggtc 2005



 Score = 50.1 bits (25), Expect = 0.002
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| | ||||| ||||| |||||||| |||||| |||| || ||||| | ||| |
Sbjct: 212 ttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtcagtgatat 153

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||    |||||||  |  |||||||||||||| || |||||||| || |||||
Sbjct: 152 ggtcggcaaggttctctagaggtccctttccggttacaatggcctgaacgaagaa 98



to top

>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 851

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 737

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 736 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 682



to top

>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At2g34430) mRNA, complete cds
          Length = 1019

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 799

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 798 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 744



to top

>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 1003

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 799

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 798 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 744



to top

>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete
           cds
          Length = 1009

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 864 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 805

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 804 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 750



to top

>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS41ZH03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 638

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 516 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 457

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 456 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 402



to top

>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 959

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||||||| ||||||| |||||| |||  ||||||||||| |  |
Sbjct: 835 ttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggccaaat 776

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 775 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 721



to top

>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 911

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 97/115 (84%), Gaps = 1/115 (0%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||| ||||||||||||||||| |||||| |||| ||||||||||| |  |
Sbjct: 827 ttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 769

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  |  ||||||||||||||||||||||| || || |||||
Sbjct: 768 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 714



to top

>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence
          Length = 979

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 799

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 798 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 744



to top

>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide
          Length = 2775

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| |||||||||||||||||||||| |||||| |||| ||||| || || |  |
Sbjct: 2372 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaat 2313

                                                                   
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||   ||| ||||  | ||||||||||||||||||||| ||||| || |||||
Sbjct: 2312 ggtcggcgagattctccaacggtccctttccggtgacgatagcctgaacaaagaa 2258



to top

>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b
            binding protein
          Length = 1301

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 1096 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 1037

                                                                   
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 1036 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 982



to top

>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein. (At2g34430) mRNA, complete cds
          Length = 853

 Score = 81.8 bits (41), Expect = 7e-13
 Identities = 96/115 (83%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| || ||| |||| ||||| || || | ||
Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 737

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||   ||||||||  | |||||||||||||||||| |||||||| || |||||
Sbjct: 736 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaa 682



to top

>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 791 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 732

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||    |||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 731 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 679



to top

>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Plus

                                                                         
Query: 69    ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
             |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 13883 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 13942

                                                                  
Query: 129   tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
             ||    |||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 13943 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 13995



to top

>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                         
Query: 69    ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
             |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 21118 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 21059

                                                                  
Query: 129   tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
             ||    |||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 21058 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 21006



to top

>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 97/117 (82%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||| | ||||| |||||| |||| || ||||||| || ||||
Sbjct: 2714 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtgaggtgg 2655

                                                                     
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
            ||   ||||||||  |  || ||||| ||||||||||| |||||||| |||||||||
Sbjct: 2654 tcggcgaggttctcgatggggcccttgccggtgacgatagcctgcacgaagaagccg 2598



to top

>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 813

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||    |||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 812 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 760



to top

>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 813

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||    |||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 812 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 760



to top

>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 815

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||    |||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 814 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 762



to top

>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 815

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||    |||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 814 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaa 762



to top

>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds
          Length = 1633

 Score = 77.8 bits (39), Expect = 1e-11
 Identities = 94/113 (83%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||||||||||| |||||| |||| || ||||||||||  |||
Sbjct: 1188 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgagatgg 1129

                                                                 
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||    | |||||  |  || ||||| |||||||||||||||||||| |||||
Sbjct: 1128 tccgccaagttctcgagggggcccttcccggtgacgatggcctgcacgaagaa 1076



to top

>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding
           protein
          Length = 869

 Score = 75.8 bits (38), Expect = 4e-11
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||  ||||||| |||||| |||| || |||||||||| ||||||   ||||
Sbjct: 794 aagttggtggcataggcccatgcgttgttgttgacggggtcggcgaggtggtcggcgagg 735

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||| ||||| ||||||||||||||||| || |||||
Sbjct: 734 ttctcgagcgggcccttgccggtgacgatggcctggacgaagaa 691



to top

>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein
          Length = 934

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 87/104 (83%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| ||||||| ||||| || ||||| |||||| |||| || |||||||||||||||
Sbjct: 812 ccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatgtgg 753

                                                       
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctg 172
           ||   |||||||| ||  || ||||| |||||||| ||||||||
Sbjct: 752 tcagcgaggttctcaagagggcccttgccggtgactatggcctg 709



to top

>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b-
           binding protein ( LHCP )
          Length = 1030

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||||||||||| || ||| |||| || ||||||||||  |||
Sbjct: 968 ccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcgagatgg 909

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||    | |||||  |  || ||||| |||||||||||||||||||| |||||
Sbjct: 908 tccgccaagttctcgaggggccccttcccggtgacgatggcctgcacgaagaa 856



to top

>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding
           protein (CABII) mRNA, partial cds
          Length = 714

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 93/113 (82%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | ||||| |||||| ||   || ||||| ||||  |||
Sbjct: 571 ccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgacatgg 512

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           || ||||||||||  |  |||||||| ||||||||||||||||| || |||||
Sbjct: 511 tcgaagaggttctcgatgggtcccttgccggtgacgatggcctggacgaagaa 459



to top

>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 67.9 bits (34), Expect = 1e-08
 Identities = 95/116 (81%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| | |||||||||||||| ||||| || ||| |||| || |||||||||||||||
Sbjct: 803 ccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgatgtgg 744

                                                                   
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagcc 184
           ||   |||||||| ||  || ||||| || |||||||| || || || ||||||||
Sbjct: 743 tcagcgaggttctcaagtgggcccttgcccgtgacgatagcttggacaaagaagcc 688



to top

>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II
          Length = 518

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 94/115 (81%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| |||||||||| ||||||||||| |||||| |||| |||||||| || |  |
Sbjct: 370 ttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtcagccaaat 311

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           | ||   ||| ||||  | |||||||||||||||||| || ||||| || |||||
Sbjct: 310 gatcagcgagattctccaacggtccctttccggtgacaatagcctgaacaaagaa 256



to top

>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 65.9 bits (33), Expect = 4e-08
 Identities = 86/104 (82%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| | |||||||||||| ||||||| |||||| |||| || |||||||||| ||||
Sbjct: 833 ccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 774

                                                       
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctg 172
           ||   || |||||  |  || ||||| |||||||||||||||||
Sbjct: 773 tctgtgatgttctccagtggccccttgccggtgacgatggcctg 730



to top

>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||||||||||||||| |||||
Sbjct: 733 ggtccctttccggtgacgatggcctgcacgaagaa 699



to top

>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||||||||||||||| |||||
Sbjct: 733 ggtccctttccggtgacgatggcctgcacgaagaa 699



to top

>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||||||||||||||| |||||
Sbjct: 733 ggtccctttccggtgacgatggcctgcacgaagaa 699



to top

>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 34/35 (97%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||||||||||||||| |||||
Sbjct: 733 ggtccctttccggtgacgatggcctgcacgaagaa 699



to top

>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 87/106 (82%)
 Strand = Plus / Minus

                                                                       
Query: 76  cgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaaga 135
           |||||||||||||||||||||| |||||| |||| || ||||| |||| ||||||    |
Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggcca 636

                                                         
Query: 136 ggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            |||||  |  |||||||| ||||| ||||||||||| || |||||
Sbjct: 635 agttctcgaggggtcccttgccggtcacgatggcctggacgaagaa 590



to top

>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding
           polypeptide (Lhcb1) mRNA, partial cds
          Length = 414

 Score = 63.9 bits (32), Expect = 2e-07
 Identities = 87/106 (82%)
 Strand = Plus / Minus

                                                                       
Query: 76  cgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaaga 135
           |||||||||||||  ||||||| |||||| |||| || |||||||| | ||| ||   ||
Sbjct: 275 cgaagttggtggcataggcccaggcgttgttgttaacggggtcggccaggtgatcagcga 216

                                                         
Query: 136 ggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||||  |  ||||| || |||||||||||||||||||| |||||
Sbjct: 215 ggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaa 170



to top

>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein
          Length = 1197

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||  ||||||| |||||| || | || |||||||| | ||| 
Sbjct: 881 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccaggtga 822

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||   ||||||||  |  ||||| || |||||||||||||||||||| |||||
Sbjct: 821 tcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaa 769



to top

>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || ||||| || | ||| 
Sbjct: 857 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccaggtga 798

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||   ||||||||  |  ||||| || |||||||| ||||||||||| |||||
Sbjct: 797 tcagtgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaa 745



to top

>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein
          Length = 2574

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                        
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
            |||||| |||||||||||||  ||||||| |||||| || | || |||||||| | ||| 
Sbjct: 1959 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccaggtga 1900

                                                                 
Query: 129  tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||   ||||||||  |  ||||| || |||||||||||||||||||| |||||
Sbjct: 1899 tcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaa 1847



to top

>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| ||||||| |||||| |||| || ||||| || | ||| 
Sbjct: 866 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccaggtga 807

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||   ||||||||  |  ||||| || |||||||| ||||||||||| |||||
Sbjct: 806 tcagcgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaa 754



to top

>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 989

 Score = 61.9 bits (31), Expect = 6e-07
 Identities = 92/113 (81%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| |||||||||||||| | | ||| |||||| ||   || ||||||| || ||||
Sbjct: 817 ccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggtgacgtgg 758

                                                                
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           || ||||||||||  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 757 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaa 705



to top

>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1);
           chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds
          Length = 1044

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 751



to top

>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein
           (At1g29930) mRNA, complete cds
          Length = 835

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 788 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 729

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 728 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 685



to top

>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b
           binding protein (At1g29930) mRNA, complete cds
          Length = 1014

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 751



to top

>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1019

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 751



to top

>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 1045

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 751



to top

>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds
          Length = 999

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 751



to top

>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS89ZA03 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 823 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 764

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 763 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 720



to top

>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence,
           complete sequence
          Length = 82053

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 734 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 675

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 674 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 631



to top

>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete
             sequence
          Length = 101075

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Plus

                                                                         
Query: 78    aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
             |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 16127 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 16186

                                                         
Query: 138   ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
             ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 16187 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 16230



 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                         
Query: 78    aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
             ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 19880 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 19821

                                                         
Query: 138   ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
             ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 19820 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 19777



 Score = 48.1 bits (24), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                         
Query: 78    aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
             |||||||| ||||||||||| |||||| |||| ||||| |||||
Sbjct: 22526 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 22483



to top

>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein
          Length = 1109

 Score = 60.0 bits (30), Expect = 2e-06
 Identities = 85/104 (81%)
 Strand = Plus / Minus

                                                                        
Query: 78   aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
            |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 1005 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 946

                                                        
Query: 138  ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 945  ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 902



to top

>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 93/115 (80%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| ||||||||||||| |||||||| || ||| |||| ||||| || || |  |
Sbjct: 838 ttccggggacgaagttggtggcaaaggcccatgcattgttgttgactggatcagccaaat 779

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||    || ||||  | ||||||||||||||||||||| ||||| || |||||
Sbjct: 778 ggtcagcaagattctccaacggtccctttccggtgacgatagcctgaacgaagaa 724



to top

>emb|BX814964.1|CNS0AE8Q Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS20ZE02 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 307

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 76/92 (82%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 158 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 99

                                           
Query: 138 ttcttaaccggtccctttccggtgacgatggc 169
           ||||  | ||||||||| || |||||||||||
Sbjct: 98  ttctctatcggtcccttaccagtgacgatggc 67



to top

>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding
           protein, complete cds
          Length = 1055

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           |||||| |||||||||||||| ||||||| || ||| ||||||| ||||||||
Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggc 840



to top

>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end
          Length = 351

 Score = 58.0 bits (29), Expect = 1e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtc 130
           ||||| ||||| |||||||| |||||| |||| ||||||||||| ||||||||
Sbjct: 335 aagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaatgtggtc 283



to top

>gb|DQ226787.1| Boechera divaricarpa isolate SLW-B-B06 mRNA sequence
          Length = 827

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           |||||||||||||||||||| |||||| |||| ||||| |||||
Sbjct: 616 aagttggtggcgaaggcccatgcgttgttgttaactggatcggc 573



to top

>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 752

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           |||||||| |||||||||||||||||||| |||||
Sbjct: 730 ggtcccttgccggtgacgatggcctgcacgaagaa 696



to top

>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||| ||||||||||| |||||
Sbjct: 733 ggtccctttccggtgacaatggcctgcacgaagaa 699



to top

>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           |||||||||||||||||||||||||| || |||||
Sbjct: 733 ggtccctttccggtgacgatggcctgaacgaagaa 699



to top

>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           |||||||||||||||||||| |||||||| |||||
Sbjct: 733 ggtccctttccggtgacgattgcctgcacgaagaa 699



to top

>gb|M95068.1|MZEORFI Zea mays putative light-harvesting chlorophyll A/B binding  protein
           mRNA, partial cds
          Length = 191

 Score = 56.0 bits (28), Expect = 4e-05
 Identities = 83/103 (80%)
 Strand = Plus / Minus

                                                                       
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtgg 128
           |||||| ||||||| |||||| | ||||| |||||| ||   || |||||||  | ||||
Sbjct: 103 ccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggssacgtgg 44

                                                      
Query: 129 tcnaagaggttcttaaccggtccctttccggtgacgatggcct 171
           || ||||||||||  |  || ||||| ||||||||||||||||
Sbjct: 43  tcgaagaggttctcgatggggcccttgccggtgacgatggcct 1



to top

>ref|XM_478729.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 972

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 756 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 712



to top

>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 995

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 736



to top

>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1007

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 736



to top

>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1108

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 783

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 782 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 738



to top

>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1000

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 741



to top

>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1012

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 741



to top

>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1032

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 787 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 743



to top

>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA
          Length = 1159

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 821

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 820 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 776



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                            
Query: 81       ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
                ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 22434794

                                                             
Query: 141      ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
                |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 22434793 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 22434749



to top

>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0406F06
          Length = 144533

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                         
Query: 81    ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
             ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 95861

                                                          
Query: 141   ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
             |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 95860 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 95816



to top

>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full
           insert sequence
          Length = 1111

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 741



to top

>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full
           insert sequence
          Length = 1012

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 741



to top

>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full
           insert sequence
          Length = 1000

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 741



to top

>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full
           insert sequence
          Length = 973

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 756 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 712



to top

>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full
           insert sequence
          Length = 1012

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 741



to top

>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full
           insert sequence
          Length = 995

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 736



to top

>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full
           insert sequence
          Length = 1007

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 736



to top

>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full
           insert sequence
          Length = 1000

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 741



to top

>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full
           insert sequence
          Length = 1032

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 85/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||||||| || |||||||||
Sbjct: 787 tccaaggggcccttgccggtgacgatggcctggacgaagaagccg 743



to top

>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB)
           mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1042

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 39/43 (90%)
 Strand = Plus / Minus

                                                      
Query: 76  cgaagttggtggcgaaggcccacgcgttgatgttcactgggtc 118
           |||||||||||||||||||||| || ||| |||| ||||||||
Sbjct: 814 cgaagttggtggcgaaggcccaagcattgttgttgactgggtc 772



to top

>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 88/109 (80%)
 Strand = Plus / Minus

                                                                       
Query: 76  cgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaaga 135
           ||||||||||||| | |  |||||||||| |||| || |||||||| ||||||||    |
Sbjct: 987 cgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtggtcggcaa 928

                                                            
Query: 136 ggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagcc 184
           ||| ||  |  || ||||| |||||||| ||||||||||| ||||||||
Sbjct: 927 ggtcctccaatgggcccttgccggtgacaatggcctgcacaaagaagcc 879



to top

>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2)
           mRNA, complete cds
          Length = 1176

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 855 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 796

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 795 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 752



to top

>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence
          Length = 762

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 746 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 687

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 686 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 643



to top

>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative
           photosystem II type I chlorophyll a /b binding protein
           (At1g29920) mRNA, complete cds
          Length = 1044

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 841 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 782

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 781 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 738



to top

>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding
           protein, putative (At1g29920) mRNA, complete cds
          Length = 994

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 841 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 782

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 781 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 738



to top

>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920)
           mRNA, complete cds
          Length = 898

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 788 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 729

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 728 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 685



to top

>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920;
           F1N18.4) mRNA, complete cds
          Length = 1007

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 840 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 781

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 780 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 737



to top

>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 804

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 788 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 729

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 728 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 685



to top

>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 834 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 775

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 774 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 731



to top

>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds
          Length = 1027

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 840 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 781

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 780 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 737



to top

>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence
          Length = 1041

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 855 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 796

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 795 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 752



to top

>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein
          Length = 1060

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||| ||||||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 994 aagttggttgcgaaggcccatgcgttgttgttgactggatcggccaaatggtcagcaagg 935

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 934 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 891



to top

>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein
          Length = 999

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 84/104 (80%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 933 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 874

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 873 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 830



to top

>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear
           gene encoding chloroplast protein, complete cds
          Length = 977

 Score = 52.0 bits (26), Expect = 6e-04
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtc 118
           |||||| |||||||||||||| ||||||| || ||| |||| ||||||||
Sbjct: 816 ccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtc 767



to top

>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein
            of photosystem II
          Length = 7650

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 150  ccctttccggtgacgatggcctgcacnaagaagccg 185
            ||||||||||||| |||| ||||||| |||||||||
Sbjct: 7047 ccctttccggtgaggatgccctgcacgaagaagccg 7012



 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||||||||||| |||| |||||||  ||||||||
Sbjct: 263 ccctttccggtgaggatgccctgcacggagaagccg 228



to top

>emb|X02360.1|PECAB22R Petunia gene for chlorophyll a/b binding protein cab 22R
          Length = 1187

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 150 ccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||| |||||||| |||||
Sbjct: 946 ccctttccggtgacgatagcctgcacaaagaa 915



to top

>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein
          Length = 1011

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| |||||||||||||| |||||||||
Sbjct: 715 cccttgccggtcacgatggcctgcacgaagaagccg 680



to top

>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 986

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                      
Query: 123 atgtggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           |||||||| |  ||||||| ||| || ||||| ||||||||||||||||| || |||||
Sbjct: 788 atgtggtcgactaggttctcaactgggcccttgccggtgacgatggcctggacgaagaa 730



to top

>gb|K00972.1|PETCAB146 Petunia major chlorophyll a/b binding protein (Cab) clone pCab146,
           3' end and flank
          Length = 498

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 150 ccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||| |||||||| |||||
Sbjct: 290 ccctttccggtgacgatagcctgcacaaagaa 259



to top

>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 71/87 (81%)
 Strand = Plus / Minus

                                                                       
Query: 98  cgcgttgatgttcactgggtcggcgatgtggtcnaagaggttcttaaccggtccctttcc 157
           ||||||| |||| || |||||||| ||||||||    |||||||  |  || ||||| ||
Sbjct: 760 cgcgttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgcc 701

                                      
Query: 158 ggtgacgatggcctgcacnaagaagcc 184
           |||||| ||||||||||| ||||||||
Sbjct: 700 ggtgacaatggcctgcacaaagaagcc 674



to top

>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial
           cds
          Length = 551

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           |||||| |||||||||||||| | ||||| |||||| |||| || ||||||||
Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggc 337



to top

>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds
          Length = 1135

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 95/119 (79%)
 Strand = Plus / Minus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| | ||||| |||||||||||||| || ||| | || |||||||| ||||  |
Sbjct: 1001 ttccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcgagat 942

                                                                       
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
            ||||    |||||||  |  || ||||||||||||||||| || || || |||||||||
Sbjct: 941  ggtcagcaaggttctccaatggaccctttccggtgacgatagcttgaacaaagaagccg 883



to top

>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll
           A/B-binding protein gene, complete cds
          Length = 1260

 Score = 50.1 bits (25), Expect = 0.002
 Identities = 92/115 (80%)
 Strand = Plus / Minus

                                                                       
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
           |||||||| | |||||||||||  ||||||| || ||| |||| |||||||| || | ||
Sbjct: 987 ttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaaggt 928

                                                                  
Query: 127 ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||    | |||||  |  |||||||||||||| ||||||||||| || |||||
Sbjct: 927 ggtcagccaagttctccaatggtccctttccggtcacgatggcctgaacgaagaa 873



to top

>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3);
           chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds
          Length = 1020

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           |||||||| ||||||||||| |||||| |||| ||||| |||||
Sbjct: 841 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798



to top

>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial
           sequence; nuclear gene for chloroplast product
          Length = 255

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||||||||| | ||| ||||||||||| |||||||||
Sbjct: 100 ggtccctttccagcgacaatggcctgcacaaagaagccg 62



to top

>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910)
           mRNA, complete cds
          Length = 870

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           |||||||| ||||||||||| |||||| |||| ||||| |||||
Sbjct: 788 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 745



to top

>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           |||||||| ||||||||||||||||| || |||||
Sbjct: 733 ggtcccttcccggtgacgatggcctgaacgaagaa 699



to top

>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           |||||||| ||||||||||||||||| || |||||
Sbjct: 733 ggtcccttcccggtgacgatggcctgkacgaagaa 699



to top

>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||| || |||||||||||||||||||| |||||
Sbjct: 733 ggtcctttcccggtgacgatggcctgcacgaagaa 699



to top

>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||| || |||||||||||||||||||| |||||
Sbjct: 733 ggtcctttcccggtgacgatggcctgcacgaagaa 699



to top

>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||| || |||||||||||||||||||| |||||
Sbjct: 733 ggtcctttcccggtgacgatggcctgcacgaagaa 699



to top

>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||| || |||||||||||||||||||| |||||
Sbjct: 733 ggtcctttcccggtgacgatggcctgcacgaagaa 699



to top

>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910;
           F1N18.5) mRNA, complete cds
          Length = 1019

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           |||||||| ||||||||||| |||||| |||| ||||| |||||
Sbjct: 841 aagttggttgcgaaggcccatgcgttgttgttgactggatcggc 798



to top

>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein
           (CipLhcb1*2) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 932

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           |||||||||||| ||||||| |||||| |||| || ||||||||
Sbjct: 835 aagttggtggcgtaggcccaggcgttgttgttgacagggtcggc 792



to top

>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein
          Length = 1361

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 94/118 (79%)
 Strand = Plus / Minus

                                                                        
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgt 126
            |||||||| |||||||||||||  ||||||| |||||| |||| || ||  | || | ||
Sbjct: 1037 ttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtccagcaaggt 978

                                                                      
Query: 127  ggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaagcc 184
            | ||   ||||||||  |  || |||||||||||||| |||||||| || ||||||||
Sbjct: 977  gatcggcgaggttctccaatggaccctttccggtgacaatggcctgaacaaagaagcc 920



to top

>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA,
           complete cds
          Length = 983

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           |||||||||||  ||||||| |||||| |||| |||||||||||
Sbjct: 836 aagttggtggcataggcccatgcgttgttgttgactgggtcggc 793



to top

>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein
           (CAB2) mRNA, nuclear gene encoding chloroplast protein,
           complete cds
          Length = 1027

 Score = 48.1 bits (24), Expect = 0.009
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           ||||| |||||||||||||| || ||| |||| |||||||||||
Sbjct: 800 aagtttgtggcgaaggcccaagcattgttgttaactgggtcggc 757



to top

>gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvesting complex II (Lhc
           II) mRNA, partial cds; nuclear gene for chloroplast
           product
          Length = 537

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 156 ccggtgacgatggcctgcacnaagaagccg 185
           ||||| |||||||||||||| |||||||||
Sbjct: 470 ccggtcacgatggcctgcacgaagaagccg 441



to top

>emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b binding protein
          Length = 1470

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                     
Query: 125  gtggtcnaagaggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||||  ||||||||| ||  ||||||||||| ||||||||||| || || |||||
Sbjct: 1083 gtggtcatagaggttctcaattggtccctttcctgtgacgatggcttgaacaaagaa 1027



to top

>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full
           insert sequence
          Length = 1107

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 84/105 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| || |||| |||||| ||   || |||||||||| |||||| |  ||||||
Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 782

                                                        
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaagccg 185
           |  |  || ||||| ||||||||||||| ||| || |||||||||
Sbjct: 781 tccaaggggcccttgccggtgacgatggtctggacgaagaagccg 737



to top

>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds
          Length = 1100

 Score = 46.1 bits (23), Expect = 0.037
 Identities = 81/101 (80%)
 Strand = Plus / Minus

                                                                       
Query: 81  ttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttc 140
           ||||||||| | ||||| |||||| ||   || |||||||||| |||||| || | ||||
Sbjct: 820 ttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtggtcgaaaaagttc 761

                                                    
Query: 141 ttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           |  |  || ||||| ||||||||||||||||| || |||||
Sbjct: 760 tcgatggggcccttgccggtgacgatggcctggacgaagaa 720



to top

>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                       
Query: 90  aaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttcttaaccggt 149
           |||||||| |||||| |||| || ||||| || | ||||||    |||||||  | ||| 
Sbjct: 662 aaggcccaagcgttgttgttaacggggtctgctaggtggtcagcaaggttctccaacggg 603

                                           
Query: 150 ccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||| ||||| || |||||
Sbjct: 602 ccctttccggtgacgatagcctggacgaagaa 571



to top

>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS93ZB12 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 972

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 84/104 (80%), Gaps = 1/104 (0%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           ||||||||||| |||||||| |||||| |||| ||||| ||||| |  |||||    |||
Sbjct: 825 aagttggtggc-aaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 767

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  | ||||||||| || ||||||||||| || || |||||
Sbjct: 766 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaa 723



to top

>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1078

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 83/104 (79%)
 Strand = Plus / Minus

                                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagagg 137
           |||||||||||| ||||||| |||||| |||| || ||||| |||| ||| ||   ||||
Sbjct: 822 aagttggtggcgtaggcccaggcgttgttgttgacagggtcagcgaggtgatcggcgagg 763

                                                       
Query: 138 ttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||  |  ||||| || || || ||||||||||| || |||||
Sbjct: 762 ttctctaggggtcctttgcctgtcacgatggcctggacgaagaa 719



to top

>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene,
            complete cds
          Length = 2095

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                         
Query: 137  gttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
            ||||| ||| || ||||| |||||||| ||||||||||| |||||
Sbjct: 1671 gttctcaacggggcccttgccggtgacaatggcctgcacgaagaa 1627



to top

>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein
           precursor, complete cds
          Length = 964

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttg 104
           |||||||  |||||||||||||| ||||||| ||||||
Sbjct: 841 ttccgggaacgaagttggtggcgtaggcccaggcgttg 804



to top

>gb|AY786530.1| Haematococcus pluvialis chloroplast major light-harvesting complex
           II protein m9 mRNA, partial cds; nuclear gene for
           chloroplast product
          Length = 577

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 375 cccttgccggtcacgatggcctggacgaagaagccg 340



to top

>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein
           (Lhcb) mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1024

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 706 cccttgccggtcacgatggcctgaacgaagaagccg 671



to top

>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb3) mRNA, complete cds
          Length = 1314

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 758 cccttgccggtcacgatggcctggacgaagaagccg 723



to top

>gb|AY430082.1| Trifolium pratense chlorophyll a/b binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 987

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                    
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtc 118
           ||||||||||| || ||||| |||||| |||| ||||||||
Sbjct: 837 aagttggtggcaaaagcccaggcgttgttgttgactgggtc 797



to top

>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
            m1 gene, complete cds; nuclear gene for chloroplast
            product
          Length = 1934

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 150  ccctttccggtgacgatggcctgcacnaagaagccg 185
            ||||| ||||| ||||||||||| || |||||||||
Sbjct: 1414 cccttgccggtcacgatggcctgaacgaagaagccg 1379



to top

>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m6 mRNA, complete cds; nuclear gene for chloroplast
           product
          Length = 1094

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 713 cccttgccggtcacgatggcctggacgaagaagccg 678



to top

>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m7 (Lhcbm7) mRNA, complete cds
          Length = 1016

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 703 cccttgccggtcacgatggcctggacgaagaagccg 668



to top

>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein
           m10 (Lhcbm10) mRNA, complete cds
          Length = 1077

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 704 cccttgccggtcacgatggcctggacgaagaagccg 669



to top

>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b
           binding protein (LhcII-1.3) mRNA, complete cds; nuclear
           gene for chloroplast product
          Length = 1100

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 698 cccttgccggtcacgatggcctggacgaagaagccg 663



to top

>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein,
           complete cds
          Length = 935

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 150 ccctttccggtgacgatggcctgcacnaagaa 181
           |||||||||||||| |||||||| || |||||
Sbjct: 732 ccctttccggtgacaatggcctggacaaagaa 701



to top

>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein
           precursor (cabII-2) mRNA, complete cds
          Length = 1068

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 686 cccttgccggtcacgatggcctggacgaagaagccg 651



to top

>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding
            protein, complete cds
          Length = 1500

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 150  ccctttccggtgacgatggcctgcacnaagaa 181
            |||||||||||||| |||||||| || |||||
Sbjct: 1306 ccctttccggtgacaatggcctgaacaaagaa 1275



 Score = 40.1 bits (20), Expect = 2.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 69   ccgggggcgaagttggtggcgaaggcccacgcgttg 104
            ||||||| ||||||||||||| | ||||| ||||||
Sbjct: 1387 ccgggggtgaagttggtggcgtaagcccaggcgttg 1352



to top

>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017
          Length = 330

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 150 ccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||| ||||| || |||||
Sbjct: 289 ccctttccggtgacgatagcctgaacgaagaa 258



to top

>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting
            chlorophyll a/b-binding protein 2, complete cds
          Length = 3125

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 76   cgaagttggtggcgaaggcccacgcgttg 104
            |||||||||||||| ||||||| ||||||
Sbjct: 3010 cgaagttggtggcgtaggcccatgcgttg 2982



to top

>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 150 ccctttccggtgacgatggcctgcacnaagaa 181
           ||||||||||||||||| ||||| || |||||
Sbjct: 771 ccctttccggtgacgatagcctgaacaaagaa 740



to top

>emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b binding protein
          Length = 1067

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 162 acgatggcctgcacnaagaagccg 185
           |||||||||||||| |||||||||
Sbjct: 678 acgatggcctgcactaagaagccg 655



to top

>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein
           precursor (Lhcb2) mRNA, complete cds
          Length = 1200

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 710 cccttgccggtcacgatggcctggacgaagaagccg 675



to top

>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I
           precursor (CAB) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1015

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 42/49 (85%)
 Strand = Plus / Minus

                                                            
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgg 115
           |||||||| | |||||||||||  ||||||| || ||| ||||||||||
Sbjct: 819 ttccggggacaaagttggtggcataggcccatgcattgttgttcactgg 771



to top

>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 150  ccctttccggtgacgatggcctgcacnaagaa 181
            ||||||||||||||||| ||||| || |||||
Sbjct: 1152 ccctttccggtgacgatagcctgaacgaagaa 1121



to top

>gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein gene, complete cds
          Length = 2544

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 150  ccctttccggtgacgatggcctgcacnaagaa 181
            ||||||||||| ||||| |||||||| |||||
Sbjct: 2355 ccctttccggtcacgatcgcctgcacgaagaa 2324



to top

>gb|M23531.1|DUNCBP D.salina major chlorophyll binding protein mRNA, complete cds
          Length = 1240

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| || |||||||||||||| || |||||||||
Sbjct: 907 cccttgccagtgacgatggcctggacgaagaagccg 872



to top

>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1)
            gene, complete cds
          Length = 2290

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 150  ccctttccggtgacgatggcctgcacnaagaagccg 185
            ||||| ||||| ||||||||||| || |||||||||
Sbjct: 1734 cccttgccggtcacgatggcctggacgaagaagccg 1699



to top

>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-4, complete cds
          Length = 988

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 690 cccttgccggtcacgatggcctgaacgaagaagccg 655



to top

>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-3, complete cds
          Length = 1256

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 702 cccttgccggtcacgatggcctggacgaagaagccg 667



to top

>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b
           binding protein LhcII-1.3, complete cds
          Length = 1107

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 150 ccctttccggtgacgatggcctgcacnaagaagccg 185
           ||||| ||||| ||||||||||| || |||||||||
Sbjct: 732 cccttgccggtcacgatggcctggacgaagaagccg 697



to top

>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-4, complete cds
          Length = 1781

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 150  ccctttccggtgacgatggcctgcacnaagaagccg 185
            ||||| ||||| ||||||||||| || |||||||||
Sbjct: 1327 cccttgccggtcacgatggcctgaacgaagaagccg 1292



to top

>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-3, complete cds
          Length = 1508

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 150  ccctttccggtgacgatggcctgcacnaagaagccg 185
            ||||| ||||| ||||||||||| || |||||||||
Sbjct: 1383 cccttgccggtcacgatggcctggacgaagaagccg 1348



to top

>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b
            binding protein LhcII-1.3, complete cds
          Length = 1835

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 150  ccctttccggtgacgatggcctgcacnaagaagccg 185
            ||||| ||||| ||||||||||| || |||||||||
Sbjct: 1574 cccttgccggtcacgatggcctggacgaagaagccg 1539



to top

>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 73/91 (80%)
 Strand = Plus / Minus

                                                                        
Query: 91   aggcccacgcgttgatgttcactgggtcggcgatgtggtcnaagaggttcttaaccggtc 150
            ||||||| |||||| |||| ||||||||||| | ||||||    |||||||  |  || |
Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggcaaggtggtcagcaaggttctctaatggac 2166

                                           
Query: 151  cctttccggtgacgatggcctgcacnaagaa 181
            ||||||||||||| || || ||||| |||||
Sbjct: 2165 cctttccggtgactatagcttgcacgaagaa 2135



to top

>emb|AL808032.1|CNS08CA7 BAC 30B15 of library A from Tetraodon nigroviridis
          Length = 109043

 Score = 42.1 bits (21), Expect = 0.58
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 138   ttcttaaccggtccctttccg 158
             |||||||||||||||||||||
Sbjct: 44020 ttcttaaccggtccctttccg 44000



to top

>gb|AC135915.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
              OSJNBa0082F22, complete sequence
          Length = 176038

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     ccgatggacagacggatggc 49
              ||||||||||||||||||||
Sbjct: 109238 ccgatggacagacggatggc 109219



 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 30     ccgatggacagacggatggc 49
              ||||||||||||||||||||
Sbjct: 106454 ccgatggacagacggatggc 106435



to top

>ref|XM_754456.1| Ustilago maydis 521 hypothetical protein (UM03402.1) partial mRNA
          Length = 1449

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 153 tttccggtgacgatggcctg 172
           ||||||||||||||||||||
Sbjct: 524 tttccggtgacgatggcctg 505



to top

>gb|AC122805.4| Mus musculus BAC clone RP23-296O23 from 3, complete sequence
          Length = 202733

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 5     gtacaagtacacatgcatat 24
             ||||||||||||||||||||
Sbjct: 22438 gtacaagtacacatgcatat 22419



to top

>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||| || |||||||| ||||||||||| |||||
Sbjct: 733 ggtcctttcccggtgacaatggcctgcacgaagaa 699



to top

>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||| || |||||||| ||||||||||| |||||
Sbjct: 733 ggtcctttcccggtgacaatggcctgcacgaagaa 699



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 30       ccgatggacagacggatggc 49
                ||||||||||||||||||||
Sbjct: 13146461 ccgatggacagacggatggc 13146442



 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 30       ccgatggacagacggatggc 49
                ||||||||||||||||||||
Sbjct: 13143677 ccgatggacagacggatggc 13143658



to top

>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein
          Length = 1036

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 84/106 (79%)
 Strand = Plus / Minus

                                                                       
Query: 76  cgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcgatgtggtcnaaga 135
           ||||||||||||| |||||||| || ||| |   ||||||||| || | ||||||  |||
Sbjct: 859 cgaagttggtggcaaaggcccaggcattgttagccactgggtcagcaaggtggtctgaga 800

                                                         
Query: 136 ggttcttaaccggtccctttccggtgacgatggcctgcacnaagaa 181
           |||||| ||  || |||||||| || || || || ||||| |||||
Sbjct: 799 ggttctcaatgggaccctttccagtaacaatagcttgcacgaagaa 754



to top

>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 67  ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtc 118
           |||||||| | |||||||||||| ||| ||| || ||| |||| ||||||||
Sbjct: 866 ttccggggacaaagttggtggcgtaggaccaggcattgttgttaactgggtc 815



to top

>emb|X16535.1|GMCAB4 G.max DNA for Cab4
          Length = 1470

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                
Query: 67   ttccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtc 118
            |||||||| | ||||| |||||  ||||||| || ||| |||||||||||||
Sbjct: 1120 ttccggggacaaagtttgtggcataggcccaagcattgttgttcactgggtc 1069



to top

>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1050

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||| || ||||||||||||||||| || |||||
Sbjct: 767 ggtcctttaccggtgacgatggcctggacgaagaa 733



to top

>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll
           a/b-binding protein
          Length = 1062

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 31/35 (88%)
 Strand = Plus / Minus

                                              
Query: 147 ggtccctttccggtgacgatggcctgcacnaagaa 181
           ||||| || ||||||||||||||||| || |||||
Sbjct: 764 ggtcctttaccggtgacgatggcctggacgaagaa 730



to top

>gb|AC132143.3| Mus musculus BAC clone RP23-20J10 from 3, complete sequence
          Length = 205880

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 5      gtacaagtacacatgcatat 24
              ||||||||||||||||||||
Sbjct: 125910 gtacaagtacacatgcatat 125891



to top

>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds
          Length = 1041

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 162 acgatggcctgcacnaagaagcc 184
           |||||||||||||| ||||||||
Sbjct: 707 acgatggcctgcacgaagaagcc 685



to top

>gb|M15214.1|TOMCBPH Tomato chlorophyll a/b-binding protein gene Cab-3T, complete cds
          Length = 339

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 78  aagttggtggcgaaggcccacgcgttgatgttcactgggtcggc 121
           ||||| ||||| ||||||||  ||||| |||| |||||||||||
Sbjct: 323 aagtttgtggcaaaggcccagacgttgttgttaactgggtcggc 280



to top

>ref|NM_113685.3| Arabidopsis thaliana LHCB2:4; chlorophyll binding AT3G27690
           (LHCB2:4) mRNA, complete cds
          Length = 946

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 67  ttccgggggcgaagttggtggcg 89
           |||||||| ||||||||||||||
Sbjct: 851 ttccggggacgaagttggtggcg 829



to top

>ref|NM_013115.1| Rattus norvegicus prostaglandin F receptor (Ptgfr), mRNA
          Length = 3000

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 148 gtccctttccggtgacgatggcc 170
           ||||||||| |||||||||||||
Sbjct: 921 gtccctttctggtgacgatggcc 943



to top

>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein
           mRNA, partial cds
          Length = 575

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 46/55 (83%)
 Strand = Plus / Minus

                                                                  
Query: 69  ccgggggcgaagttggtggcgaaggcccacgcgttgatgttcactgggtcggcga 123
           |||||| | ||||||||||| || ||||| || ||| |||| || ||||||||||
Sbjct: 465 ccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcga 411



to top

>gb|AC093365.10| Mus musculus chromosome 3, clone RP23-60O16, complete sequence
          Length = 236143

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 35     ggacagacggatggctgct 53
              |||||||||||||||||||
Sbjct: 115211 ggacagacggatggctgct 115193



to top

>gb|DQ226800.1| Boechera divaricarpa isolate SLW-B-D01 mRNA sequence
          Length = 510

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 67  ttccgggggcgaagttggtggcg 89
           |||||||| ||||||||||||||
Sbjct: 404 ttccggggacgaagttggtggcg 382



to top

>gb|AC133204.3| Mus musculus BAC clone RP23-106N3 from chromosome 5, complete sequence
          Length = 224181

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 6     tacaagtacacatgcatat 24
             |||||||||||||||||||
Sbjct: 52160 tacaagtacacatgcatat 52142



to top

>gb|AC125213.3| Mus musculus BAC clone RP23-136A14 from 7, complete sequence
          Length = 194309

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 6     tacaagtacacatgcatat 24
             |||||||||||||||||||
Sbjct: 94097 tacaagtacacatgcatat 94115



to top

>gb|AC007364.3| Homo sapiens BAC clone RP11-329H24 from 2, complete sequence
          Length = 200908

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                   
Query: 48    gctgctaaacacattnaacttc 69
             ||||||||||||||| ||||||
Sbjct: 60423 gctgctaaacacattcaacttc 60402



to top

>gb|AC116567.5| Mus musculus BAC clone RP23-1M9 from 5, complete sequence
          Length = 206570

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 6      tacaagtacacatgcatat 24
              |||||||||||||||||||
Sbjct: 109745 tacaagtacacatgcatat 109763



to top

>gb|CP000319.1| Nitrobacter hamburgensis X14, complete genome
          Length = 4406967

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 136     ggttcttaaccggtccctt 154
               |||||||||||||||||||
Sbjct: 1915093 ggttcttaaccggtccctt 1915111



to top

>gb|BC056343.1| Mus musculus sortilin 1, mRNA (cDNA clone MGC:73925 IMAGE:5704346),
            complete cds
          Length = 6804

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 35   ggacagacggatggctgct 53
            |||||||||||||||||||
Sbjct: 2003 ggacagacggatggctgct 1985



to top

>dbj|AK147442.1| Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN
            full-length enriched library, clone:M5C1042I07
            product:sortilin 1, full insert sequence
          Length = 6837

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 35   ggacagacggatggctgct 53
            |||||||||||||||||||
Sbjct: 2054 ggacagacggatggctgct 2036



to top

>gb|AC018929.12| Oryza sativa chromosome 10 BAC OSJNBa0027L23 genomic sequence, complete
             sequence
          Length = 143961

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 77    gaagttggtggcgaaggcccacg 99
             |||| ||||||||||||||||||
Sbjct: 18054 gaaggtggtggcgaaggcccacg 18032



to top

>gb|S74898.1| prostaglandin F2 alpha receptor [rats, corpus luteum, mRNA Partial,
           1101 nt]
          Length = 1101

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 148 gtccctttccggtgacgatggcc 170
           ||||||||| |||||||||||||
Sbjct: 788 gtccctttctggtgacgatggcc 810



to top

>gb|BT006298.1| Arabidopsis thaliana At3g27700 mRNA, complete cds
          Length = 801

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 67  ttccgggggcgaagttggtggcg 89
           |||||||| ||||||||||||||
Sbjct: 796 ttccggggacgaagttggtggcg 774



to top

>gb|BC034129.1| Mus musculus sortilin 1, mRNA (cDNA clone IMAGE:4920258), partial cds
          Length = 2810

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 35   ggacagacggatggctgct 53
            |||||||||||||||||||
Sbjct: 1504 ggacagacggatggctgct 1486



to top

>gb|AF370557.1|AF370557 Arabidopsis thaliana light harvesting chlorophyll a/b-binding
           protein (MGF10.9) mRNA, complete cds
          Length = 917

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 67  ttccgggggcgaagttggtggcg 89
           |||||||| ||||||||||||||
Sbjct: 845 ttccggggacgaagttggtggcg 823



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                       
Query: 77       gaagttggtggcgaaggcccacg 99
                |||| ||||||||||||||||||
Sbjct: 22366031 gaaggtggtggcgaaggcccacg 22366009



to top

>gb|AY088541.1| Arabidopsis thaliana clone 7700 mRNA, complete sequence
          Length = 917

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 67  ttccgggggcgaagttggtggcg 89
           |||||||| ||||||||||||||
Sbjct: 845 ttccggggacgaagttggtggcg 823



to top

>gb|AF134125.1| Arabidopsis thaliana Lhcb2 protein (Lhcb2:4) mRNA, complete cds
          Length = 897

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                  
Query: 67  ttccgggggcgaagttggtggcg 89
           |||||||| ||||||||||||||
Sbjct: 801 ttccggggacgaagttggtggcg 779



to top

>dbj|AK177805.1| Mus musculus cDNA, clone:Y0G0104F07, strand:minus,
           reference:ENSEMBL:Mouse-Transcript-
           ENST:ENSMUST00000016188, based on BLAT search
          Length = 230

 Score = 38.2 bits (19), Expect = 9.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                              
Query: 35  ggacagacggatggctgct 53
           |||||||||||||||||||
Sbjct: 145 ggacagacggatggctgct 127


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 861,618
Number of Sequences: 3902068
Number of extensions: 861618
Number of successful extensions: 51740
Number of sequences better than 10.0: 264
Number of HSP's better than 10.0 without gapping: 262
Number of HSP's successfully gapped in prelim test: 3
Number of HSP's that attempted gapping in prelim test: 51092
Number of HSP's gapped (non-prelim): 568
length of query: 185
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 163
effective length of database: 17,147,199,772
effective search space: 2794993562836
effective search space used: 2794993562836
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top