ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbah63n06 |
|---|---|
| Clone Library Name | barley_pub |
>emb|AJ534445.1|HVU534445 Hordeum vulgare mRNA for hexose transporter (stp1 gene) Length = 2614 Score = 1291 bits (651), Expect = 0.0 Identities = 654/655 (99%) Strand = Plus / Minus Query: 1 cacaaatacaaagttccaaggcgaaaagaacagatgatctaagtacatatcctacttcca 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2536 cacaaatacaaagttccaaggcgaaaagaacagatgatctaagtacatatcctacttcca 2477 Query: 61 aaagccggcctacgacgacacgattcagcctcacgatgtaaagtctttcgtatctgctcc 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2476 aaagccggcctacgacgacacgattcagcctcacgatgtaaagtctttcgtatctgctcc 2417 Query: 121 ctttgaagtttcttaaccaaagcatcgcaggttaaccagtgtagtagtagttatgacaac 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2416 ctttgaagtttcttaaccaaagcatcgcaggttaaccagtgtagtagtagttatgacaac 2357 Query: 181 acaaaattaccaccagcgacgcggatcaccggatcagagcaactagtctgtggcttcctt 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2356 acaaaattaccaccagcgacgcggatcaccggatcagagcaactagtctgtggcttcctt 2297 Query: 241 gccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccctttgt 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2296 gccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccctttgt 2237 Query: 301 ctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatatattcc 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2236 ctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatatattcc 2177 Query: 361 gaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgat 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2176 gaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgat 2117 Query: 421 gtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggg 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2116 gtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggg 2057 Query: 481 gaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaa 540 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Sbjct: 2056 gaaaatctccgcgcagagaatattcgggataggtccaaaacccatgacgaagaagcagaa 1997 Query: 541 gtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatccagaac 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1996 gtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatccagaac 1937 Query: 601 attcaccaaaaccaagatagctagtgccactatcaagacagggattgttgagagg 655 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1936 attcaccaaaaccaagatagctagtgccactatcaagacagggattgttgagagg 1882
>emb|AJ534446.1|HVU534446 Hordeum vulgare mRNA for sugar transporter (stp2 gene) Length = 2516 Score = 430 bits (217), Expect = e-117 Identities = 217/217 (100%) Strand = Plus / Minus Query: 226 gtctgtggcttccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccag 285 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2248 gtctgtggcttccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccag 2189 Query: 286 gggcatgccctttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaac 345 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2188 gggcatgccctttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaac 2129 Query: 346 gacagcatatattccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagt 405 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2128 gacagcatatattccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagt 2069 Query: 406 gtatgtcacgatgatgtcaccaatccagaaggttagt 442 ||||||||||||||||||||||||||||||||||||| Sbjct: 2068 gtatgtcacgatgatgtcaccaatccagaaggttagt 2032 Score = 204 bits (103), Expect = 3e-49 Identities = 103/103 (100%) Strand = Plus / Minus Query: 520 acccatgacgaagaagcagaagtagactatgacactgatcgttgagagagcggcgtgcac 579 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1954 acccatgacgaagaagcagaagtagactatgacactgatcgttgagagagcggcgtgcac 1895 Query: 580 catggttcccacatccagaacattcaccaaaaccaagatagct 622 ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1894 catggttcccacatccagaacattcaccaaaaccaagatagct 1852
>ref|NM_197573.1| Oryza sativa (japonica cultivar-group) putative sugar transporter (OSJNBb0064P21.3), mRNA Length = 2438 Score = 331 bits (167), Expect = 2e-87 Identities = 353/415 (85%) Strand = Plus / Minus Query: 236 tccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccc 295 |||||| ||||||| || ||||| |||||||||||||||||||| || || ||||||||| Sbjct: 2389 tccttggcctgctttgctccgacagagaagaactcggtgatgacttcaagaggcatgccc 2330 Query: 296 tttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatat 355 |||||||| || ||||||||| |||| || | ||| || | ||||| || || || || Sbjct: 2329 tttgtctccggcaccttcatgaagacaaacaggaaagccagtatgcagaccactgcgtag 2270 Query: 356 attccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacg 415 ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 2269 attccaaacactccagcgagtccaatggcgttgagcatcacggggagggtgtatgtcaca 2210 Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||| |||| | Sbjct: 2209 atgatatcaccgatccagaatgttagggcacagatggctatgcagatgccacgaacggtg 2150 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 || ||||||||||| || |||||||| || || |||||||| || |||||||| |||||| Sbjct: 2149 gtcgggaaaatctctgcacagagaatgtttggaataggcccgaaccccatgacaaagaag 2090 Query: 536 cagaagtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatcc 595 |||||||||| ||||||||||| || || || | ||| || |||||||| ||||||||| Sbjct: 2089 cagaagtagagtatgacactgactgtggacagtgaggcatgaaccatggtccccacatcc 2030 Query: 596 agaacattcaccaaaaccaagatagctagtgccactatcaagacagggattgttg 650 |||| ||| |||| || ||||||||||||||| ||||||| || ||||||||||| Sbjct: 2029 agaatattgaccagaatcaagatagctagtgctactatcaggatagggattgttg 1975
>gb|AC073166.7| Oryza sativa chromosome 10 BAC OSJNBb0064P21 genomic sequence, complete sequence Length = 142114 Score = 331 bits (167), Expect = 2e-87 Identities = 353/415 (85%) Strand = Plus / Minus Query: 236 tccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccc 295 |||||| ||||||| || ||||| |||||||||||||||||||| || || ||||||||| Sbjct: 38296 tccttggcctgctttgctccgacagagaagaactcggtgatgacttcaagaggcatgccc 38237 Query: 296 tttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatat 355 |||||||| || ||||||||| |||| || | ||| || | ||||| || || || || Sbjct: 38236 tttgtctccggcaccttcatgaagacaaacaggaaagccagtatgcagaccactgcgtag 38177 Query: 356 attccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacg 415 ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 38176 attccaaacactccagcgagtccaatggcgttgagcatcacggggagggtgtatgtcaca 38117 Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||| |||| | Sbjct: 38116 atgatatcaccgatccagaatgttagggcacagatggctatgcagatgccacgaacggtg 38057 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 || ||||||||||| || |||||||| || || |||||||| || |||||||| |||||| Sbjct: 38056 gtcgggaaaatctctgcacagagaatgtttggaataggcccgaaccccatgacaaagaag 37997 Query: 536 cagaagtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatcc 595 |||||||||| ||||||||||| || || || | ||| || |||||||| ||||||||| Sbjct: 37996 cagaagtagagtatgacactgactgtggacagtgaggcatgaaccatggtccccacatcc 37937 Query: 596 agaacattcaccaaaaccaagatagctagtgccactatcaagacagggattgttg 650 |||| ||| |||| || ||||||||||||||| ||||||| || ||||||||||| Sbjct: 37936 agaatattgaccagaatcaagatagctagtgctactatcaggatagggattgttg 37882
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 331 bits (167), Expect = 2e-87 Identities = 353/415 (85%) Strand = Plus / Minus Query: 236 tccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccc 295 |||||| ||||||| || ||||| |||||||||||||||||||| || || ||||||||| Sbjct: 20533006 tccttggcctgctttgctccgacagagaagaactcggtgatgacttcaagaggcatgccc 20532947 Query: 296 tttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatat 355 |||||||| || ||||||||| |||| || | ||| || | ||||| || || || || Sbjct: 20532946 tttgtctccggcaccttcatgaagacaaacaggaaagccagtatgcagaccactgcgtag 20532887 Query: 356 attccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacg 415 ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 20532886 attccaaacactccagcgagtccaatggcgttgagcatcacggggagggtgtatgtcaca 20532827 Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||| |||| | Sbjct: 20532826 atgatatcaccgatccagaatgttagggcacagatggctatgcagatgccacgaacggtg 20532767 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 || ||||||||||| || |||||||| || || |||||||| || |||||||| |||||| Sbjct: 20532766 gtcgggaaaatctctgcacagagaatgtttggaataggcccgaaccccatgacaaagaag 20532707 Query: 536 cagaagtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatcc 595 |||||||||| ||||||||||| || || || | ||| || |||||||| ||||||||| Sbjct: 20532706 cagaagtagagtatgacactgactgtggacagtgaggcatgaaccatggtccccacatcc 20532647 Query: 596 agaacattcaccaaaaccaagatagctagtgccactatcaagacagggattgttg 650 |||| ||| |||| || ||||||||||||||| ||||||| || ||||||||||| Sbjct: 20532646 agaatattgaccagaatcaagatagctagtgctactatcaggatagggattgttg 20532592
>dbj|AK102640.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033100A10, full insert sequence Length = 2800 Score = 331 bits (167), Expect = 2e-87 Identities = 353/415 (85%) Strand = Plus / Minus Query: 236 tccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccc 295 |||||| ||||||| || ||||| |||||||||||||||||||| || || ||||||||| Sbjct: 2420 tccttggcctgctttgctccgacagagaagaactcggtgatgacttcaagaggcatgccc 2361 Query: 296 tttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatat 355 |||||||| || ||||||||| |||| || | ||| || | ||||| || || || || Sbjct: 2360 tttgtctccggcaccttcatgaagacaaacaggaaagccagtatgcagaccactgcgtag 2301 Query: 356 attccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacg 415 ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 2300 attccaaacactccagcgagtccaatggcgttgagcatcacggggagggtgtatgtcaca 2241 Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||| |||| | Sbjct: 2240 atgatatcaccgatccagaatgttagggcacagatggctatgcagatgccacgaacggtg 2181 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 || ||||||||||| || |||||||| || || |||||||| || |||||||| |||||| Sbjct: 2180 gtcgggaaaatctctgcacagagaatgtttggaataggcccgaaccccatgacaaagaag 2121 Query: 536 cagaagtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatcc 595 |||||||||| ||||||||||| || || || | ||| || |||||||| ||||||||| Sbjct: 2120 cagaagtagagtatgacactgactgtggacagtgaggcatgaaccatggtccccacatcc 2061 Query: 596 agaacattcaccaaaaccaagatagctagtgccactatcaagacagggattgttg 650 |||| ||| |||| || ||||||||||||||| ||||||| || ||||||||||| Sbjct: 2060 agaatattgaccagaatcaagatagctagtgctactatcaggatagggattgttg 2006
>dbj|AK067391.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013106M11, full insert sequence Length = 1564 Score = 331 bits (167), Expect = 2e-87 Identities = 353/415 (85%) Strand = Plus / Minus Query: 236 tccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccc 295 |||||| ||||||| || ||||| |||||||||||||||||||| || || ||||||||| Sbjct: 1230 tccttggcctgctttgctccgacagagaagaactcggtgatgacttcaagaggcatgccc 1171 Query: 296 tttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatat 355 |||||||| || ||||||||| |||| || | ||| || | ||||| || || || || Sbjct: 1170 tttgtctccggcaccttcatgaagacaaacaggaaagccagtatgcagaccactgcgtag 1111 Query: 356 attccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacg 415 ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 1110 attccaaacactccagcgagtccaatggcgttgagcatcacggggagggtgtatgtcaca 1051 Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||| |||| | Sbjct: 1050 atgatatcaccgatccagaatgttagggcacagatggctatgcagatgccacgaacggtg 991 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 || ||||||||||| || |||||||| || || |||||||| || |||||||| |||||| Sbjct: 990 gtcgggaaaatctctgcacagagaatgtttggaataggcccgaaccccatgacaaagaag 931 Query: 536 cagaagtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatcc 595 |||||||||| ||||||||||| || || || | ||| || |||||||| ||||||||| Sbjct: 930 cagaagtagagtatgacactgactgtggacagtgaggcatgaaccatggtccccacatcc 871 Query: 596 agaacattcaccaaaaccaagatagctagtgccactatcaagacagggattgttg 650 |||| ||| |||| || ||||||||||||||| ||||||| || ||||||||||| Sbjct: 870 agaatattgaccagaatcaagatagctagtgctactatcaggatagggattgttg 816
>dbj|AK059705.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-D08, full insert sequence Length = 1625 Score = 331 bits (167), Expect = 2e-87 Identities = 353/415 (85%) Strand = Plus / Minus Query: 236 tccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccc 295 |||||| ||||||| || ||||| |||||||||||||||||||| || || ||||||||| Sbjct: 1245 tccttggcctgctttgctccgacagagaagaactcggtgatgacttcaagaggcatgccc 1186 Query: 296 tttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatat 355 |||||||| || ||||||||| |||| || | ||| || | ||||| || || || || Sbjct: 1185 tttgtctccggcaccttcatgaagacaaacaggaaagccagtatgcagaccactgcgtag 1126 Query: 356 attccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacg 415 ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 1125 attccaaacactccagcgagtccaatggcgttgagcatcacggggagggtgtatgtcaca 1066 Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||| |||| | Sbjct: 1065 atgatatcaccgatccagaatgttagggcacagatggctatgcagatgccacgaacggtg 1006 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 || ||||||||||| || |||||||| || || |||||||| || |||||||| |||||| Sbjct: 1005 gtcgggaaaatctctgcacagagaatgtttggaataggcccgaaccccatgacaaagaag 946 Query: 536 cagaagtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatcc 595 |||||||||| ||||||||||| || || || | ||| || |||||||| ||||||||| Sbjct: 945 cagaagtagagtatgacactgactgtggacagtgaggcatgaaccatggtccccacatcc 886 Query: 596 agaacattcaccaaaaccaagatagctagtgccactatcaagacagggattgttg 650 |||| ||| |||| || ||||||||||||||| ||||||| || ||||||||||| Sbjct: 885 agaatattgaccagaatcaagatagctagtgctactatcaggatagggattgttg 831
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 331 bits (167), Expect = 2e-87 Identities = 353/415 (85%) Strand = Plus / Minus Query: 236 tccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccc 295 |||||| ||||||| || ||||| |||||||||||||||||||| || || ||||||||| Sbjct: 20544278 tccttggcctgctttgctccgacagagaagaactcggtgatgacttcaagaggcatgccc 20544219 Query: 296 tttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatat 355 |||||||| || ||||||||| |||| || | ||| || | ||||| || || || || Sbjct: 20544218 tttgtctccggcaccttcatgaagacaaacaggaaagccagtatgcagaccactgcgtag 20544159 Query: 356 attccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacg 415 ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 20544158 attccaaacactccagcgagtccaatggcgttgagcatcacggggagggtgtatgtcaca 20544099 Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||| |||| | Sbjct: 20544098 atgatatcaccgatccagaatgttagggcacagatggctatgcagatgccacgaacggtg 20544039 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 || ||||||||||| || |||||||| || || |||||||| || |||||||| |||||| Sbjct: 20544038 gtcgggaaaatctctgcacagagaatgtttggaataggcccgaaccccatgacaaagaag 20543979 Query: 536 cagaagtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatcc 595 |||||||||| ||||||||||| || || || | ||| || |||||||| ||||||||| Sbjct: 20543978 cagaagtagagtatgacactgactgtggacagtgaggcatgaaccatggtccccacatcc 20543919 Query: 596 agaacattcaccaaaaccaagatagctagtgccactatcaagacagggattgttg 650 |||| ||| |||| || ||||||||||||||| ||||||| || ||||||||||| Sbjct: 20543918 agaatattgaccagaatcaagatagctagtgctactatcaggatagggattgttg 20543864
>dbj|AK065191.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E10, full insert sequence Length = 2368 Score = 323 bits (163), Expect = 4e-85 Identities = 352/415 (84%) Strand = Plus / Minus Query: 236 tccttgccctgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccc 295 |||||| ||||||| || ||||| |||||||||||||||||||| || || ||||||||| Sbjct: 2057 tccttggcctgctttgctccgacagagaagaactcggtgatgacttcaagaggcatgccc 1998 Query: 296 tttgtctcagggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatat 355 |||||||| || ||||||||| |||| || | ||| || | ||||| || || || || Sbjct: 1997 tttgtctccggcaccttcatgaagacaaacaggaaagccagtatgcagaccactgcgtag 1938 Query: 356 attccgaaaactccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacg 415 ||||| || |||||||||||||| |||||||||||||||||||| || ||||||||||| Sbjct: 1937 attccaaacactccagcgagtccaatggcgttgagcatcacggggagggtgtatgtcaca 1878 Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 ||||| ||||| |||||||| ||||| || |||||||| |||||||||||||| |||| | Sbjct: 1877 atgatatcaccgatccagaatgttagggcacagatggctatgcagatgccacgaacggtg 1818 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 || ||||||||||| || |||||||| || || |||||||| || |||||||| |||||| Sbjct: 1817 gtcgggaaaatctctgcacagagaatgtttggaataggcccgaaccccatgacaaagaag 1758 Query: 536 cagaagtagactatgacactgatcgttgagagagcggcgtgcaccatggttcccacatcc 595 |||||||||| ||||||||||| || || || | ||| || |||| ||| ||||||||| Sbjct: 1757 cagaagtagagtatgacactgactgtggacagtgaggcatgaaccagggtccccacatcc 1698 Query: 596 agaacattcaccaaaaccaagatagctagtgccactatcaagacagggattgttg 650 |||| ||| |||| || ||||||||||||||| ||||||| || ||||||||||| Sbjct: 1697 agaatattgaccagaatcaagatagctagtgctactatcaggatagggattgttg 1643
>ref|XM_464773.1| Oryza sativa (japonica cultivar-group), mRNA Length = 2934 Score = 180 bits (91), Expect = 4e-42 Identities = 259/315 (82%) Strand = Plus / Minus Query: 262 gaagaactcggtgatgacctccaggggcatgccctttgtctcagggaccttcatgtagac 321 |||||||||||||||||| || || ||||||||||| ||||| |||||||| | | |||| Sbjct: 2491 gaagaactcggtgatgacttcgagcggcatgcccttcgtctcggggaccttgaggaagac 2432 Query: 322 gaatacgaaggctatcatgcaaacgacagcatatattccgaaaactccagcgagtccgat 381 ||| |||||||| ||| |||||| || || ||||| || || || || || || ||||| Sbjct: 2431 gaacacgaaggcaatcgagcaaacaactgcgtatataccaaagacacctgctaggccgat 2372 Query: 382 ggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttag 441 ||| || |||||||| || || |||| || || ||||| |||||||||||||| || || Sbjct: 2371 ggcattcagcatcacagggaggctgtaggtgactatgatatcaccaatccagaatgtcag 2312 Query: 442 tgcgcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaat 501 ||||||||||||||||||||||| ||||| |||||||| |||||||| || ||||| Sbjct: 2311 ggcgcagatggcaatgcagatgccgcggaccctagtggggaagatctccgcacacagaat 2252 Query: 502 attcgggataggcccaaaacccatgacgaagaagcagaagtagactatgacactgatcgt 561 || ||||| || || || |||||||||||| |||||||||||| ||||| ||||| || Sbjct: 2251 gttggggatcggaccgaatcccatgacgaagcagcagaagtagatgatgacgctgattgt 2192 Query: 562 tgagagagcggcgtg 576 ||||| |||||||| Sbjct: 2191 ggagagtgcggcgtg 2177
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 180 bits (91), Expect = 4e-42 Identities = 259/315 (82%) Strand = Plus / Minus Query: 262 gaagaactcggtgatgacctccaggggcatgccctttgtctcagggaccttcatgtagac 321 |||||||||||||||||| || || ||||||||||| ||||| |||||||| | | |||| Sbjct: 7276899 gaagaactcggtgatgacttcgagcggcatgcccttcgtctcggggaccttgaggaagac 7276840 Query: 322 gaatacgaaggctatcatgcaaacgacagcatatattccgaaaactccagcgagtccgat 381 ||| |||||||| ||| |||||| || || ||||| || || || || || || ||||| Sbjct: 7276839 gaacacgaaggcaatcgagcaaacaactgcgtatataccaaagacacctgctaggccgat 7276780 Query: 382 ggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttag 441 ||| || |||||||| || || |||| || || ||||| |||||||||||||| || || Sbjct: 7276779 ggcattcagcatcacagggaggctgtaggtgactatgatatcaccaatccagaatgtcag 7276720 Query: 442 tgcgcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaat 501 ||||||||||||||||||||||| ||||| |||||||| |||||||| || ||||| Sbjct: 7276719 ggcgcagatggcaatgcagatgccgcggaccctagtggggaagatctccgcacacagaat 7276660 Query: 502 attcgggataggcccaaaacccatgacgaagaagcagaagtagactatgacactgatcgt 561 || ||||| || || || |||||||||||| |||||||||||| ||||| ||||| || Sbjct: 7276659 gttggggatcggaccgaatcccatgacgaagcagcagaagtagatgatgacgctgattgt 7276600 Query: 562 tgagagagcggcgtg 576 ||||| |||||||| Sbjct: 7276599 ggagagtgcggcgtg 7276585 Score = 50.1 bits (25), Expect = 0.009 Identities = 76/93 (81%) Strand = Plus / Minus Query: 445 gcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaatatt 504 ||||||||| ||||||| |||||| ||| |||||||| ||||| ||||| || || || Sbjct: 35799641 gcagatggcgatgcagaggccacgcacgcgcgtggggaatatctcggcgcacaggatgtt 35799582 Query: 505 cgggataggcccaaaacccatgacgaagaagca 537 ||||| || || || |||||||||||| |||| Sbjct: 35799581 ggggatggggccgaaccccatgacgaagcagca 35799549
>dbj|AP005756.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBb0035N08 Length = 136267 Score = 180 bits (91), Expect = 4e-42 Identities = 259/315 (82%) Strand = Plus / Minus Query: 262 gaagaactcggtgatgacctccaggggcatgccctttgtctcagggaccttcatgtagac 321 |||||||||||||||||| || || ||||||||||| ||||| |||||||| | | |||| Sbjct: 52707 gaagaactcggtgatgacttcgagcggcatgcccttcgtctcggggaccttgaggaagac 52648 Query: 322 gaatacgaaggctatcatgcaaacgacagcatatattccgaaaactccagcgagtccgat 381 ||| |||||||| ||| |||||| || || ||||| || || || || || || ||||| Sbjct: 52647 gaacacgaaggcaatcgagcaaacaactgcgtatataccaaagacacctgctaggccgat 52588 Query: 382 ggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttag 441 ||| || |||||||| || || |||| || || ||||| |||||||||||||| || || Sbjct: 52587 ggcattcagcatcacagggaggctgtaggtgactatgatatcaccaatccagaatgtcag 52528 Query: 442 tgcgcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaat 501 ||||||||||||||||||||||| ||||| |||||||| |||||||| || ||||| Sbjct: 52527 ggcgcagatggcaatgcagatgccgcggaccctagtggggaagatctccgcacacagaat 52468 Query: 502 attcgggataggcccaaaacccatgacgaagaagcagaagtagactatgacactgatcgt 561 || ||||| || || || |||||||||||| |||||||||||| ||||| ||||| || Sbjct: 52467 gttggggatcggaccgaatcccatgacgaagcagcagaagtagatgatgacgctgattgt 52408 Query: 562 tgagagagcggcgtg 576 ||||| |||||||| Sbjct: 52407 ggagagtgcggcgtg 52393
>dbj|AK120560.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013132C18, full insert sequence Length = 2934 Score = 180 bits (91), Expect = 4e-42 Identities = 259/315 (82%) Strand = Plus / Minus Query: 262 gaagaactcggtgatgacctccaggggcatgccctttgtctcagggaccttcatgtagac 321 |||||||||||||||||| || || ||||||||||| ||||| |||||||| | | |||| Sbjct: 2490 gaagaactcggtgatgacttcgagcggcatgcccttcgtctcggggaccttgaggaagac 2431 Query: 322 gaatacgaaggctatcatgcaaacgacagcatatattccgaaaactccagcgagtccgat 381 ||| |||||||| ||| |||||| || || ||||| || || || || || || ||||| Sbjct: 2430 gaacacgaaggcaatcgagcaaacaactgcgtatataccaaagacacctgctaggccgat 2371 Query: 382 ggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttag 441 ||| || |||||||| || || |||| || || ||||| |||||||||||||| || || Sbjct: 2370 ggcattcagcatcacagggaggctgtaggtgactatgatatcaccaatccagaatgtcag 2311 Query: 442 tgcgcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaat 501 ||||||||||||||||||||||| ||||| |||||||| |||||||| || ||||| Sbjct: 2310 ggcgcagatggcaatgcagatgccgcggaccctagtggggaagatctccgcacacagaat 2251 Query: 502 attcgggataggcccaaaacccatgacgaagaagcagaagtagactatgacactgatcgt 561 || ||||| || || || |||||||||||| |||||||||||| ||||| ||||| || Sbjct: 2250 gttggggatcggaccgaatcccatgacgaagcagcagaagtagatgatgacgctgattgt 2191 Query: 562 tgagagagcggcgtg 576 ||||| |||||||| Sbjct: 2190 ggagagtgcggcgtg 2176
>dbj|AK099716.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013086B19, full insert sequence Length = 2378 Score = 180 bits (91), Expect = 4e-42 Identities = 259/315 (82%) Strand = Plus / Minus Query: 262 gaagaactcggtgatgacctccaggggcatgccctttgtctcagggaccttcatgtagac 321 |||||||||||||||||| || || ||||||||||| ||||| |||||||| | | |||| Sbjct: 2001 gaagaactcggtgatgacttcgagcggcatgcccttcgtctcggggaccttgaggaagac 1942 Query: 322 gaatacgaaggctatcatgcaaacgacagcatatattccgaaaactccagcgagtccgat 381 ||| |||||||| ||| |||||| || || ||||| || || || || || || ||||| Sbjct: 1941 gaacacgaaggcaatcgagcaaacaactgcgtatataccaaagacacctgctaggccgat 1882 Query: 382 ggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttag 441 ||| || |||||||| || || |||| || || ||||| |||||||||||||| || || Sbjct: 1881 ggcattcagcatcacagggaggctgtaggtgactatgatatcaccaatccagaatgtcag 1822 Query: 442 tgcgcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaat 501 ||||||||||||||||||||||| ||||| |||||||| |||||||| || ||||| Sbjct: 1821 ggcgcagatggcaatgcagatgccgcggaccctagtggggaagatctccgcacacagaat 1762 Query: 502 attcgggataggcccaaaacccatgacgaagaagcagaagtagactatgacactgatcgt 561 || ||||| || || || |||||||||||| |||||||||||| ||||| ||||| || Sbjct: 1761 gttggggatcggaccgaatcccatgacgaagcagcagaagtagatgatgacgctgattgt 1702 Query: 562 tgagagagcggcgtg 576 ||||| |||||||| Sbjct: 1701 ggagagtgcggcgtg 1687
>gb|BT009593.1| Triticum aestivum clone wre1n.pk0062.g6:fis, full insert mRNA sequence Length = 1315 Score = 167 bits (84), Expect = 6e-38 Identities = 252/308 (81%) Strand = Plus / Minus Query: 245 tgcttcgccccgaccgagaagaactcggtgatgacctccaggggcatgccctttgtctca 304 ||||||||||| |||| |||||||||||||||||||| |||||||||||||||||||| Sbjct: 846 tgcttcgccccaaccgcaaagaactcggtgatgacctcgaggggcatgccctttgtctct 787 Query: 305 gggaccttcatgtagacgaatacgaaggctatcatgcaaacgacagcatatattccgaaa 364 |||||||| | ||||||||| || ||||| || ||||||||| |||||||| || || Sbjct: 786 gggacctttaggtagacgaacacaaaggcaatgcagcaaacgactgcatatataccaaag 727 Query: 365 actccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgatgtca 424 || || || || || || || || |||||||| || || |||| || || || |||||| Sbjct: 726 acacccgctagaccaatagcattcagcatcacaggcaggctgtaggtaacaataatgtca 667 Query: 425 ccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggggaaa 484 | ||||||||| || || ||||| || || ||||||| |||||||| |||||||||| Sbjct: 666 caaatccagaatgtgagggcgcaaatagcgatgcagacaccacggactctggtggggaaa 607 Query: 485 atctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaagtag 544 ||||| || || ||||| || ||||| || ||||| |||||||| ||| ||||||||||| Sbjct: 606 atctctgcacatagaatgttggggatcgggccaaagcccatgacaaagcagcagaagtag 547 Query: 545 actatgac 552 || ||||| Sbjct: 546 acaatgac 539
>gb|AY105508.1| Zea mays PCO114533 mRNA sequence Length = 2180 Score = 113 bits (57), Expect = 7e-22 Identities = 243/305 (79%) Strand = Plus / Minus Query: 263 aagaactcggtgatgacctccaggggcatgccctttgtctcagggaccttcatgtagacg 322 ||||| ||||| || ||||| |||||||| |||||||||||||||||||| | | ||||| Sbjct: 1800 aagaattcggtaataacctcaaggggcatcccctttgtctcagggaccttaaggaagacg 1741 Query: 323 aatacgaaggctatcatgcaaacgacagcatatattccgaaaactccagcgagtccgatg 382 || || |||| |||| ||| ||||| |||||||| | |||||| || || ||||| || Sbjct: 1740 aacacaaaggaaatcaagcatacgactgcatatatgctgaaaacacccgccagtccaata 1681 Query: 383 gcgttgagcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttagt 442 || || |||||||| ||||| |||| || |||||||| || || |||||||| || | Sbjct: 1680 gcattcagcatcacaggaaggctgtaggtgacgatgatatctccgatccagaatgtaaag 1621 Query: 443 gcgcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaata 502 || || |||||||| |||| |||||| || ||| || || ||||| || || | ||| Sbjct: 1620 gcacaaatggcaatacagaggccacgaaccctggttggaaagatctctgcacataaaatg 1561 Query: 503 ttcgggataggcccaaaacccatgacgaagaagcagaagtagactatgacactgatcgtt 562 || ||||| || ||||| ||||| |||||| ||||||||||||| || |||||||| || Sbjct: 1560 ttggggatgggaccaaatcccataacgaagcagcagaagtagacgataacactgatggtg 1501 Query: 563 gagag 567 ||||| Sbjct: 1500 gagag 1496
>ref|NM_179234.1| Arabidopsis thaliana carbohydrate transporter/ nucleoside transporter/ sugar porter AT4G35300 transcript variant AT4G35300.1 mRNA, complete cds Length = 2590 Score = 83.8 bits (42), Expect = 7e-13 Identities = 144/178 (80%) Strand = Plus / Minus Query: 368 ccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcacca 427 ||||| ||||| |||| ||||||| |||||| ||| |||| || ||||| ||||||| Sbjct: 2266 ccagctagtccaatggatttgagcagcacggggagactgtaagtgacgattatgtcacag 2207 Query: 428 atccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggggaaaatc 487 ||||||||||| |||||||||||||| |||||||| || ||||| || || |||||| Sbjct: 2206 atccagaaggtgagtgcgcagatggcgatgcagattccgcggactcgagttggaaaaatc 2147 Query: 488 tccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaagtaga 545 || | ||||| || || || ||| || |||||||| ||||||||||||||||||| Sbjct: 2146 tctgaacagaggatgtttggagcaggaccgaaacccatcacgaagaagcagaagtaga 2089
>ref|NM_119696.4| Arabidopsis thaliana carbohydrate transporter/ sugar porter AT4G35300 transcript variant AT4G35300.2 mRNA, complete cds Length = 2591 Score = 83.8 bits (42), Expect = 7e-13 Identities = 144/178 (80%) Strand = Plus / Minus Query: 368 ccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcacca 427 ||||| ||||| |||| ||||||| |||||| ||| |||| || ||||| ||||||| Sbjct: 2267 ccagctagtccaatggatttgagcagcacggggagactgtaagtgacgattatgtcacag 2208 Query: 428 atccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggggaaaatc 487 ||||||||||| |||||||||||||| |||||||| || ||||| || || |||||| Sbjct: 2207 atccagaaggtgagtgcgcagatggcgatgcagattccgcggactcgagttggaaaaatc 2148 Query: 488 tccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaagtaga 545 || | ||||| || || || ||| || |||||||| ||||||||||||||||||| Sbjct: 2147 tctgaacagaggatgtttggagcaggaccgaaacccatcacgaagaagcagaagtaga 2090
>emb|AL161587.2|ATCHRIV83 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 83 Length = 197859 Score = 83.8 bits (42), Expect = 7e-13 Identities = 144/178 (80%) Strand = Plus / Plus Query: 368 ccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcacca 427 ||||| ||||| |||| ||||||| |||||| ||| |||| || ||||| ||||||| Sbjct: 61196 ccagctagtccaatggatttgagcagcacggggagactgtaagtgacgattatgtcacag 61255 Query: 428 atccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggggaaaatc 487 ||||||||||| |||||||||||||| |||||||| || ||||| || || |||||| Sbjct: 61256 atccagaaggtgagtgcgcagatggcgatgcagattccgcggactcgagttggaaaaatc 61315 Query: 488 tccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaagtaga 545 || | ||||| || || || ||| || |||||||| ||||||||||||||||||| Sbjct: 61316 tctgaacagaggatgtttggagcaggaccgaaacccatcacgaagaagcagaagtaga 61373
>emb|AL022604.1|ATF23E12 Arabidopsis thaliana DNA chromosome 4, BAC clone F23E12 (ESSA project) Length = 86710 Score = 83.8 bits (42), Expect = 7e-13 Identities = 144/178 (80%) Strand = Plus / Minus Query: 368 ccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcacca 427 ||||| ||||| |||| ||||||| |||||| ||| |||| || ||||| ||||||| Sbjct: 42155 ccagctagtccaatggatttgagcagcacggggagactgtaagtgacgattatgtcacag 42096 Query: 428 atccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggggaaaatc 487 ||||||||||| |||||||||||||| |||||||| || ||||| || || |||||| Sbjct: 42095 atccagaaggtgagtgcgcagatggcgatgcagattccgcggactcgagttggaaaaatc 42036 Query: 488 tccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaagtaga 545 || | ||||| || || || ||| || |||||||| ||||||||||||||||||| Sbjct: 42035 tctgaacagaggatgtttggagcaggaccgaaacccatcacgaagaagcagaagtaga 41978
>gb|AY094465.1| Arabidopsis thaliana AT4g35300/F23E12_140 mRNA, complete cds Length = 2570 Score = 83.8 bits (42), Expect = 7e-13 Identities = 144/178 (80%) Strand = Plus / Minus Query: 368 ccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcacca 427 ||||| ||||| |||| ||||||| |||||| ||| |||| || ||||| ||||||| Sbjct: 2280 ccagctagtccaatggatttgagcagcacggggagactgtaagtgacgattatgtcacag 2221 Query: 428 atccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggggaaaatc 487 ||||||||||| |||||||||||||| |||||||| || ||||| || || |||||| Sbjct: 2220 atccagaaggtgagtgcgcagatggcgatgcagattccgcggactcgagttggaaaaatc 2161 Query: 488 tccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaagtaga 545 || | ||||| || || || ||| || |||||||| ||||||||||||||||||| Sbjct: 2160 tctgaacagaggatgtttggagcaggaccgaaacccatcacgaagaagcagaagtaga 2103
>emb|BX828912.1|CNS0A3H4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL50ZE01 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1135 Score = 83.8 bits (42), Expect = 7e-13 Identities = 144/178 (80%) Strand = Plus / Minus Query: 368 ccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcacca 427 ||||| ||||| |||| ||||||| |||||| ||| |||| || ||||| ||||||| Sbjct: 926 ccagctagtccaatggatttgagcagcacggggagactgtaagtgacgattatgtcacag 867 Query: 428 atccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggggaaaatc 487 ||||||||||| |||||||||||||| |||||||| || ||||| || || |||||| Sbjct: 866 atccagaaggtgagtgcgcagatggcgatgcagattccgcggactcgagttggaaaaatc 807 Query: 488 tccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaagtaga 545 || | ||||| || || || ||| || |||||||| ||||||||||||||||||| Sbjct: 806 tctgaacagaggatgtttggagcaggaccgaaacccatcacgaagaagcagaagtaga 749
>emb|AJ532570.1|ATH532570 Arabidopsis thaliana mRNA for monosaccharide sensing protein 2 (mssp2 gene) Length = 2190 Score = 83.8 bits (42), Expect = 7e-13 Identities = 144/178 (80%) Strand = Plus / Minus Query: 368 ccagcgagtccgatggcgttgagcatcacgggaagagtgtatgtcacgatgatgtcacca 427 ||||| ||||| |||| ||||||| |||||| ||| |||| || ||||| ||||||| Sbjct: 2042 ccagctagtccaatggatttgagcagcacggggagactgtaagtgacgattatgtcacag 1983 Query: 428 atccagaaggttagtgcgcagatggcaatgcagatgccacggacggaggtggggaaaatc 487 ||||||||||| |||||||||||||| |||||||| || ||||| || || |||||| Sbjct: 1982 atccagaaggtgagtgcgcagatggcgatgcagattccgcggactcgagttggaaaaatc 1923 Query: 488 tccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcagaagtaga 545 || | ||||| || || || ||| || |||||||| ||||||||||||||||||| Sbjct: 1922 tctgaacagaggatgtttggagcaggaccgaaacccatcacgaagaagcagaagtaga 1865
>gb|AY165599.1| Saccharum hybrid cultivar putative sugar transporter type 2a mRNA, complete cds Length = 2665 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 263 aagaactcggtgatgacctccaggggcatgccctttgtctcagggacctt 312 |||||||| ||||||||||| |||||||||||||||||||| || ||||| Sbjct: 2297 aagaactcagtgatgacctcaaggggcatgccctttgtctccggaacctt 2248 Score = 48.1 bits (24), Expect = 0.037 Identities = 66/80 (82%) Strand = Plus / Minus Query: 389 agcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttagtgcgcag 448 |||||||| |||||| ||||||| || || ||||| |||| ||| || | | || ||| Sbjct: 2171 agcatcacaggaagactgtatgtgacaataatgtctccaacccaaaatatcaaggcacag 2112 Query: 449 atggcaatgcagatgccacg 468 |||||||||||||||||||| Sbjct: 2111 atggcaatgcagatgccacg 2092
>dbj|AP004945.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT43B20, TM0117b, complete sequence Length = 114918 Score = 61.9 bits (31), Expect = 2e-06 Identities = 106/131 (80%) Strand = Plus / Minus Query: 416 atgatgtcaccaatccagaaggttagtgcgcagatggcaatgcagatgccacggacggag 475 |||||||||| ||||| |||||||| || || ||||||||||||| ||||| || Sbjct: 52047 atgatgtcactgatccaaaaggttagagcacatatggcaatgcagagaccacgaactcga 51988 Query: 476 gtggggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaag 535 |||||||||||||| || || || ||||| || | ||||||||||||||||| ||| | Sbjct: 51987 gtggggaaaatctcagcacaaagtatattaggtactggcccaaaacccatgacaaaggaa 51928 Query: 536 cagaagtagac 546 ||||| ||||| Sbjct: 51927 cagaaatagac 51917
>gb|AC136843.6| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0094M06, complete sequence Length = 135583 Score = 60.0 bits (30), Expect = 1e-05 Identities = 63/74 (85%) Strand = Plus / Minus Query: 479 gggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcag 538 ||||| ||||| |||||||| || || ||||| || || || |||||||||||| ||||| Sbjct: 101167 gggaagatctcggcgcagaggatgttggggatggggccgaaccccatgacgaagcagcag 101108 Query: 539 aagtagactatgac 552 |||||||| ||||| Sbjct: 101107 aagtagacgatgac 101094
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 60.0 bits (30), Expect = 1e-05 Identities = 63/74 (85%) Strand = Plus / Minus Query: 479 gggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcag 538 ||||| ||||| |||||||| || || ||||| || || || |||||||||||| ||||| Sbjct: 15928569 gggaagatctcggcgcagaggatgttggggatggggccgaaccccatgacgaagcagcag 15928510 Query: 539 aagtagactatgac 552 |||||||| ||||| Sbjct: 15928509 aagtagacgatgac 15928496
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 60.0 bits (30), Expect = 1e-05 Identities = 63/74 (85%) Strand = Plus / Minus Query: 479 gggaaaatctccgcgcagagaatattcgggataggcccaaaacccatgacgaagaagcag 538 ||||| ||||| |||||||| || || ||||| || || || |||||||||||| ||||| Sbjct: 16015945 gggaagatctcggcgcagaggatgttggggatggggccgaaccccatgacgaagcagcag 16015886 Query: 539 aagtagactatgac 552 |||||||| ||||| Sbjct: 16015885 aagtagacgatgac 16015872
>ref|XM_468552.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1959 Score = 50.1 bits (25), Expect = 0.009 Identities = 76/93 (81%) Strand = Plus / Minus Query: 445 gcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaatatt 504 ||||||||| ||||||| |||||| ||| |||||||| ||||| ||||| || || || Sbjct: 1719 gcagatggcgatgcagaggccacgcacgcgcgtggggaatatctcggcgcacaggatgtt 1660 Query: 505 cgggataggcccaaaacccatgacgaagaagca 537 ||||| || || || |||||||||||| |||| Sbjct: 1659 ggggatggggccgaaccccatgacgaagcagca 1627
>dbj|AP004082.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1149_C12 Length = 120743 Score = 50.1 bits (25), Expect = 0.009 Identities = 76/93 (81%) Strand = Plus / Minus Query: 445 gcagatggcaatgcagatgccacggacggaggtggggaaaatctccgcgcagagaatatt 504 ||||||||| ||||||| |||||| ||| |||||||| ||||| ||||| || || || Sbjct: 70356 gcagatggcgatgcagaggccacgcacgcgcgtggggaatatctcggcgcacaggatgtt 70297 Query: 505 cgggataggcccaaaacccatgacgaagaagca 537 ||||| || || || |||||||||||| |||| Sbjct: 70296 ggggatggggccgaaccccatgacgaagcagca 70264
>ref|NM_101937.3| Arabidopsis thaliana carbohydrate transporter/ nucleoside transporter/ sugar porter AT1G20840 mRNA, complete cds Length = 2488 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 519 aacccatgacgaagaagcagaagtaga 545 ||||||| ||||||||||||||||||| Sbjct: 2015 aacccatcacgaagaagcagaagtaga 1989
>ref|NM_115008.1| Arabidopsis thaliana carbohydrate transporter/ nucleoside transporter/ sugar porter AT3G51490 mRNA, complete cds Length = 2190 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Minus Query: 254 ccgaccgagaagaactcggtgatgacctccaggggcatgccctttgtctcagggacctt 312 ||||| ||||||||||| | ||| || || |||||||| ||||||||||| || ||||| Sbjct: 2144 ccgacggagaagaactcagagataacttcaaggggcattccctttgtctctggtacctt 2086
>gb|AC126786.22| Medicago truncatula clone mth2-8c2, complete sequence Length = 115134 Score = 46.1 bits (23), Expect = 0.14 Identities = 47/55 (85%) Strand = Plus / Minus Query: 260 gagaagaactcggtgatgacctccaggggcatgccctttgtctcagggaccttca 314 |||||||| || |||||||| || ||||||||||| ||||| || || ||||||| Sbjct: 14958 gagaagaattcagtgatgacttcaaggggcatgccttttgtttctggaaccttca 14904 Score = 46.1 bits (23), Expect = 0.14 Identities = 62/75 (82%) Strand = Plus / Minus Query: 387 tgagcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttagtgcgc 446 |||||||||| ||||| | ||| || || |||||||| ||||||||||| || ||| | Sbjct: 14831 tgagcatcacaggaagcgagtaggtgacaatgatgtctccaatccagaacactaatgcac 14772 Query: 447 agatggcaatgcaga 461 |||| |||||||||| Sbjct: 14771 agatagcaatgcaga 14757
>emb|AL133452.1|ATF26O13 Arabidopsis thaliana DNA chromosome 3, BAC clone F26O13 Length = 94349 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Plus Query: 254 ccgaccgagaagaactcggtgatgacctccaggggcatgccctttgtctcagggacctt 312 ||||| ||||||||||| | ||| || || |||||||| ||||||||||| || ||||| Sbjct: 50785 ccgacggagaagaactcagagataacttcaaggggcattccctttgtctctggtacctt 50843
>gb|AC144482.11| Medicago truncatula clone mth2-10p1, complete sequence Length = 121112 Score = 46.1 bits (23), Expect = 0.14 Identities = 47/55 (85%) Strand = Plus / Minus Query: 260 gagaagaactcggtgatgacctccaggggcatgccctttgtctcagggaccttca 314 |||||||| || |||||||| || ||||||||||| ||||| || || ||||||| Sbjct: 23399 gagaagaattcagtgatgacttcaaggggcatgccttttgtttctggaaccttca 23345 Score = 46.1 bits (23), Expect = 0.14 Identities = 62/75 (82%) Strand = Plus / Minus Query: 387 tgagcatcacgggaagagtgtatgtcacgatgatgtcaccaatccagaaggttagtgcgc 446 |||||||||| ||||| | ||| || || |||||||| ||||||||||| || ||| | Sbjct: 23272 tgagcatcacaggaagcgagtaggtgacaatgatgtctccaatccagaacactaatgcac 23213 Query: 447 agatggcaatgcaga 461 |||| |||||||||| Sbjct: 23212 agatagcaatgcaga 23198
>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I, complete sequence Length = 143879 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Plus Query: 519 aacccatgacgaagaagcagaagtaga 545 ||||||| ||||||||||||||||||| Sbjct: 135869 aacccatcacgaagaagcagaagtaga 135895
>emb|Z50752.1|ATSUGTRPR A.thaliana mRNA for sugar transporter Length = 2426 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 519 aacccatgacgaagaagcagaagtaga 545 ||||||| ||||||||||||||||||| Sbjct: 1936 aacccatcacgaagaagcagaagtaga 1910
>emb|AJ532571.1|ATH532571 Arabidopsis thaliana mRNA for monosaccharide sensing protein 3 (mssp3 gene) Length = 2190 Score = 46.1 bits (23), Expect = 0.14 Identities = 50/59 (84%) Strand = Plus / Minus Query: 254 ccgaccgagaagaactcggtgatgacctccaggggcatgccctttgtctcagggacctt 312 ||||| ||||||||||| | ||| || || |||||||| ||||||||||| || ||||| Sbjct: 2144 ccgacggagaagaactcagagataacttcaaggggcattccctttgtctctggtacctt 2086
>gb|AC007369.2| Arabidopsis thaliana chromosome I BAC F9H16 genomic sequence, complete sequence Length = 103192 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 519 aacccatgacgaagaagcagaagtaga 545 ||||||| ||||||||||||||||||| Sbjct: 102461 aacccatcacgaagaagcagaagtaga 102435
>ref|XM_947213.1| Theileria annulata strain Ankara pre-mRNA splicing factor (TA13035) partial mRNA Length = 2082 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Plus Query: 4 aaatacaaagttccaaggcgaaaagaacag 33 ||||| |||||||||||||||||| ||||| Sbjct: 932 aaatagaaagttccaaggcgaaaacaacag 961
>gb|AF238484.1|AF238484 Hepatitis C virus 2a polyprotein gene, complete cds Length = 9416 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 415 gatgatgtcaccaatccagaag 436 |||||||||||||||||||||| Sbjct: 1732 gatgatgtcaccaatccagaag 1753
>emb|AL356287.16| Human DNA sequence from clone RP11-57O2 on chromosome 13 Contains a High-mobility group (nonhistone chromosomal) protein pseudogene, part of a novel gene and the 5' end of the SGCG gene for sarcoglycan, gamma (35kD dystrophin-associated glycoprotein), complete sequence Length = 182118 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 565 gagagcggcgtgcaccatggt 585 ||||||||||||||||||||| Sbjct: 139511 gagagcggcgtgcaccatggt 139531
>gb|AE000659.1|HUAE000659 Homo sapiens T-cell receptor alpha delta locus from bases 250472 to 501670 (section 2 of 5) of the Complete Nucleotide Sequence Length = 251199 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 604 caccaaaaccaagatagcta 623 |||||||||||||||||||| Sbjct: 32369 caccaaaaccaagatagcta 32388
>gb|AC127367.4| Mus musculus BAC clone RP23-19G15 from chromosome 9, complete sequence Length = 176541 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 293 ccctttgtctcagggaccttcatg 316 ||||||||| |||||||||||||| Sbjct: 148283 ccctttgtcacagggaccttcatg 148306
>emb|CT025534.4| M.truncatula DNA sequence from clone MTH2-1H4 on chromosome 3, complete sequence Length = 100991 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 629 actatcaagacagggattgt 648 |||||||||||||||||||| Sbjct: 33984 actatcaagacagggattgt 33965
>gb|AC123815.3| Mus musculus BAC clone RP24-238O19 from chromosome 9, complete sequence Length = 136592 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 293 ccctttgtctcagggaccttcatg 316 ||||||||| |||||||||||||| Sbjct: 38979 ccctttgtcacagggaccttcatg 39002
>gb|AC121239.34| Medicago truncatula clone mth1-8p19, complete sequence Length = 100985 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 629 actatcaagacagggattgt 648 |||||||||||||||||||| Sbjct: 33979 actatcaagacagggattgt 33960
>emb|BX901894.23| Zebrafish DNA sequence from clone DKEY-71L4 in linkage group 4, complete sequence Length = 157981 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 8 acaaagttccaaggcgaaaagaacagat 35 |||||||||||||| ||||| ||||||| Sbjct: 82318 acaaagttccaaggggaaaaaaacagat 82345
>emb|AL773587.11| Mouse DNA sequence from clone RP23-38J2 on chromosome X, complete sequence Length = 175713 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 tagtagttatgacaacacaa 184 |||||||||||||||||||| Sbjct: 172707 tagtagttatgacaacacaa 172688
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 196 gcgacgcggatcaccggatc 215 |||||||||||||||||||| Sbjct: 5073324 gcgacgcggatcaccggatc 5073343
>emb|X51488.1|OLPROLA1 Rice prolamin gene (strain W1444) Length = 349 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 447 agatggcaatgcagatgcca 466 |||||||||||||||||||| Sbjct: 307 agatggcaatgcagatgcca 326
>ref|NG_001332.1| Homo sapiens T cell receptor alpha delta locus (TCRA/TCRD) on chromosome 14 Length = 1071646 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 604 caccaaaaccaagatagcta 623 |||||||||||||||||||| Sbjct: 282840 caccaaaaccaagatagcta 282859
>emb|AL133400.19| Mouse DNA sequence from clone RP21-598F11 on chromosome X, complete sequence Length = 86674 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 165 tagtagttatgacaacacaa 184 |||||||||||||||||||| Sbjct: 54769 tagtagttatgacaacacaa 54750 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,625,869 Number of Sequences: 3902068 Number of extensions: 4625869 Number of successful extensions: 79219 Number of sequences better than 10.0: 54 Number of HSP's better than 10.0 without gapping: 55 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 78958 Number of HSP's gapped (non-prelim): 237 length of query: 655 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 632 effective length of database: 17,143,297,704 effective search space: 10834564148928 effective search space used: 10834564148928 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
