ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah63m11
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_470473.1| Oryza sativa (japonica cultivar-group), mRNA 119 1e-23
2ref|XM_470474.1| Oryza sativa (japonica cultivar-group), mRNA 119 1e-23
3gb|AC128647.8| Oryza sativa (japonica cultivar-group) chromosome... 119 1e-23
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 119 1e-23
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 119 1e-23
6dbj|AK070146.1| Oryza sativa (japonica cultivar-group) cDNA clon... 119 1e-23
7dbj|AK120953.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 3e-21
8gb|AC025539.6| Homo sapiens BAC clone RP11-281P23 from 4, comple... 44 0.53
9gb|AC126182.2| Homo sapiens 3 BAC RP11-359H3 (Roswell Park Cance... 44 0.53
10gb|AC009289.8|AC009289 Homo sapiens, clone RP11-44J3, complete s... 44 0.53
11gb|AC149346.2| Phakopsora pachyrhizi clone JGIAFNA-33E14, comple... 44 0.53
12gb|AC011288.4| Homo sapiens BAC clone RP11-27B1 from 7, complete... 42 2.1
13gb|AC073316.6| Homo sapiens BAC clone RP11-191P7 from 7, complet... 42 2.1
14emb|CR788305.17| Zebrafish DNA sequence from clone DKEYP-59G5 in... 42 2.1
15gb|AC107882.3| Homo sapiens chromosome 11, clone CTD-2019O4, com... 42 2.1
16gb|AC107886.2| Homo sapiens chromosome 11, clone CTD-3064C13, co... 42 2.1
17emb|BX537259.24| Zebrafish DNA sequence from clone CH211-241P10 ... 42 2.1
18ref|NM_105886.1| Arabidopsis thaliana unknown protein AT1G72270 ... 40 8.3
19ref|NM_117681.2| Arabidopsis thaliana unknown protein AT4G15890 ... 40 8.3
20gb|AC165975.4| Mus musculus BAC clone RP23-3L23 from chromosome ... 40 8.3
21ref|XM_457782.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 8.3
22gb|AE006333.1| Lactococcus lactis subsp. lactis IL1403 section 9... 40 8.3
23gb|DP000012.1| Macropus eugenii target 1 genomic scaffold 40 8.3
24gb|AC125082.3| Mus musculus BAC clone RP24-90M24 from chromosome... 40 8.3
25ref|XM_745988.1| Aspergillus fumigatus Af293 hypothetical protei... 40 8.3
26gb|AC124445.4| Mus musculus BAC clone RP24-191B18 from chromosom... 40 8.3
27ref|XM_947841.1| Theileria annulata strain Ankara DEAD-box famil... 40 8.3
28emb|AL078612.8|HSDJ65P5 Human DNA sequence from clone RP1-65P5 o... 40 8.3
29gb|AC108713.2| Homo sapiens 3q BAC RP11-115O13 (Roswell Park Can... 40 8.3
30emb|Z97339.2|ATFCA4 Arabidopsis thaliana DNA chromosome 4, ESSA ... 40 8.3
31emb|Y11187.1|AT23KB A.thaliana RH1, TC1, G14587-5, G14587-6, and... 40 8.3
32gb|AE008873.1| Salmonella typhimurium LT2, section 177 of 220 of... 40 8.3
33emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS... 40 8.3
34emb|AL627280.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 8.3
35emb|AL161542.2|ATCHRIV42 Arabidopsis thaliana DNA chromosome 4, ... 40 8.3
36emb|AL606809.8| Zebrafish DNA sequence from clone BUSM1-71J22 in... 40 8.3
37emb|AL606702.7| Zebrafish DNA sequence from clone BUSM1-172K9 in... 40 8.3
38emb|BX510316.11| Zebrafish DNA sequence from clone CH211-194J3 i... 40 8.3
39gb|AC092124.2| Homo sapiens chromosome 16 clone RP11-1079H2, com... 40 8.3
40gb|AC015821.9| Homo sapiens chromosome 17, clone RP11-160O5, com... 40 8.3
41gb|AC108687.3| Homo sapiens 3 BAC RP11-725C17 (Roswell Park Canc... 40 8.3
42gb|AC091884.4| Homo sapiens chromosome 5 clone RP11-109J4, compl... 40 8.3
43ref|XM_393191.2| PREDICTED: Apis mellifera similar to ENSANGP000... 40 8.3
44emb|BX814309.1|CNS0ADLA Arabidopsis thaliana Full-length cDNA Co... 40 8.3
45emb|BX814149.1|CNS0ADM5 Arabidopsis thaliana Full-length cDNA Co... 40 8.3
46emb|BX816757.1|CNS0AAPK Arabidopsis thaliana Full-length cDNA Co... 40 8.3
47dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome 40 8.3
48gb|AC067754.6|AC067754 Arabidopsis thaliana chromosome 1 BAC T9N... 40 8.3
49gb|AC090551.6| Homo sapiens chromosome 16 clone RP11-197K24, com... 40 8.3
50gb|AC068278.6| Homo sapiens BAC clone RP11-131G20 from 2, comple... 40 8.3
51gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome 40 8.3
52ref|XM_216723.3| PREDICTED: Rattus norvegicus ninein (predicted)... 40 8.3
53gb|AC106790.3| Homo sapiens chromosome 5 clone RP11-376E20, comp... 40 8.3
54gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 8.3
55dbj|AK176381.1| Arabidopsis thaliana mRNA for hypothetical prote... 40 8.3
56emb|X53847.1|STRFAIJ S. typhimurium rfaI and rfaJ genes for 1,3-... 40 8.3
57gb|AC145184.3| Macropus eugenii clone ME_KBa-71M6, complete sequ... 40 8.3
58gb|AC145183.3| Macropus eugenii clone ME_KBa-60J17, complete seq... 40 8.3
59gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 8.3
60gb|AE015924.1| Porphyromonas gingivalis W83, complete genome 40 8.3
61gb|AF026386.1|AF026386 Salmonella typhimurium strain LT2 LPS cor... 40 8.3
62gb|AF001397.1|AF001397 Salmonella typhimurium putative lipopolys... 40 8.3
63emb|AJ002585.1|ATAJ2585 Arabidopsis thaliana Thionin gene 40 8.3
64emb|AL670195.10| Mouse DNA sequence from clone RP23-313O9 on chr... 40 8.3

>ref|XM_470473.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 2545

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                        
Query: 508  tgtacttcttcatctcttccattgccttctgaacccatgttgagctagatctctctgcca 567
            ||||||||| ||||||||| |||||| |||||||||| |||||||||||||||| || ||
Sbjct: 1995 tgtacttctgcatctcttcaattgccgtctgaacccacgttgagctagatctctgtgtca 1936

                                        
Query: 568  gcatggcttcaaaatctttaacaggatt 595
            |||||||||||||||||| |||||||||
Sbjct: 1935 gcatggcttcaaaatcttgaacaggatt 1908



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                        
Query: 255  ctcgccatctcttcagtcacatcgctgtcaggcgcttcttctttgcatatgagcaaaaca 314
            |||||||||||||| ||||||||||| ||||| ||||||||||||| ||| ||| || | 
Sbjct: 2245 ctcgccatctcttccgtcacatcgctatcaggtgcttcttctttgcttataagcgaagct 2186

                                
Query: 315  ttcttggatgaaagaagctg 334
            |||||||| |||||||||||
Sbjct: 2185 ttcttggacgaaagaagctg 2166



to top

>ref|XM_470474.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3562

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                        
Query: 508  tgtacttcttcatctcttccattgccttctgaacccatgttgagctagatctctctgcca 567
            ||||||||| ||||||||| |||||| |||||||||| |||||||||||||||| || ||
Sbjct: 3012 tgtacttctgcatctcttcaattgccgtctgaacccacgttgagctagatctctgtgtca 2953

                                        
Query: 568  gcatggcttcaaaatctttaacaggatt 595
            |||||||||||||||||| |||||||||
Sbjct: 2952 gcatggcttcaaaatcttgaacaggatt 2925



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                        
Query: 255  ctcgccatctcttcagtcacatcgctgtcaggcgcttcttctttgcatatgagcaaaaca 314
            |||||||||||||| ||||||||||| ||||| ||||||||||||| ||| ||| || | 
Sbjct: 3262 ctcgccatctcttccgtcacatcgctatcaggtgcttcttctttgcttataagcgaagct 3203

                                
Query: 315  ttcttggatgaaagaagctg 334
            |||||||| |||||||||||
Sbjct: 3202 ttcttggacgaaagaagctg 3183



to top

>gb|AC128647.8| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0062G19, complete sequence
          Length = 92392

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                         
Query: 508   tgtacttcttcatctcttccattgccttctgaacccatgttgagctagatctctctgcca 567
             ||||||||| ||||||||| |||||| |||||||||| |||||||||||||||| || ||
Sbjct: 68841 tgtacttctgcatctcttcaattgccgtctgaacccacgttgagctagatctctgtgtca 68782

                                         
Query: 568   gcatggcttcaaaatctttaacaggatt 595
             |||||||||||||||||| |||||||||
Sbjct: 68781 gcatggcttcaaaatcttgaacaggatt 68754



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                  
Query: 282   tcaggcgcttcttctttgcatatgagcaaaacattcttggatgaaagaagctg 334
             ||||| ||||||||||||| ||| ||| || | |||||||| |||||||||||
Sbjct: 69202 tcaggtgcttcttctttgcttataagcgaagctttcttggacgaaagaagctg 69150



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 255   ctcgccatctcttcagtcacatcgct 280
             |||||||||||||| |||||||||||
Sbjct: 69323 ctcgccatctcttccgtcacatcgct 69298



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 508      tgtacttcttcatctcttccattgccttctgaacccatgttgagctagatctctctgcca 567
                ||||||||| ||||||||| |||||| |||||||||| |||||||||||||||| || ||
Sbjct: 35814902 tgtacttctgcatctcttcaattgccgtctgaacccacgttgagctagatctctgtgtca 35814843

                                            
Query: 568      gcatggcttcaaaatctttaacaggatt 595
                |||||||||||||||||| |||||||||
Sbjct: 35814842 gcatggcttcaaaatcttgaacaggatt 35814815



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                     
Query: 282      tcaggcgcttcttctttgcatatgagcaaaacattcttggatgaaagaagctg 334
                ||||| ||||||||||||| ||| ||| || | |||||||| |||||||||||
Sbjct: 35815263 tcaggtgcttcttctttgcttataagcgaagctttcttggacgaaagaagctg 35815211



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 255      ctcgccatctcttcagtcacatcgct 280
                |||||||||||||| |||||||||||
Sbjct: 35815384 ctcgccatctcttccgtcacatcgct 35815359



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                            
Query: 508      tgtacttcttcatctcttccattgccttctgaacccatgttgagctagatctctctgcca 567
                ||||||||| ||||||||| |||||| |||||||||| |||||||||||||||| || ||
Sbjct: 35905032 tgtacttctgcatctcttcaattgccgtctgaacccacgttgagctagatctctgtgtca 35904973

                                            
Query: 568      gcatggcttcaaaatctttaacaggatt 595
                |||||||||||||||||| |||||||||
Sbjct: 35904972 gcatggcttcaaaatcttgaacaggatt 35904945



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                     
Query: 282      tcaggcgcttcttctttgcatatgagcaaaacattcttggatgaaagaagctg 334
                ||||| ||||||||||||| ||| ||| || | |||||||| |||||||||||
Sbjct: 35905393 tcaggtgcttcttctttgcttataagcgaagctttcttggacgaaagaagctg 35905341



 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                          
Query: 255      ctcgccatctcttcagtcacatcgct 280
                |||||||||||||| |||||||||||
Sbjct: 35905514 ctcgccatctcttccgtcacatcgct 35905489



to top

>dbj|AK070146.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042F12, full
            insert sequence
          Length = 3591

 Score =  119 bits (60), Expect = 1e-23
 Identities = 81/88 (92%)
 Strand = Plus / Minus

                                                                        
Query: 508  tgtacttcttcatctcttccattgccttctgaacccatgttgagctagatctctctgcca 567
            ||||||||| ||||||||| |||||| |||||||||| |||||||||||||||| || ||
Sbjct: 3041 tgtacttctgcatctcttcaattgccgtctgaacccacgttgagctagatctctgtgtca 2982

                                        
Query: 568  gcatggcttcaaaatctttaacaggatt 595
            |||||||||||||||||| |||||||||
Sbjct: 2981 gcatggcttcaaaatcttgaacaggatt 2954



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                        
Query: 255  ctcgccatctcttcagtcacatcgctgtcaggcgcttcttctttgcatatgagcaaaaca 314
            |||||||||||||| ||||||||||| ||||| ||||||||||||| ||||||| || | 
Sbjct: 3291 ctcgccatctcttccgtcacatcgctatcaggtgcttcttctttgcttatgagcgaagct 3232

                                
Query: 315  ttcttggatgaaagaagctg 334
            |||||||| |||||||||||
Sbjct: 3231 ttcttggacgaaagaagctg 3212



to top

>dbj|AK120953.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038P17, full
            insert sequence
          Length = 3386

 Score =  111 bits (56), Expect = 3e-21
 Identities = 80/88 (90%)
 Strand = Plus / Minus

                                                                        
Query: 508  tgtacttcttcatctcttccattgccttctgaacccatgttgagctagatctctctgcca 567
            ||||||||| ||||||| | |||||| |||||||||| |||||||||||||||| || ||
Sbjct: 2769 tgtacttctgcatctctgcaattgccgtctgaacccacgttgagctagatctctgtgtca 2710

                                        
Query: 568  gcatggcttcaaaatctttaacaggatt 595
            |||||||||||||||||| |||||||||
Sbjct: 2709 gcatggcttcaaaatcttgaacaggatt 2682



 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                        
Query: 255  ctcgccatctcttcagtcacatcgctgtcaggcgcttcttctttgcatatgagcaaaaca 314
            |||||||||||||| ||||||||||| ||||| ||||||||||||| ||| ||| || | 
Sbjct: 3019 ctcgccatctcttccgtcacatcgctatcaggtgcttcttctttgcttataagcgaagct 2960

                                
Query: 315  ttcttggatgaaagaagctg 334
            |||||||| |||||||||||
Sbjct: 2959 ttcttggacgaaagaagctg 2940



to top

>gb|AC025539.6| Homo sapiens BAC clone RP11-281P23 from 4, complete sequence
          Length = 77426

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 323   tgaaagaagctgaaagaacttcacca 348
             |||||||||||||||||| |||||||
Sbjct: 51103 tgaaagaagctgaaagaatttcacca 51078



to top

>gb|AC126182.2| Homo sapiens 3 BAC RP11-359H3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 196944

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 340   acttcaccacatcatccaccttcttc 365
             ||||||||||||||||| ||||||||
Sbjct: 53916 acttcaccacatcatcccccttcttc 53891



to top

>gb|AC009289.8|AC009289 Homo sapiens, clone RP11-44J3, complete sequence
          Length = 146010

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 340    acttcaccacatcatccaccttcttc 365
              ||||||||||||||||| ||||||||
Sbjct: 108882 acttcaccacatcatcccccttcttc 108857



to top

>gb|AC149346.2| Phakopsora pachyrhizi clone JGIAFNA-33E14, complete sequence
          Length = 38941

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 116  atatcatgaccaaagcttcagaacat 141
            |||||||||||||||||| |||||||
Sbjct: 1664 atatcatgaccaaagctttagaacat 1639



to top

>gb|AC011288.4| Homo sapiens BAC clone RP11-27B1 from 7, complete sequence
          Length = 159722

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 169   tgatgttagaatttttctact 189
             |||||||||||||||||||||
Sbjct: 26707 tgatgttagaatttttctact 26727



to top

>gb|AC073316.6| Homo sapiens BAC clone RP11-191P7 from 7, complete sequence
          Length = 148930

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 306   agcaaaacattcttggatgaa 326
             |||||||||||||||||||||
Sbjct: 34638 agcaaaacattcttggatgaa 34618



to top

>emb|CR788305.17| Zebrafish DNA sequence from clone DKEYP-59G5 in linkage group 20,
              complete sequence
          Length = 187351

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 580    aatctttaacaggatttacat 600
              |||||||||||||||||||||
Sbjct: 108621 aatctttaacaggatttacat 108601



to top

>gb|AC107882.3| Homo sapiens chromosome 11, clone CTD-2019O4, complete sequence
          Length = 130916

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 514   tcttcatctcttccattgcct 534
             |||||||||||||||||||||
Sbjct: 34927 tcttcatctcttccattgcct 34947



to top

>gb|AC107886.2| Homo sapiens chromosome 11, clone CTD-3064C13, complete sequence
          Length = 133892

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 514   tcttcatctcttccattgcct 534
             |||||||||||||||||||||
Sbjct: 36152 tcttcatctcttccattgcct 36132



to top

>emb|BX537259.24| Zebrafish DNA sequence from clone CH211-241P10 in linkage group 20,
             complete sequence
          Length = 185460

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 580   aatctttaacaggatttacat 600
             |||||||||||||||||||||
Sbjct: 49612 aatctttaacaggatttacat 49632



to top

>ref|NM_105886.1| Arabidopsis thaliana unknown protein AT1G72270 mRNA, complete cds
          Length = 8334

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 atccaccttcttcagtctct 372
           ||||||||||||||||||||
Sbjct: 315 atccaccttcttcagtctct 334



to top

>ref|NM_117681.2| Arabidopsis thaliana unknown protein AT4G15890 mRNA, complete cds
          Length = 4182

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 353 atccaccttcttcagtctct 372
           ||||||||||||||||||||
Sbjct: 463 atccaccttcttcagtctct 444



to top

>gb|AC165975.4| Mus musculus BAC clone RP23-3L23 from chromosome 5, complete sequence
          Length = 259091

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 364   tcagtctctcgtaaagcttggtca 387
             ||||||||||| ||||||||||||
Sbjct: 47225 tcagtctctcgaaaagcttggtca 47248



to top

>ref|XM_457782.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0C02640g)
           partial mRNA
          Length = 972

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 576 tcaaaatctttaacaggatt 595
           ||||||||||||||||||||
Sbjct: 224 tcaaaatctttaacaggatt 205



to top

>gb|AE006333.1| Lactococcus lactis subsp. lactis IL1403 section 95 of 218 of the
            complete genome
          Length = 11167

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 228  gatatttcggttttcaagaa 247
            ||||||||||||||||||||
Sbjct: 4329 gatatttcggttttcaagaa 4348



to top

>gb|DP000012.1| Macropus eugenii target 1 genomic scaffold
          Length = 1996640

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 520     tctcttccattgccttctga 539
               ||||||||||||||||||||
Sbjct: 1881546 tctcttccattgccttctga 1881565



to top

>gb|AC125082.3| Mus musculus BAC clone RP24-90M24 from chromosome 10, complete sequence
          Length = 226256

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 193    attgccttgaggacccagaacaat 216
              |||||||| |||||||||||||||
Sbjct: 220078 attgccttcaggacccagaacaat 220101



to top

>ref|XM_745988.1| Aspergillus fumigatus Af293 hypothetical protein (Afu6g12020)
           partial mRNA
          Length = 2238

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 93  gcaccaccatcgtctcagatacca 116
           ||||||||||||||| ||||||||
Sbjct: 736 gcaccaccatcgtctgagatacca 759



to top

>gb|AC124445.4| Mus musculus BAC clone RP24-191B18 from chromosome 10, complete sequence
          Length = 190295

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 193    attgccttgaggacccagaacaat 216
              |||||||| |||||||||||||||
Sbjct: 117306 attgccttcaggacccagaacaat 117283



to top

>ref|XM_947841.1| Theileria annulata strain Ankara DEAD-box family helicase (TA07525)
           partial mRNA
          Length = 2274

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 321 gatgaaagaagctgaaagaa 340
           ||||||||||||||||||||
Sbjct: 363 gatgaaagaagctgaaagaa 382



to top

>emb|AL078612.8|HSDJ65P5 Human DNA sequence from clone RP1-65P5 on chromosome 11p13 Contains
            the RCN1 gene for EF-hand calcium binding domain protein
            reticulocalbin 1, a seudogene similar to part of EIF4A
            (Eukaryotic Initiation Factor 4A), ESTs, STSs, GSSs and a
            putative CpG island, complete sequence
          Length = 94497

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 176  agaatttttctactaccatt 195
            ||||||||||||||||||||
Sbjct: 7185 agaatttttctactaccatt 7166



to top

>gb|AC108713.2| Homo sapiens 3q BAC RP11-115O13 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 158987

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   actgatgttagaatttttct 186
             ||||||||||||||||||||
Sbjct: 92131 actgatgttagaatttttct 92112



to top

>emb|Z97339.2|ATFCA4 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 4
          Length = 205065

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 353    atccaccttcttcagtctct 372
              ||||||||||||||||||||
Sbjct: 186577 atccaccttcttcagtctct 186558



to top

>emb|Y11187.1|AT23KB A.thaliana RH1, TC1, G14587-5, G14587-6, and PRL1 genes
          Length = 23918

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 353   atccaccttcttcagtctct 372
             ||||||||||||||||||||
Sbjct: 15636 atccaccttcttcagtctct 15617



to top

>gb|AE008873.1| Salmonella typhimurium LT2, section 177 of 220 of the complete
           genome
          Length = 21337

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 461 cttttcgtagtaatctcctt 480
           ||||||||||||||||||||
Sbjct: 553 cttttcgtagtaatctcctt 572



to top

>emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS767 of Debaryomyces
              hansenii
          Length = 1592360

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 576    tcaaaatctttaacaggatt 595
              ||||||||||||||||||||
Sbjct: 218092 tcaaaatctttaacaggatt 218111



to top

>emb|AL627280.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18,
              complete chromosome; segment 16/20
          Length = 245050

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 461    cttttcgtagtaatctcctt 480
              ||||||||||||||||||||
Sbjct: 208925 cttttcgtagtaatctcctt 208906



to top

>emb|AL161542.2|ATCHRIV42 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 42
          Length = 195068

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 353    atccaccttcttcagtctct 372
              ||||||||||||||||||||
Sbjct: 143631 atccaccttcttcagtctct 143612



to top

>emb|AL606809.8| Zebrafish DNA sequence from clone BUSM1-71J22 in linkage group 15
             Contains to novel reverse transcriptase pseudogenes and a
             CpG island, complete sequence
          Length = 73260

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 507   gtgtacttcttcatctcttc 526
             ||||||||||||||||||||
Sbjct: 22438 gtgtacttcttcatctcttc 22419



to top

>emb|AL606702.7| Zebrafish DNA sequence from clone BUSM1-172K9 in linkage group 15
             Contains a novel transposase pseudogene and a putative
             novel gene, complete sequence
          Length = 102736

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 507   gtgtacttcttcatctcttc 526
             ||||||||||||||||||||
Sbjct: 84953 gtgtacttcttcatctcttc 84972



to top

>emb|BX510316.11| Zebrafish DNA sequence from clone CH211-194J3 in linkage group 12,
             complete sequence
          Length = 189720

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 352   catccaccttcttcagtctc 371
             ||||||||||||||||||||
Sbjct: 55710 catccaccttcttcagtctc 55691



to top

>gb|AC092124.2| Homo sapiens chromosome 16 clone RP11-1079H2, complete sequence
          Length = 197992

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 562   ctgccagcatggcttcaaaa 581
             ||||||||||||||||||||
Sbjct: 73519 ctgccagcatggcttcaaaa 73500



to top

>gb|AC015821.9| Homo sapiens chromosome 17, clone RP11-160O5, complete sequence
          Length = 160184

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 321   gatgaaagaagctgaaagaa 340
             ||||||||||||||||||||
Sbjct: 74441 gatgaaagaagctgaaagaa 74460



to top

>gb|AC108687.3| Homo sapiens 3 BAC RP11-725C17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 128821

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 167   actgatgttagaatttttct 186
             ||||||||||||||||||||
Sbjct: 14115 actgatgttagaatttttct 14096



to top

>gb|AC091884.4| Homo sapiens chromosome 5 clone RP11-109J4, complete sequence
          Length = 192149

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 372   tcgtaaagcttggtcacaaa 391
             ||||||||||||||||||||
Sbjct: 64727 tcgtaaagcttggtcacaaa 64746



to top

>ref|XM_393191.2| PREDICTED: Apis mellifera similar to ENSANGP00000011437 (LOC409693),
            mRNA
          Length = 1856

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 515  cttcatctcttccattgcct 534
            ||||||||||||||||||||
Sbjct: 1767 cttcatctcttccattgcct 1786



to top

>emb|BX814309.1|CNS0ADLA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB67ZE05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1398

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 atccaccttcttcagtctct 372
           ||||||||||||||||||||
Sbjct: 353 atccaccttcttcagtctct 372



to top

>emb|BX814149.1|CNS0ADM5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB59ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1381

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 atccaccttcttcagtctct 372
           ||||||||||||||||||||
Sbjct: 350 atccaccttcttcagtctct 369



to top

>emb|BX816757.1|CNS0AAPK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH67ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1372

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 atccaccttcttcagtctct 372
           ||||||||||||||||||||
Sbjct: 323 atccaccttcttcagtctct 342



to top

>dbj|AP006878.1| Thermococcus kodakarensis KOD1 DNA, complete genome
          Length = 2088737

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 362    cttcagtctctcgtaaagct 381
              ||||||||||||||||||||
Sbjct: 845403 cttcagtctctcgtaaagct 845422



to top

>gb|AC067754.6|AC067754 Arabidopsis thaliana chromosome 1 BAC T9N14 genomic sequence, complete
             sequence
          Length = 98874

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 353   atccaccttcttcagtctct 372
             ||||||||||||||||||||
Sbjct: 74753 atccaccttcttcagtctct 74734



 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 353   atccaccttcttcagtctct 372
             ||||||||||||||||||||
Sbjct: 63865 atccaccttcttcagtctct 63846



to top

>gb|AC090551.6| Homo sapiens chromosome 16 clone RP11-197K24, complete sequence
          Length = 174737

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 562  ctgccagcatggcttcaaaa 581
            ||||||||||||||||||||
Sbjct: 2592 ctgccagcatggcttcaaaa 2611



to top

>gb|AC068278.6| Homo sapiens BAC clone RP11-131G20 from 2, complete sequence
          Length = 156916

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 567    agcatggcttcaaaatcttt 586
              ||||||||||||||||||||
Sbjct: 111853 agcatggcttcaaaatcttt 111834



to top

>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome
          Length = 3179300

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 326     aagaagctgaaagaacttca 345
               ||||||||||||||||||||
Sbjct: 2544272 aagaagctgaaagaacttca 2544253



to top

>ref|XM_216723.3| PREDICTED: Rattus norvegicus ninein (predicted) (Nin_predicted), mRNA
          Length = 8022

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 249  aagctcctcgccatctcttcagtc 272
            |||||||||||| |||||||||||
Sbjct: 3926 aagctcctcgccttctcttcagtc 3903



to top

>gb|AC106790.3| Homo sapiens chromosome 5 clone RP11-376E20, complete sequence
          Length = 73401

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 312   acattcttggatgaaagaagctgaaaga 339
             ||||||||| ||||||||||| ||||||
Sbjct: 13532 acattcttgtatgaaagaagcagaaaga 13505



to top

>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 461     cttttcgtagtaatctcctt 480
               ||||||||||||||||||||
Sbjct: 3700157 cttttcgtagtaatctcctt 3700176



to top

>dbj|AK176381.1| Arabidopsis thaliana mRNA for hypothetical protein, partial cds,
           clone: RAFL24-09-E23
          Length = 1295

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 atccaccttcttcagtctct 372
           ||||||||||||||||||||
Sbjct: 223 atccaccttcttcagtctct 242



to top

>emb|X53847.1|STRFAIJ S. typhimurium rfaI and rfaJ genes for 1,3-galactosyltransferase and
            1,2-glucosyltransferase respectively
          Length = 2622

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 461  cttttcgtagtaatctcctt 480
            ||||||||||||||||||||
Sbjct: 2576 cttttcgtagtaatctcctt 2557



to top

>gb|AC145184.3| Macropus eugenii clone ME_KBa-71M6, complete sequence
          Length = 137074

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   tctcttccattgccttctga 539
             ||||||||||||||||||||
Sbjct: 21980 tctcttccattgccttctga 21999



to top

>gb|AC145183.3| Macropus eugenii clone ME_KBa-60J17, complete sequence
          Length = 168360

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 520    tctcttccattgccttctga 539
              ||||||||||||||||||||
Sbjct: 167276 tctcttccattgccttctga 167295



to top

>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome
          Length = 4791961

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 461     cttttcgtagtaatctcctt 480
               ||||||||||||||||||||
Sbjct: 3922424 cttttcgtagtaatctcctt 3922405



to top

>gb|AE015924.1| Porphyromonas gingivalis W83, complete genome
          Length = 2343476

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 336    aagaacttcaccacatcatc 355
              ||||||||||||||||||||
Sbjct: 586095 aagaacttcaccacatcatc 586114



to top

>gb|AF026386.1|AF026386 Salmonella typhimurium strain LT2 LPS core oligosaccharide
           biosynthesis region, WaaY (waaY) gene, partial cds; WaaJ
           (waaJ), WaaI (waaI), WaaB (waaB), WaaP (waaP), WaaG
           (waaG), and WaaQ (waaQ) genes, complete cds; and WaaA
           (waaA) gene, partial cds
          Length = 8421

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 461 cttttcgtagtaatctcctt 480
           ||||||||||||||||||||
Sbjct: 28  cttttcgtagtaatctcctt 47



to top

>gb|AF001397.1|AF001397 Salmonella typhimurium putative lipopolysaccharide biosynthesis
           protein (rfaY) gene, complete cds
          Length = 800

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 461 cttttcgtagtaatctcctt 480
           ||||||||||||||||||||
Sbjct: 305 cttttcgtagtaatctcctt 286



to top

>emb|AJ002585.1|ATAJ2585 Arabidopsis thaliana Thionin gene
          Length = 2133

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 353 atccaccttcttcagtctct 372
           ||||||||||||||||||||
Sbjct: 918 atccaccttcttcagtctct 937



to top

>emb|AL670195.10| Mouse DNA sequence from clone RP23-313O9 on chromosome 4, complete
              sequence
          Length = 202663

 Score = 40.1 bits (20), Expect = 8.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 293    ttctttgcatatgagcaaaa 312
              ||||||||||||||||||||
Sbjct: 166080 ttctttgcatatgagcaaaa 166061


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,055,291
Number of Sequences: 3902068
Number of extensions: 6055291
Number of successful extensions: 127223
Number of sequences better than 10.0: 64
Number of HSP's better than 10.0 without gapping: 64
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 126964
Number of HSP's gapped (non-prelim): 259
length of query: 612
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 589
effective length of database: 17,143,297,704
effective search space: 10097402347656
effective search space used: 10097402347656
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top