Clone Name	rbah63l10
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	ref|XM_483589.1| Oryza sativa (japonica cultivar-group), mRNA	287	2e-74
2	ref|XM_507312.1| PREDICTED Oryza sativa (japonica cultivar-group...	287	2e-74
3	dbj|AK101416.1| Oryza sativa (japonica cultivar-group) cDNA clon...	287	2e-74
4	dbj|AK058490.1| Oryza sativa (japonica cultivar-group) cDNA clon...	287	2e-74
5	dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D...	143	8e-31
6	dbj|AP003914.3| Oryza sativa (japonica cultivar-group) genomic D...	143	8e-31
7	dbj|AP003948.2| Oryza sativa (japonica cultivar-group) genomic D...	143	8e-31
8	gb|AY111978.1| Zea mays CL45039_-2 mRNA sequence	127	5e-26
9	gb|AY104606.1| Zea mays PCO071007 mRNA sequence	115	2e-22
10	ref|XM_483591.1| Oryza sativa (japonica cultivar-group), mRNA	94	7e-16
11	emb|BX065427.1|CNS09MNB Single read from an extremity of a full-...	60	1e-05
12	emb|BX036885.1|CNS090MH Single read from an extremity of a full-...	60	1e-05
13	emb|BX062168.1|CNS09K4S Single read from an extremity of a full-...	56	1e-04
14	emb|BX029473.1|CNS08UWL Single read from an extremity of a full-...	56	1e-04
15	emb|BX019031.1|CNS08MUJ Single read from an extremity of a full-...	56	1e-04
16	emb|BX017181.1|CNS08LF5 Single read from an extremity of a full-...	56	1e-04
17	emb|BX049251.1|CNS09A5Z Single read from an extremity of a full-...	54	6e-04
18	emb|BX053396.1|CNS09DD4 Single read from an extremity of a full-...	52	0.002
19	emb|BX072064.1|CNS09RRO Single read from an extremity of a full-...	52	0.002
20	emb|BX071791.1|CNS09RK3 Single read from an extremity of a full-...	52	0.002
21	emb|BX071790.1|CNS09RK2 Single read from an extremity of a full-...	52	0.002
22	emb|BX071653.1|CNS09RG9 Single read from an extremity of a full-...	52	0.002
23	emb|BX071652.1|CNS09RG8 Single read from an extremity of a full-...	52	0.002
24	emb|BX071452.1|CNS09RAO Single read from an extremity of a full-...	52	0.002
25	emb|BX071451.1|CNS09RAN Single read from an extremity of a full-...	52	0.002
26	emb|BX071396.1|CNS09R94 Single read from an extremity of a full-...	52	0.002
27	emb|BX071298.1|CNS09R6E Single read from an extremity of a full-...	52	0.002
28	emb|BX071259.1|CNS09R5B Single read from an extremity of a full-...	52	0.002
29	emb|BX071258.1|CNS09R5A Single read from an extremity of a full-...	52	0.002
30	emb|BX071034.1|CNS09QZ2 Single read from an extremity of a full-...	52	0.002
31	emb|BX071033.1|CNS09QZ1 Single read from an extremity of a full-...	52	0.002
32	emb|BX070988.1|CNS09QXS Single read from an extremity of a full-...	52	0.002
33	emb|BX070987.1|CNS09QXR Single read from an extremity of a full-...	52	0.002
34	emb|BX070913.1|CNS09QVP Single read from an extremity of a full-...	52	0.002
35	emb|BX070912.1|CNS09QVO Single read from an extremity of a full-...	52	0.002
36	emb|BX070805.1|CNS09QSP Single read from an extremity of a full-...	52	0.002
37	emb|BX070804.1|CNS09QSO Single read from an extremity of a full-...	52	0.002
38	emb|BX070631.1|CNS09QNV Single read from an extremity of a full-...	52	0.002
39	emb|BX070630.1|CNS09QNU Single read from an extremity of a full-...	52	0.002
40	emb|BX070560.1|CNS09QLW Single read from an extremity of a full-...	52	0.002
41	emb|BX070494.1|CNS09QK2 Single read from an extremity of a full-...	52	0.002
42	emb|BX070493.1|CNS09QK1 Single read from an extremity of a full-...	52	0.002
43	emb|BX070258.1|CNS09QDI Single read from an extremity of a full-...	52	0.002
44	emb|BX070053.1|CNS09Q7T Single read from an extremity of a full-...	52	0.002
45	emb|BX070052.1|CNS09Q7S Single read from an extremity of a full-...	52	0.002
46	emb|BX070015.1|CNS09Q6R Single read from an extremity of a full-...	52	0.002
47	emb|BX070014.1|CNS09Q6Q Single read from an extremity of a full-...	52	0.002
48	emb|BX069981.1|CNS09Q5T Single read from an extremity of a full-...	52	0.002
49	emb|BX069946.1|CNS09Q4U Single read from an extremity of a full-...	52	0.002
50	emb|BX069852.1|CNS09Q28 Single read from an extremity of a full-...	52	0.002
51	emb|BX069851.1|CNS09Q27 Single read from an extremity of a full-...	52	0.002
52	emb|BX069725.1|CNS09PYP Single read from an extremity of a full-...	52	0.002
53	emb|BX069724.1|CNS09PYO Single read from an extremity of a full-...	52	0.002
54	emb|BX069627.1|CNS09PVZ Single read from an extremity of a full-...	52	0.002
55	emb|BX069626.1|CNS09PVY Single read from an extremity of a full-...	52	0.002
56	emb|BX069444.1|CNS09PQW Single read from an extremity of a full-...	52	0.002
57	emb|BX069443.1|CNS09PQV Single read from an extremity of a full-...	52	0.002
58	emb|BX069442.1|CNS09PQU Single read from an extremity of a full-...	52	0.002
59	emb|BX069441.1|CNS09PQT Single read from an extremity of a full-...	52	0.002
60	emb|BX069361.1|CNS09POL Single read from an extremity of a full-...	52	0.002
61	emb|BX069360.1|CNS09POK Single read from an extremity of a full-...	52	0.002
62	emb|BX069131.1|CNS09PI7 Single read from an extremity of a full-...	52	0.002
63	emb|BX069130.1|CNS09PI6 Single read from an extremity of a full-...	52	0.002
64	emb|BX069121.1|CNS09PHX Single read from an extremity of a full-...	52	0.002
65	emb|BX069029.1|CNS09PFD Single read from an extremity of a full-...	52	0.002
66	emb|BX069028.1|CNS09PFC Single read from an extremity of a full-...	52	0.002
67	emb|BX068969.1|CNS09PDP Single read from an extremity of a full-...	52	0.002
68	emb|BX068968.1|CNS09PDO Single read from an extremity of a full-...	52	0.002
69	emb|BX068913.1|CNS09PC5 Single read from an extremity of a full-...	52	0.002
70	emb|BX068796.1|CNS09P8W Single read from an extremity of a full-...	52	0.002
71	emb|BX068679.1|CNS09P5N Single read from an extremity of a full-...	52	0.002
72	emb|BX068678.1|CNS09P5M Single read from an extremity of a full-...	52	0.002
73	emb|BX068669.1|CNS09P5D Single read from an extremity of a full-...	52	0.002
74	emb|BX068455.1|CNS09OZF Single read from an extremity of a full-...	52	0.002
75	emb|BX068359.1|CNS09OWR Single read from an extremity of a full-...	52	0.002
76	emb|BX068150.1|CNS09OQY Single read from an extremity of a full-...	52	0.002
77	emb|BX068136.1|CNS09OQK Single read from an extremity of a full-...	52	0.002
78	emb|BX068135.1|CNS09OQJ Single read from an extremity of a full-...	52	0.002
79	emb|BX067770.1|CNS09OGE Single read from an extremity of a full-...	52	0.002
80	emb|BX067769.1|CNS09OGD Single read from an extremity of a full-...	52	0.002
81	emb|BX067575.1|CNS09OAZ Single read from an extremity of a full-...	52	0.002
82	emb|BX067574.1|CNS09OAY Single read from an extremity of a full-...	52	0.002
83	emb|BX067534.1|CNS09O9U Single read from an extremity of a full-...	52	0.002
84	emb|BX067533.1|CNS09O9T Single read from an extremity of a full-...	52	0.002
85	emb|BX067446.1|CNS09O7E Single read from an extremity of a full-...	52	0.002
86	emb|BX067445.1|CNS09O7D Single read from an extremity of a full-...	52	0.002
87	emb|BX067333.1|CNS09O49 Single read from an extremity of a full-...	52	0.002
88	emb|BX067064.1|CNS09NWS Single read from an extremity of a full-...	52	0.002
89	emb|BX067063.1|CNS09NWR Single read from an extremity of a full-...	52	0.002
90	emb|BX067001.1|CNS09NV1 Single read from an extremity of a full-...	52	0.002
91	emb|BX067000.1|CNS09NV0 Single read from an extremity of a full-...	52	0.002
92	emb|BX067241.1|CNS09O1P Single read from an extremity of a full-...	52	0.002
93	emb|BX067240.1|CNS09O1O Single read from an extremity of a full-...	52	0.002
94	emb|BX067178.1|CNS09NZY Single read from an extremity of a full-...	52	0.002
95	emb|BX067177.1|CNS09NZX Single read from an extremity of a full-...	52	0.002
96	emb|BX067146.1|CNS09NZ2 Single read from an extremity of a full-...	52	0.002
97	emb|BX067145.1|CNS09NZ1 Single read from an extremity of a full-...	52	0.002
98	emb|BX066849.1|CNS09NQT Single read from an extremity of a full-...	52	0.002
99	emb|BX066848.1|CNS09NQS Single read from an extremity of a full-...	52	0.002
100	emb|BX066768.1|CNS09NOK Single read from an extremity of a full-...	52	0.002
101	emb|BX066767.1|CNS09NOJ Single read from an extremity of a full-...	52	0.002
102	emb|BX066726.1|CNS09NNE Single read from an extremity of a full-...	52	0.002
103	emb|BX066725.1|CNS09NND Single read from an extremity of a full-...	52	0.002
104	emb|BX066633.1|CNS09NKT Single read from an extremity of a full-...	52	0.002
105	emb|BX066558.1|CNS09NIQ Single read from an extremity of a full-...	52	0.002
106	emb|BX066557.1|CNS09NIP Single read from an extremity of a full-...	52	0.002
107	emb|BX066512.1|CNS09NHG Single read from an extremity of a full-...	52	0.002
108	emb|BX066511.1|CNS09NHF Single read from an extremity of a full-...	52	0.002
109	emb|BX066367.1|CNS09NDF Single read from an extremity of a full-...	52	0.002
110	emb|BX066366.1|CNS09NDE Single read from an extremity of a full-...	52	0.002
111	emb|BX066303.1|CNS09NBN Single read from an extremity of a full-...	52	0.002
112	emb|BX066302.1|CNS09NBM Single read from an extremity of a full-...	52	0.002
113	emb|BX066297.1|CNS09NBH Single read from an extremity of a full-...	52	0.002
114	emb|BX066296.1|CNS09NBG Single read from an extremity of a full-...	52	0.002
115	emb|BX066130.1|CNS09N6U Single read from an extremity of a full-...	52	0.002
116	emb|BX066129.1|CNS09N6T Single read from an extremity of a full-...	52	0.002
117	emb|BX065912.1|CNS09N0S Single read from an extremity of a full-...	52	0.002
118	emb|BX065603.1|CNS09MS7 Single read from an extremity of a full-...	52	0.002
119	emb|BX065559.1|CNS09MQZ Single read from an extremity of a full-...	52	0.002
120	emb|BX065558.1|CNS09MQY Single read from an extremity of a full-...	52	0.002
121	emb|BX065426.1|CNS09MNA Single read from an extremity of a full-...	52	0.002
122	emb|BX065421.1|CNS09MN5 Single read from an extremity of a full-...	52	0.002
123	emb|BX065420.1|CNS09MN4 Single read from an extremity of a full-...	52	0.002
124	emb|BX065376.1|CNS09MLW Single read from an extremity of a full-...	52	0.002
125	emb|BX065375.1|CNS09MLV Single read from an extremity of a full-...	52	0.002
126	emb|BX065329.1|CNS09MKL Single read from an extremity of a full-...	52	0.002
127	emb|BX065312.1|CNS09MK4 Single read from an extremity of a full-...	52	0.002
128	emb|BX065118.1|CNS09MEQ Single read from an extremity of a full-...	52	0.002
129	emb|BX065105.1|CNS09MED Single read from an extremity of a full-...	52	0.002
130	emb|BX064707.1|CNS09M3B Single read from an extremity of a full-...	52	0.002
131	emb|BX064706.1|CNS09M3A Single read from an extremity of a full-...	52	0.002
132	emb|BX064243.1|CNS09LQF Single read from an extremity of a full-...	52	0.002
133	emb|BX064242.1|CNS09LQE Single read from an extremity of a full-...	52	0.002
134	emb|BX064203.1|CNS09LPB Single read from an extremity of a full-...	52	0.002
135	emb|BX064173.1|CNS09LOH Single read from an extremity of a full-...	52	0.002
136	emb|BX064172.1|CNS09LOG Single read from an extremity of a full-...	52	0.002
137	emb|BX064030.1|CNS09LKI Single read from an extremity of a full-...	52	0.002
138	emb|BX064029.1|CNS09LKH Single read from an extremity of a full-...	52	0.002
139	emb|BX063864.1|CNS09LFW Single read from an extremity of a full-...	52	0.002
140	emb|BX063860.1|CNS09LFS Single read from an extremity of a full-...	52	0.002
141	emb|BX063859.1|CNS09LFR Single read from an extremity of a full-...	52	0.002
142	emb|BX063580.1|CNS09L80 Single read from an extremity of a full-...	52	0.002
143	emb|BX063579.1|CNS09L7Z Single read from an extremity of a full-...	52	0.002
144	emb|BX063193.1|CNS09KX9 Single read from an extremity of a full-...	52	0.002
145	emb|BX063192.1|CNS09KX8 Single read from an extremity of a full-...	52	0.002
146	emb|BX062982.1|CNS09KRE Single read from an extremity of a full-...	52	0.002
147	emb|BX062974.1|CNS09KR6 Single read from an extremity of a full-...	52	0.002
148	emb|BX062973.1|CNS09KR5 Single read from an extremity of a full-...	52	0.002
149	emb|BX062925.1|CNS09KPT Single read from an extremity of a full-...	52	0.002
150	emb|BX062924.1|CNS09KPS Single read from an extremity of a full-...	52	0.002
151	emb|BX062896.1|CNS09KP0 Single read from an extremity of a full-...	52	0.002
152	emb|BX062641.1|CNS09KHX Single read from an extremity of a full-...	52	0.002
153	emb|BX062575.1|CNS09KG3 Single read from an extremity of a full-...	52	0.002
154	emb|BX062574.1|CNS09KG2 Single read from an extremity of a full-...	52	0.002
155	emb|BX062497.1|CNS09KDX Single read from an extremity of a full-...	52	0.002
156	emb|BX062308.1|CNS09K8O Single read from an extremity of a full-...	52	0.002
157	emb|BX062215.1|CNS09K63 Single read from an extremity of a full-...	52	0.002
158	emb|BX062214.1|CNS09K62 Single read from an extremity of a full-...	52	0.002
159	emb|BX062069.1|CNS09K21 Single read from an extremity of a full-...	52	0.002
160	emb|BX062068.1|CNS09K20 Single read from an extremity of a full-...	52	0.002
161	emb|BX062040.1|CNS09K18 Single read from an extremity of a full-...	52	0.002
162	emb|BX062039.1|CNS09K17 Single read from an extremity of a full-...	52	0.002
163	emb|BX061714.1|CNS09JS6 Single read from an extremity of a full-...	52	0.002
164	emb|BX061713.1|CNS09JS5 Single read from an extremity of a full-...	52	0.002
165	emb|BX061678.1|CNS09JR6 Single read from an extremity of a full-...	52	0.002
166	emb|BX061619.1|CNS09JPJ Single read from an extremity of a full-...	52	0.002
167	emb|BX061618.1|CNS09JPI Single read from an extremity of a full-...	52	0.002
168	emb|BX061538.1|CNS09JNA Single read from an extremity of a full-...	52	0.002
169	emb|BX061537.1|CNS09JN9 Single read from an extremity of a full-...	52	0.002
170	emb|BX061485.1|CNS09JLT Single read from an extremity of a full-...	52	0.002
171	emb|BX061484.1|CNS09JLS Single read from an extremity of a full-...	52	0.002
172	emb|BX061264.1|CNS09JFO Single read from an extremity of a full-...	52	0.002
173	emb|BX061263.1|CNS09JFN Single read from an extremity of a full-...	52	0.002
174	emb|BX061104.1|CNS09JB8 Single read from an extremity of a full-...	52	0.002
175	emb|BX060853.1|CNS09J49 Single read from an extremity of a full-...	52	0.002
176	emb|BX060852.1|CNS09J48 Single read from an extremity of a full-...	52	0.002
177	emb|BX060835.1|CNS09J3R Single read from an extremity of a full-...	52	0.002
178	emb|BX060421.1|CNS09IS9 Single read from an extremity of a full-...	52	0.002
179	emb|BX060334.1|CNS09IPU Single read from an extremity of a full-...	52	0.002
180	emb|BX060333.1|CNS09IPT Single read from an extremity of a full-...	52	0.002
181	emb|BX059972.1|CNS09IFS Single read from an extremity of a full-...	52	0.002
182	emb|BX059971.1|CNS09IFR Single read from an extremity of a full-...	52	0.002
183	emb|BX059904.1|CNS09IDW Single read from an extremity of a full-...	52	0.002
184	emb|BX059765.1|CNS09IA1 Single read from an extremity of a full-...	52	0.002
185	emb|BX059761.1|CNS09I9X Single read from an extremity of a full-...	52	0.002
186	emb|BX059760.1|CNS09I9W Single read from an extremity of a full-...	52	0.002
187	emb|BX059674.1|CNS09I7I Single read from an extremity of a full-...	52	0.002
188	emb|BX059626.1|CNS09I66 Single read from an extremity of a full-...	52	0.002
189	emb|BX059625.1|CNS09I65 Single read from an extremity of a full-...	52	0.002
190	emb|BX059607.1|CNS09I5N Single read from an extremity of a full-...	52	0.002
191	emb|BX059606.1|CNS09I5M Single read from an extremity of a full-...	52	0.002
192	emb|BX059417.1|CNS09I0D Single read from an extremity of a full-...	52	0.002
193	emb|BX059393.1|CNS09HZP Single read from an extremity of a full-...	52	0.002
194	emb|BX059392.1|CNS09HZO Single read from an extremity of a full-...	52	0.002
195	emb|BX059211.1|CNS09HUN Single read from an extremity of a full-...	52	0.002
196	emb|BX059210.1|CNS09HUM Single read from an extremity of a full-...	52	0.002
197	emb|BX059153.1|CNS09HT1 Single read from an extremity of a full-...	52	0.002
198	emb|BX059152.1|CNS09HT0 Single read from an extremity of a full-...	52	0.002
199	emb|BX059116.1|CNS09HS0 Single read from an extremity of a full-...	52	0.002
200	emb|BX059115.1|CNS09HRZ Single read from an extremity of a full-...	52	0.002
201	emb|BX058758.1|CNS09HI2 Single read from an extremity of a full-...	52	0.002
202	emb|BX058710.1|CNS09HGQ Single read from an extremity of a full-...	52	0.002
203	emb|BX058709.1|CNS09HGP Single read from an extremity of a full-...	52	0.002
204	emb|BX058537.1|CNS09HBX Single read from an extremity of a full-...	52	0.002
205	emb|BX058436.1|CNS09H94 Single read from an extremity of a full-...	52	0.002
206	emb|BX058409.1|CNS09H8D Single read from an extremity of a full-...	52	0.002
207	emb|BX056661.1|CNS09FVT Single read from an extremity of a full-...	52	0.002
208	emb|BX056611.1|CNS09FUF Single read from an extremity of a full-...	52	0.002
209	emb|BX056610.1|CNS09FUE Single read from an extremity of a full-...	52	0.002
210	emb|BX057874.1|CNS09GTI Single read from an extremity of a full-...	52	0.002
211	emb|BX057873.1|CNS09GTH Single read from an extremity of a full-...	52	0.002
212	emb|BX057794.1|CNS09GRA Single read from an extremity of a full-...	52	0.002
213	emb|BX057529.1|CNS09GJX Single read from an extremity of a full-...	52	0.002
214	emb|BX057073.1|CNS09G79 Single read from an extremity of a full-...	52	0.002
215	emb|BX056977.1|CNS09G4L Single read from an extremity of a full-...	52	0.002
216	emb|BX056976.1|CNS09G4K Single read from an extremity of a full-...	52	0.002
217	emb|BX056850.1|CNS09G12 Single read from an extremity of a full-...	52	0.002
218	emb|BX056819.1|CNS09G07 Single read from an extremity of a full-...	52	0.002
219	emb|BX056466.1|CNS09FQE Single read from an extremity of a full-...	52	0.002
220	emb|BX056465.1|CNS09FQD Single read from an extremity of a full-...	52	0.002
221	emb|BX056335.1|CNS09FMR Single read from an extremity of a full-...	52	0.002
222	emb|BX056260.1|CNS09FKO Single read from an extremity of a full-...	52	0.002
223	emb|BX055500.1|CNS09EZK Single read from an extremity of a full-...	52	0.002
224	emb|BX055499.1|CNS09EZJ Single read from an extremity of a full-...	52	0.002
225	emb|BX055379.1|CNS09EW7 Single read from an extremity of a full-...	52	0.002
226	emb|BX055259.1|CNS09ESV Single read from an extremity of a full-...	52	0.002
227	emb|BX053250.1|CNS09D92 Single read from an extremity of a full-...	52	0.002
228	emb|BX053249.1|CNS09D91 Single read from an extremity of a full-...	52	0.002
229	emb|BX053171.1|CNS09D6V Single read from an extremity of a full-...	52	0.002
230	emb|BX053153.1|CNS09D6D Single read from an extremity of a full-...	52	0.002
231	emb|BX054879.1|CNS09EIB Single read from an extremity of a full-...	52	0.002
232	emb|BX054878.1|CNS09EIA Single read from an extremity of a full-...	52	0.002
233	emb|BX054828.1|CNS09EGW Single read from an extremity of a full-...	52	0.002
234	emb|BX052909.1|CNS09CZL Single read from an extremity of a full-...	52	0.002
235	emb|BX052908.1|CNS09CZK Single read from an extremity of a full-...	52	0.002
236	emb|BX054730.1|CNS09EE6 Single read from an extremity of a full-...	52	0.002
237	emb|BX054702.1|CNS09EDE Single read from an extremity of a full-...	52	0.002
238	emb|BX054649.1|CNS09EBX Single read from an extremity of a full-...	52	0.002
239	emb|BX054648.1|CNS09EBW Single read from an extremity of a full-...	52	0.002
240	emb|BX054626.1|CNS09EBA Single read from an extremity of a full-...	52	0.002
241	emb|BX054625.1|CNS09EB9 Single read from an extremity of a full-...	52	0.002
242	emb|BX054462.1|CNS09E6Q Single read from an extremity of a full-...	52	0.002
243	emb|BX054461.1|CNS09E6P Single read from an extremity of a full-...	52	0.002
244	emb|BX054393.1|CNS09E4T Single read from an extremity of a full-...	52	0.002
245	emb|BX054392.1|CNS09E4S Single read from an extremity of a full-...	52	0.002
246	emb|BX054176.1|CNS09DYS Single read from an extremity of a full-...	52	0.002
247	emb|BX054175.1|CNS09DYR Single read from an extremity of a full-...	52	0.002
248	emb|BX054174.1|CNS09DYQ Single read from an extremity of a full-...	52	0.002
249	emb|BX053953.1|CNS09DSL Single read from an extremity of a full-...	52	0.002
250	emb|BX053952.1|CNS09DSK Single read from an extremity of a full-...	52	0.002
251	emb|BX053920.1|CNS09DRO Single read from an extremity of a full-...	52	0.002
252	emb|BX053912.1|CNS09DRG Single read from an extremity of a full-...	52	0.002
253	emb|BX053911.1|CNS09DRF Single read from an extremity of a full-...	52	0.002
254	emb|BX053818.1|CNS09DOU Single read from an extremity of a full-...	52	0.002
255	emb|BX053817.1|CNS09DOT Single read from an extremity of a full-...	52	0.002
256	emb|BX052788.1|CNS09CW8 Single read from an extremity of a full-...	52	0.002
257	emb|BX052695.1|CNS09CTN Single read from an extremity of a full-...	52	0.002
258	emb|BX052693.1|CNS09CTL Single read from an extremity of a full-...	52	0.002
259	emb|BX052621.1|CNS09CRL Single read from an extremity of a full-...	52	0.002
260	emb|BX052620.1|CNS09CRK Single read from an extremity of a full-...	52	0.002
261	emb|BX052419.1|CNS09CLZ Single read from an extremity of a full-...	52	0.002
262	emb|BX052418.1|CNS09CLY Single read from an extremity of a full-...	52	0.002
263	emb|BX052393.1|CNS09CL9 Single read from an extremity of a full-...	52	0.002
264	emb|BX052362.1|CNS09CKE Single read from an extremity of a full-...	52	0.002
265	emb|BX052356.1|CNS09CK8 Single read from an extremity of a full-...	52	0.002
266	emb|BX052355.1|CNS09CK7 Single read from an extremity of a full-...	52	0.002
267	emb|BX052342.1|CNS09CJU Single read from an extremity of a full-...	52	0.002
268	emb|BX051896.1|CNS09C7G Single read from an extremity of a full-...	52	0.002
269	emb|BX051895.1|CNS09C7F Single read from an extremity of a full-...	52	0.002
270	emb|BX051873.1|CNS09C6T Single read from an extremity of a full-...	52	0.002
271	emb|BX051872.1|CNS09C6S Single read from an extremity of a full-...	52	0.002
272	emb|BX051690.1|CNS09C1Q Single read from an extremity of a full-...	52	0.002
273	emb|BX051689.1|CNS09C1P Single read from an extremity of a full-...	52	0.002
274	emb|BX051513.1|CNS09BWT Single read from an extremity of a full-...	52	0.002
275	emb|BX051488.1|CNS09BW4 Single read from an extremity of a full-...	52	0.002
276	emb|BX051487.1|CNS09BW3 Single read from an extremity of a full-...	52	0.002
277	emb|BX051019.1|CNS09BJ3 Single read from an extremity of a full-...	52	0.002
278	emb|BX050866.1|CNS09BEU Single read from an extremity of a full-...	52	0.002
279	emb|BX050391.1|CNS09B1N Single read from an extremity of a full-...	52	0.002
280	emb|BX050351.1|CNS09B0J Single read from an extremity of a full-...	52	0.002
281	emb|BX050350.1|CNS09B0I Single read from an extremity of a full-...	52	0.002
282	emb|BX049980.1|CNS09AQ8 Single read from an extremity of a full-...	52	0.002
283	emb|BX049958.1|CNS09APM Single read from an extremity of a full-...	52	0.002
284	emb|BX049739.1|CNS09AJJ Single read from an extremity of a full-...	52	0.002
285	emb|BX049738.1|CNS09AJI Single read from an extremity of a full-...	52	0.002
286	emb|BX049727.1|CNS09AJ7 Single read from an extremity of a full-...	52	0.002
287	emb|BX049726.1|CNS09AJ6 Single read from an extremity of a full-...	52	0.002
288	emb|BX049691.1|CNS09AI7 Single read from an extremity of a full-...	52	0.002
289	emb|BX049690.1|CNS09AI6 Single read from an extremity of a full-...	52	0.002
290	emb|BX031049.1|CNS08W4D Single read from an extremity of a full-...	52	0.002
291	emb|BX031048.1|CNS08W4C Single read from an extremity of a full-...	52	0.002
292	emb|BX030983.1|CNS08W2J Single read from an extremity of a full-...	52	0.002
293	emb|BX030982.1|CNS08W2I Single read from an extremity of a full-...	52	0.002
294	emb|BX049587.1|CNS09AFB Single read from an extremity of a full-...	52	0.002
295	emb|BX049539.1|CNS09ADZ Single read from an extremity of a full-...	52	0.002
296	emb|BX049521.1|CNS09ADH Single read from an extremity of a full-...	52	0.002
297	emb|BX049314.1|CNS09A7Q Single read from an extremity of a full-...	52	0.002
298	emb|BX049154.1|CNS09A3A Single read from an extremity of a full-...	52	0.002
299	emb|BX048996.1|CNS099YW Single read from an extremity of a full-...	52	0.002
300	emb|BX048502.1|CNS099L6 Single read from an extremity of a full-...	52	0.002
301	emb|BX048501.1|CNS099L5 Single read from an extremity of a full-...	52	0.002
302	emb|BX048464.1|CNS099K4 Single read from an extremity of a full-...	52	0.002
303	emb|BX048463.1|CNS099K3 Single read from an extremity of a full-...	52	0.002
304	emb|BX048446.1|CNS099JM Single read from an extremity of a full-...	52	0.002
305	emb|BX048445.1|CNS099JL Single read from an extremity of a full-...	52	0.002
306	emb|BX046467.1|CNS0980N Single read from an extremity of a full-...	52	0.002
307	emb|BX046466.1|CNS0980M Single read from an extremity of a full-...	52	0.002
308	emb|BX046459.1|CNS0980F Single read from an extremity of a full-...	52	0.002
309	emb|BX048383.1|CNS099HV Single read from an extremity of a full-...	52	0.002
310	emb|BX048248.1|CNS099E4 Single read from an extremity of a full-...	52	0.002
311	emb|BX048218.1|CNS099DA Single read from an extremity of a full-...	52	0.002
312	emb|BX048047.1|CNS0998J Single read from an extremity of a full-...	52	0.002
313	emb|BX047941.1|CNS0995L Single read from an extremity of a full-...	52	0.002
314	emb|BX047940.1|CNS0995K Single read from an extremity of a full-...	52	0.002
315	emb|BX047916.1|CNS0994W Single read from an extremity of a full-...	52	0.002
316	emb|BX047915.1|CNS0994V Single read from an extremity of a full-...	52	0.002
317	emb|BX047819.1|CNS09927 Single read from an extremity of a full-...	52	0.002
318	emb|BX047818.1|CNS09926 Single read from an extremity of a full-...	52	0.002
319	emb|BX047435.1|CNS098RJ Single read from an extremity of a full-...	52	0.002
320	emb|BX047372.1|CNS098PS Single read from an extremity of a full-...	52	0.002
321	emb|BX047345.1|CNS098P1 Single read from an extremity of a full-...	52	0.002
322	emb|BX047325.1|CNS098OH Single read from an extremity of a full-...	52	0.002
323	emb|BX047324.1|CNS098OG Single read from an extremity of a full-...	52	0.002
324	emb|BX047179.1|CNS098KF Single read from an extremity of a full-...	52	0.002
325	emb|BX047178.1|CNS098KE Single read from an extremity of a full-...	52	0.002
326	emb|BX047172.1|CNS098K8 Single read from an extremity of a full-...	52	0.002
327	emb|BX047171.1|CNS098K7 Single read from an extremity of a full-...	52	0.002
328	emb|BX047166.1|CNS098K2 Single read from an extremity of a full-...	52	0.002
329	emb|BX047165.1|CNS098K1 Single read from an extremity of a full-...	52	0.002
330	emb|BX046896.1|CNS098CK Single read from an extremity of a full-...	52	0.002
331	emb|BX046895.1|CNS098CJ Single read from an extremity of a full-...	52	0.002
332	emb|BX046884.1|CNS098C8 Single read from an extremity of a full-...	52	0.002
333	emb|BX046883.1|CNS098C7 Single read from an extremity of a full-...	52	0.002
334	emb|BX046708.1|CNS0987C Single read from an extremity of a full-...	52	0.002
335	emb|BX046707.1|CNS0987B Single read from an extremity of a full-...	52	0.002
336	emb|BX046609.1|CNS0984L Single read from an extremity of a full-...	52	0.002
337	emb|BX046608.1|CNS0984K Single read from an extremity of a full-...	52	0.002
338	emb|BX046323.1|CNS097WN Single read from an extremity of a full-...	52	0.002
339	emb|BX046322.1|CNS097WM Single read from an extremity of a full-...	52	0.002
340	emb|BX046319.1|CNS097WJ Single read from an extremity of a full-...	52	0.002
341	emb|BX046318.1|CNS097WI Single read from an extremity of a full-...	52	0.002
342	emb|BX046134.1|CNS097RE Single read from an extremity of a full-...	52	0.002
343	emb|BX046112.1|CNS097QS Single read from an extremity of a full-...	52	0.002
344	emb|BX046093.1|CNS097Q9 Single read from an extremity of a full-...	52	0.002
345	emb|BX046092.1|CNS097Q8 Single read from an extremity of a full-...	52	0.002
346	emb|BX045967.1|CNS097MR Single read from an extremity of a full-...	52	0.002
347	emb|BX045966.1|CNS097MQ Single read from an extremity of a full-...	52	0.002
348	emb|BX045804.1|CNS097I8 Single read from an extremity of a full-...	52	0.002
349	emb|BX045797.1|CNS097I1 Single read from an extremity of a full-...	52	0.002
350	emb|BX045796.1|CNS097I0 Single read from an extremity of a full-...	52	0.002
351	emb|BX045626.1|CNS097DA Single read from an extremity of a full-...	52	0.002
352	emb|BX045539.1|CNS097AV Single read from an extremity of a full-...	52	0.002
353	emb|BX045538.1|CNS097AU Single read from an extremity of a full-...	52	0.002
354	emb|BX045485.1|CNS0979D Single read from an extremity of a full-...	52	0.002
355	emb|BX045024.1|CNS096WK Single read from an extremity of a full-...	52	0.002
356	emb|BX045023.1|CNS096WJ Single read from an extremity of a full-...	52	0.002
357	emb|BX045316.1|CNS0974O Single read from an extremity of a full-...	52	0.002
358	emb|BX044837.1|CNS096RD Single read from an extremity of a full-...	52	0.002
359	emb|BX042938.1|CNS095AM Single read from an extremity of a full-...	52	0.002
360	emb|BX044634.1|CNS096LQ Single read from an extremity of a full-...	52	0.002
361	emb|BX044628.1|CNS096LK Single read from an extremity of a full-...	52	0.002
362	emb|BX044426.1|CNS096FY Single read from an extremity of a full-...	52	0.002
363	emb|BX044425.1|CNS096FX Single read from an extremity of a full-...	52	0.002
364	emb|BX044403.1|CNS096FB Single read from an extremity of a full-...	52	0.002
365	emb|BX044402.1|CNS096FA Single read from an extremity of a full-...	52	0.002
366	emb|BX044342.1|CNS096DM Single read from an extremity of a full-...	52	0.002
367	emb|BX044340.1|CNS096DK Single read from an extremity of a full-...	52	0.002
368	emb|BX044069.1|CNS09661 Single read from an extremity of a full-...	52	0.002
369	emb|BX043944.1|CNS0962K Single read from an extremity of a full-...	52	0.002
370	emb|BX043943.1|CNS0962J Single read from an extremity of a full-...	52	0.002
371	emb|BX043818.1|CNS095Z2 Single read from an extremity of a full-...	52	0.002
372	emb|BX043787.1|CNS095Y7 Single read from an extremity of a full-...	52	0.002
373	emb|BX043786.1|CNS095Y6 Single read from an extremity of a full-...	52	0.002
374	emb|BX043712.1|CNS095W4 Single read from an extremity of a full-...	52	0.002
375	emb|BX043711.1|CNS095W3 Single read from an extremity of a full-...	52	0.002
376	emb|BX043329.1|CNS095LH Single read from an extremity of a full-...	52	0.002
377	emb|BX043621.1|CNS095TL Single read from an extremity of a full-...	52	0.002
378	emb|BX043282.1|CNS095K6 Single read from an extremity of a full-...	52	0.002
379	emb|BX043266.1|CNS095JQ Single read from an extremity of a full-...	52	0.002
380	emb|BX043265.1|CNS095JP Single read from an extremity of a full-...	52	0.002
381	emb|BX043174.1|CNS095H6 Single read from an extremity of a full-...	52	0.002
382	emb|BX042820.1|CNS0957C Single read from an extremity of a full-...	52	0.002
383	emb|BX042733.1|CNS0954X Single read from an extremity of a full-...	52	0.002
384	emb|BX042732.1|CNS0954W Single read from an extremity of a full-...	52	0.002
385	emb|BX042596.1|CNS09514 Single read from an extremity of a full-...	52	0.002
386	emb|BX042595.1|CNS09513 Single read from an extremity of a full-...	52	0.002
387	emb|BX042559.1|CNS09503 Single read from an extremity of a full-...	52	0.002
388	emb|BX042367.1|CNS094UR Single read from an extremity of a full-...	52	0.002
389	emb|BX042366.1|CNS094UQ Single read from an extremity of a full-...	52	0.002
390	emb|BX042199.1|CNS094Q3 Single read from an extremity of a full-...	52	0.002
391	emb|BX042131.1|CNS094O7 Single read from an extremity of a full-...	52	0.002
392	emb|BX042130.1|CNS094O6 Single read from an extremity of a full-...	52	0.002
393	emb|BX041755.1|CNS094DR Single read from an extremity of a full-...	52	0.002
394	emb|BX041754.1|CNS094DQ Single read from an extremity of a full-...	52	0.002
395	emb|BX042008.1|CNS094KS Single read from an extremity of a full-...	52	0.002
396	emb|BX041902.1|CNS094HU Single read from an extremity of a full-...	52	0.002
397	emb|BX041901.1|CNS094HT Single read from an extremity of a full-...	52	0.002
398	emb|BX041545.1|CNS0947X Single read from an extremity of a full-...	52	0.002
399	emb|BX041544.1|CNS0947W Single read from an extremity of a full-...	52	0.002
400	emb|BX041477.1|CNS09461 Single read from an extremity of a full-...	52	0.002
401	emb|BX041103.1|CNS093VN Single read from an extremity of a full-...	52	0.002
402	emb|BX041102.1|CNS093VM Single read from an extremity of a full-...	52	0.002
403	emb|BX040797.1|CNS093N5 Single read from an extremity of a full-...	52	0.002
404	emb|BX040742.1|CNS093LM Single read from an extremity of a full-...	52	0.002
405	emb|BX040741.1|CNS093LL Single read from an extremity of a full-...	52	0.002
406	emb|BX040675.1|CNS093JR Single read from an extremity of a full-...	52	0.002
407	emb|BX040496.1|CNS093ES Single read from an extremity of a full-...	52	0.002
408	emb|BX040136.1|CNS0934S Single read from an extremity of a full-...	52	0.002
409	emb|BX039576.1|CNS092P8 Single read from an extremity of a full-...	52	0.002
410	emb|BX039575.1|CNS092P7 Single read from an extremity of a full-...	52	0.002
411	emb|BX039533.1|CNS092O1 Single read from an extremity of a full-...	52	0.002
412	emb|BX039261.1|CNS092GH Single read from an extremity of a full-...	52	0.002
413	emb|BX039260.1|CNS092GG Single read from an extremity of a full-...	52	0.002
414	emb|BX039143.1|CNS092D7 Single read from an extremity of a full-...	52	0.002
415	emb|BX037453.1|CNS09129 Single read from an extremity of a full-...	52	0.002
416	emb|BX037434.1|CNS0911Q Single read from an extremity of a full-...	52	0.002
417	emb|BX037433.1|CNS0911P Single read from an extremity of a full-...	52	0.002
418	emb|BX036970.1|CNS090OU Single read from an extremity of a full-...	52	0.002
419	emb|BX036969.1|CNS090OT Single read from an extremity of a full-...	52	0.002
420	emb|BX036482.1|CNS090BA Single read from an extremity of a full-...	52	0.002
421	emb|BX036481.1|CNS090B9 Single read from an extremity of a full-...	52	0.002
422	emb|BX036217.1|CNS0903X Single read from an extremity of a full-...	52	0.002
423	emb|BX036216.1|CNS0903W Single read from an extremity of a full-...	52	0.002
424	emb|BX036197.1|CNS0903D Single read from an extremity of a full-...	52	0.002
425	emb|BX036196.1|CNS0903C Single read from an extremity of a full-...	52	0.002
426	emb|BX036099.1|CNS0900N Single read from an extremity of a full-...	52	0.002
427	emb|BX036098.1|CNS0900M Single read from an extremity of a full-...	52	0.002
428	emb|BX035700.1|CNS08ZPK Single read from an extremity of a full-...	52	0.002
429	emb|BX035668.1|CNS08ZOO Single read from an extremity of a full-...	52	0.002
430	emb|BX035667.1|CNS08ZON Single read from an extremity of a full-...	52	0.002
431	emb|BX035566.1|CNS08ZLU Single read from an extremity of a full-...	52	0.002
432	emb|BX034802.1|CNS08Z0M Single read from an extremity of a full-...	52	0.002
433	emb|BX034801.1|CNS08Z0L Single read from an extremity of a full-...	52	0.002
434	emb|BX034329.1|CNS08YNH Single read from an extremity of a full-...	52	0.002
435	emb|BX034088.1|CNS08YGS Single read from an extremity of a full-...	52	0.002
436	emb|BX034087.1|CNS08YGR Single read from an extremity of a full-...	52	0.002
437	emb|BX033987.1|CNS08YDZ Single read from an extremity of a full-...	52	0.002
438	emb|BX032612.1|CNS08XBS Single read from an extremity of a full-...	52	0.002
439	emb|BX032477.1|CNS08X81 Single read from an extremity of a full-...	52	0.002
440	emb|BX032476.1|CNS08X80 Single read from an extremity of a full-...	52	0.002
441	emb|BX032360.1|CNS08X4S Single read from an extremity of a full-...	52	0.002
442	emb|BX032359.1|CNS08X4R Single read from an extremity of a full-...	52	0.002
443	emb|BX032294.1|CNS08X2Y Single read from an extremity of a full-...	52	0.002
444	emb|BX032293.1|CNS08X2X Single read from an extremity of a full-...	52	0.002
445	emb|BX032199.1|CNS08X0B Single read from an extremity of a full-...	52	0.002
446	emb|BX031887.1|CNS08WRN Single read from an extremity of a full-...	52	0.002
447	emb|BX031886.1|CNS08WRM Single read from an extremity of a full-...	52	0.002
448	emb|BX031841.1|CNS08WQD Single read from an extremity of a full-...	52	0.002
449	emb|BX031840.1|CNS08WQC Single read from an extremity of a full-...	52	0.002
450	emb|BX031779.1|CNS08WON Single read from an extremity of a full-...	52	0.002
451	emb|BX031778.1|CNS08WOM Single read from an extremity of a full-...	52	0.002
452	emb|BX031478.1|CNS08WGA Single read from an extremity of a full-...	52	0.002
453	emb|BX031467.1|CNS08WFZ Single read from an extremity of a full-...	52	0.002
454	emb|BX031466.1|CNS08WFY Single read from an extremity of a full-...	52	0.002
455	emb|BX031429.1|CNS08WEX Single read from an extremity of a full-...	52	0.002
456	emb|BX029472.1|CNS08UWK Single read from an extremity of a full-...	52	0.002
457	emb|BX029434.1|CNS08UVI Single read from an extremity of a full-...	52	0.002
458	emb|BX029433.1|CNS08UVH Single read from an extremity of a full-...	52	0.002
459	emb|BX029400.1|CNS08UUK Single read from an extremity of a full-...	52	0.002
460	emb|BX029399.1|CNS08UUJ Single read from an extremity of a full-...	52	0.002
461	emb|BX029680.1|CNS08V2C Single read from an extremity of a full-...	52	0.002
462	emb|BX029679.1|CNS08V2B Single read from an extremity of a full-...	52	0.002
463	emb|BX029634.1|CNS08V12 Single read from an extremity of a full-...	52	0.002
464	emb|BX028961.1|CNS08UID Single read from an extremity of a full-...	52	0.002
465	emb|BX028778.1|CNS08UDA Single read from an extremity of a full-...	52	0.002
466	emb|BX028777.1|CNS08UD9 Single read from an extremity of a full-...	52	0.002
467	emb|BX028647.1|CNS08U9N Single read from an extremity of a full-...	52	0.002
468	emb|BX028646.1|CNS08U9M Single read from an extremity of a full-...	52	0.002
469	emb|BX028589.1|CNS08U81 Single read from an extremity of a full-...	52	0.002
470	emb|BX028588.1|CNS08U80 Single read from an extremity of a full-...	52	0.002
471	emb|BX028456.1|CNS08U4C Single read from an extremity of a full-...	52	0.002
472	emb|BX028432.1|CNS08U3O Single read from an extremity of a full-...	52	0.002
473	emb|BX028431.1|CNS08U3N Single read from an extremity of a full-...	52	0.002
474	emb|BX028413.1|CNS08U35 Single read from an extremity of a full-...	52	0.002
475	emb|BX028367.1|CNS08U1V Single read from an extremity of a full-...	52	0.002
476	emb|BX028366.1|CNS08U1U Single read from an extremity of a full-...	52	0.002
477	emb|BX028266.1|CNS08TZ2 Single read from an extremity of a full-...	52	0.002
478	emb|BX028265.1|CNS08TZ1 Single read from an extremity of a full-...	52	0.002
479	emb|BX028083.1|CNS08TTZ Single read from an extremity of a full-...	52	0.002
480	emb|BX028025.1|CNS08TSD Single read from an extremity of a full-...	52	0.002
481	emb|BX027952.1|CNS08TQC Single read from an extremity of a full-...	52	0.002
482	emb|BX027951.1|CNS08TQB Single read from an extremity of a full-...	52	0.002
483	emb|BX027857.1|CNS08TNP Single read from an extremity of a full-...	52	0.002
484	emb|BX027779.1|CNS08TLJ Single read from an extremity of a full-...	52	0.002
485	emb|BX027696.1|CNS08TJ8 Single read from an extremity of a full-...	52	0.002
486	emb|BX027695.1|CNS08TJ7 Single read from an extremity of a full-...	52	0.002
487	emb|BX027677.1|CNS08TIP Single read from an extremity of a full-...	52	0.002
488	emb|BX027635.1|CNS08THJ Single read from an extremity of a full-...	52	0.002
489	emb|BX027634.1|CNS08THI Single read from an extremity of a full-...	52	0.002
490	emb|BX027566.1|CNS08TFM Single read from an extremity of a full-...	52	0.002
491	emb|BX027562.1|CNS08TFI Single read from an extremity of a full-...	52	0.002
492	emb|BX026986.1|CNS08SZI Single read from an extremity of a full-...	52	0.002
493	emb|BX026985.1|CNS08SZH Single read from an extremity of a full-...	52	0.002
494	emb|BX026939.1|CNS08SY7 Single read from an extremity of a full-...	52	0.002
495	emb|BX026938.1|CNS08SY6 Single read from an extremity of a full-...	52	0.002
496	emb|BX026768.1|CNS08STG Single read from an extremity of a full-...	52	0.002
497	emb|BX026767.1|CNS08STF Single read from an extremity of a full-...	52	0.002
498	emb|BX026049.1|CNS08S9H Single read from an extremity of a full-...	52	0.002
499	emb|BX026048.1|CNS08S9G Single read from an extremity of a full-...	52	0.002
500	emb|BX025624.1|CNS08RXO Single read from an extremity of a full-...	52	0.002

---

>ref|XM_483589.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 980

 Score =  287 bits (145), Expect = 2e-74
 Identities = 319/377 (84%)
 Strand = Plus / Minus

                                                                       
Query: 178 cgcggttgcccgagtcgccaccatccttgaagggtttcttcttcatctgcaacctcctct 237
           ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 790 cgcggttccctgagtcaccaccatccttgaagggtttcttcttcatctgcaacctcctct 731

                                                                       
Query: 238 ccggacacttgagcttgaagggcatgagaaagctcgccgtttccctgaagtgcggcccga 297
           | |||||||||||||||||||||||||| ||  | |  | ||| |||||||| || || |
Sbjct: 730 ctggacacttgagcttgaagggcatgaggaaatttgaagcttctctgaagtgtgggccaa 671

                                                                       
Query: 298 ccgtggagatttcgtgcacgacatcttctaaacatatgacgccgtgttctccaagagcct 357
           | |  | |||||| ||||| | |||||| |||||||||| ||| | |||||| |||||||
Sbjct: 670 ctgatgcgatttcatgcacaagatcttccaaacatatgatgccatattctcccagagcct 611

                                                                       
Query: 358 tctcgattagatcattgctggtaagggggaaaggctccttgtcgaaatacccgcgaccct 417
           |||| || ||||||||||||||||| |||||||| |||||||| |   |||| || ||||
Sbjct: 610 tctcaatgagatcattgctggtaagagggaaaggttccttgtccaggaacccacggccct 551

                                                                       
Query: 418 tcttgtagataagctccttcacattcttcaaattggggaacccataggtgacaaacggcc 477
           ||||||| ||||| |||||||||||||||||||| ||||||||||| |||| ||||||| 
Sbjct: 550 tcttgtaaataagatccttcacattcttcaaatttgggaacccataagtgataaacggct 491

                                                                       
Query: 478 caacagcagcaagcctcttgaggtttgcctcggtggccttgaggaagactcctgtgagga 537
           | ||| ||  ||||||||| |   | || || |||||||||||||| || || |||||||
Sbjct: 490 ccacaacaagaagcctcttcatagtagcgtcagtggccttgaggaacacgccggtgagga 431

                            
Query: 538 cctgggtcagccgcagc 554
           |||| ||||||||||||
Sbjct: 430 cctgcgtcagccgcagc 414



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 56/64 (87%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                       
Query: 44  tttccgaaacaaaggtacattcagctatgctattacaaaaccgacacggtaataacggat 103
           |||| |||| ||||||||| || |||| ||||||||||||| |||| ||| |||||||||
Sbjct: 929 tttcagaaataaaggtacaatcggctaggctattacaaaactgacaaggt-ataacggat 871

               
Query: 104 ccat 107
           ||||
Sbjct: 870 ccat 867

---

>ref|XM_507312.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1211_G06.30
           mRNA
          Length = 984

 Score =  287 bits (145), Expect = 2e-74
 Identities = 319/377 (84%)
 Strand = Plus / Minus

                                                                       
Query: 178 cgcggttgcccgagtcgccaccatccttgaagggtttcttcttcatctgcaacctcctct 237
           ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 790 cgcggttccctgagtcaccaccatccttgaagggtttcttcttcatctgcaacctcctct 731

                                                                       
Query: 238 ccggacacttgagcttgaagggcatgagaaagctcgccgtttccctgaagtgcggcccga 297
           | |||||||||||||||||||||||||| ||  | |  | ||| |||||||| || || |
Sbjct: 730 ctggacacttgagcttgaagggcatgaggaaatttgaagcttctctgaagtgtgggccaa 671

                                                                       
Query: 298 ccgtggagatttcgtgcacgacatcttctaaacatatgacgccgtgttctccaagagcct 357
           | |  | |||||| ||||| | |||||| |||||||||| ||| | |||||| |||||||
Sbjct: 670 ctgatgcgatttcatgcacaagatcttccaaacatatgatgccatattctcccagagcct 611

                                                                       
Query: 358 tctcgattagatcattgctggtaagggggaaaggctccttgtcgaaatacccgcgaccct 417
           |||| || ||||||||||||||||| |||||||| |||||||| |   |||| || ||||
Sbjct: 610 tctcaatgagatcattgctggtaagagggaaaggttccttgtccaggaacccacggccct 551

                                                                       
Query: 418 tcttgtagataagctccttcacattcttcaaattggggaacccataggtgacaaacggcc 477
           ||||||| ||||| |||||||||||||||||||| ||||||||||| |||| ||||||| 
Sbjct: 550 tcttgtaaataagatccttcacattcttcaaatttgggaacccataagtgataaacggct 491

                                                                       
Query: 478 caacagcagcaagcctcttgaggtttgcctcggtggccttgaggaagactcctgtgagga 537
           | ||| ||  ||||||||| |   | || || |||||||||||||| || || |||||||
Sbjct: 490 ccacaacaagaagcctcttcatagtagcgtcagtggccttgaggaacacgccggtgagga 431

                            
Query: 538 cctgggtcagccgcagc 554
           |||| ||||||||||||
Sbjct: 430 cctgcgtcagccgcagc 414



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 56/64 (87%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                       
Query: 44  tttccgaaacaaaggtacattcagctatgctattacaaaaccgacacggtaataacggat 103
           |||| |||| ||||||||| || |||| ||||||||||||| |||| ||| |||||||||
Sbjct: 929 tttcagaaataaaggtacaatcggctaggctattacaaaactgacaaggt-ataacggat 871

               
Query: 104 ccat 107
           ||||
Sbjct: 870 ccat 867

---

>dbj|AK101416.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033037N08, full
           insert sequence
          Length = 981

 Score =  287 bits (145), Expect = 2e-74
 Identities = 319/377 (84%)
 Strand = Plus / Minus

                                                                       
Query: 178 cgcggttgcccgagtcgccaccatccttgaagggtttcttcttcatctgcaacctcctct 237
           ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 790 cgcggttccctgagtcaccaccatccttgaagggtttcttcttcatctgcaacctcctct 731

                                                                       
Query: 238 ccggacacttgagcttgaagggcatgagaaagctcgccgtttccctgaagtgcggcccga 297
           | |||||||||||||||||||||||||| ||  | |  | ||| |||||||| || || |
Sbjct: 730 ctggacacttgagcttgaagggcatgaggaaatttgaagcttctctgaagtgtgggccaa 671

                                                                       
Query: 298 ccgtggagatttcgtgcacgacatcttctaaacatatgacgccgtgttctccaagagcct 357
           | |  | |||||| ||||| | |||||| |||||||||| ||| | |||||| |||||||
Sbjct: 670 ctgatgcgatttcatgcacaagatcttccaaacatatgatgccatattctcccagagcct 611

                                                                       
Query: 358 tctcgattagatcattgctggtaagggggaaaggctccttgtcgaaatacccgcgaccct 417
           |||| || ||||||||||||||||| |||||||| |||||||| |   |||| || ||||
Sbjct: 610 tctcaatgagatcattgctggtaagagggaaaggttccttgtccaggaacccacggccct 551

                                                                       
Query: 418 tcttgtagataagctccttcacattcttcaaattggggaacccataggtgacaaacggcc 477
           ||||||| ||||| |||||||||||||||||||| ||||||||||| |||| ||||||| 
Sbjct: 550 tcttgtaaataagatccttcacattcttcaaatttgggaacccataagtgataaacggct 491

                                                                       
Query: 478 caacagcagcaagcctcttgaggtttgcctcggtggccttgaggaagactcctgtgagga 537
           | ||| ||  ||||||||| |   | || || |||||||||||||| || || |||||||
Sbjct: 490 ccacaacaagaagcctcttcatagtagcgtcagtggccttgaggaacacgccggtgagga 431

                            
Query: 538 cctgggtcagccgcagc 554
           |||| ||||||||||||
Sbjct: 430 cctgcgtcagccgcagc 414



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 56/64 (87%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                       
Query: 44  tttccgaaacaaaggtacattcagctatgctattacaaaaccgacacggtaataacggat 103
           |||| |||| ||||||||| || |||| ||||||||||||| |||| ||| |||||||||
Sbjct: 929 tttcagaaataaaggtacaatcggctaggctattacaaaactgacaaggt-ataacggat 871

               
Query: 104 ccat 107
           ||||
Sbjct: 870 ccat 867

---

>dbj|AK058490.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-E01, full
           insert sequence
          Length = 984

 Score =  287 bits (145), Expect = 2e-74
 Identities = 319/377 (84%)
 Strand = Plus / Minus

                                                                       
Query: 178 cgcggttgcccgagtcgccaccatccttgaagggtttcttcttcatctgcaacctcctct 237
           ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 790 cgcggttccctgagtcaccaccatccttgaagggtttcttcttcatctgcaacctcctct 731

                                                                       
Query: 238 ccggacacttgagcttgaagggcatgagaaagctcgccgtttccctgaagtgcggcccga 297
           | |||||||||||||||||||||||||| ||  | |  | ||| |||||||| || || |
Sbjct: 730 ctggacacttgagcttgaagggcatgaggaaatttgaagcttctctgaagtgtgggccaa 671

                                                                       
Query: 298 ccgtggagatttcgtgcacgacatcttctaaacatatgacgccgtgttctccaagagcct 357
           | |  | |||||| ||||| | |||||| |||||||||| ||| | |||||| |||||||
Sbjct: 670 ctgatgcgatttcatgcacaagatcttccaaacatatgatgccatattctcccagagcct 611

                                                                       
Query: 358 tctcgattagatcattgctggtaagggggaaaggctccttgtcgaaatacccgcgaccct 417
           |||| || ||||||||||||||||| |||||||| |||||||| |   |||| || ||||
Sbjct: 610 tctcaatgagatcattgctggtaagagggaaaggttccttgtccaggaacccacggccct 551

                                                                       
Query: 418 tcttgtagataagctccttcacattcttcaaattggggaacccataggtgacaaacggcc 477
           ||||||| ||||| |||||||||||||||||||| ||||||||||| |||| ||||||| 
Sbjct: 550 tcttgtaaataagatccttcacattcttcaaatttgggaacccataagtgataaacggct 491

                                                                       
Query: 478 caacagcagcaagcctcttgaggtttgcctcggtggccttgaggaagactcctgtgagga 537
           | ||| ||  ||||||||| |   | || || |||||||||||||| || || |||||||
Sbjct: 490 ccacaacaagaagcctcttcatagtagcgtcagtggccttgaggaacacgccggtgagga 431

                            
Query: 538 cctgggtcagccgcagc 554
           |||| ||||||||||||
Sbjct: 430 cctgcgtcagccgcagc 414



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 55/64 (85%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                       
Query: 44  tttccgaaacaaaggtacattcagctatgctattacaaaaccgacacggtaataacggat 103
           |||| |||| ||||||||| || |||| ||||||||||| | |||| ||| |||||||||
Sbjct: 929 tttcagaaataaaggtacaatcggctaggctattacaaatctgacaaggt-ataacggat 871

               
Query: 104 ccat 107
           ||||
Sbjct: 870 ccat 867

---

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score =  143 bits (72), Expect = 8e-31
 Identities = 84/88 (95%)
 Strand = Plus / Minus

                                                                            
Query: 178      cgcggttgcccgagtcgccaccatccttgaagggtttcttcttcatctgcaacctcctct 237
                ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 27122054 cgcggttccctgagtcaccaccatccttgaagggtttcttcttcatctgcaacctcctct 27121995

                                            
Query: 238      ccggacacttgagcttgaagggcatgag 265
                | ||||||||||||||||||||||||||
Sbjct: 27121994 ctggacacttgagcttgaagggcatgag 27121967



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                            
Query: 355      ccttctcgattagatcattgctggtaagggggaaaggctccttgtcgaaatacccgcgac 414
                ||||||| || ||||||||||||||||| |||||||| |||||||| |   |||| || |
Sbjct: 27121383 ccttctcaatgagatcattgctggtaagagggaaaggttccttgtccaggaacccacggc 27121324

                                                             
Query: 415      ccttcttgtagataagctccttcacattcttcaaattggggaacc 459
                |||||||||| ||||| |||||||||||||||||||| |||||||
Sbjct: 27121323 ccttcttgtaaataagatccttcacattcttcaaatttgggaacc 27121279



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/163 (83%), Gaps = 4/163 (2%)
 Strand = Plus / Minus

                                                                            
Query: 195      ccaccatccttgaagggtttcttcttcatctgcaacctcctctccggacacttgagcttg 254
                |||||||||||| ||||||||||||||||||| |||||||| ||  ||||||||||||||
Sbjct: 27128982 ccaccatccttgtagggtttcttcttcatctgtaacctcct-tcttgacacttgagcttg 27128924

                                                                            
Query: 255      aagggcatgagaaagctcgccgtttccctgaagtgcggcccgaccgtggagatttcgtgc 314
                ||||||||||| ||| | |  | ||  |||||||| || ||||| || | |||||| |||
Sbjct: 27128923 aagggcatgaggaagtttgaagcttgtctgaagtgtggaccgactgttgcgatttcatgc 27128864

                                                           
Query: 315      acgacatcttctaaacatatgacgccgtgttctccaagagcct 357
                    ||||||| |||||||||| ||| |||||||| |||||||
Sbjct: 27128863 ---tcatcttccaaacatatgatgccatgttctcctagagcct 27128824



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                            
Query: 6        tgctatttcgtgatctgatcccaaacactcaggtagggtttccgaaacaaaggtacattc 65
                ||||||||| | ||||||||||||||| ||||||| | |||| |||| ||||||||| ||
Sbjct: 27129182 tgctatttcataatctgatcccaaacattcaggtacgctttcagaaataaaggtacaatc 27129123

                                 
Query: 66       agctatgctattacaaa 82
                 |||| |||||||||||
Sbjct: 27129122 ggctaggctattacaaa 27129106



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                             
Query: 510      gtggccttgaggaagactcctgtgaggacctgggtcagccgcagc 554
                |||||||||||||| || || ||||||||||| ||||||||||||
Sbjct: 27121115 gtggccttgaggaacacgccggtgaggacctgcgtcagccgcagc 27121071



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 56/64 (87%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                            
Query: 44       tttccgaaacaaaggtacattcagctatgctattacaaaaccgacacggtaataacggat 103
                |||| |||| ||||||||| || |||| ||||||||||||| |||| ||| |||||||||
Sbjct: 27122193 tttcagaaataaaggtacaatcggctaggctattacaaaactgacaaggt-ataacggat 27122135

                    
Query: 104      ccat 107
                ||||
Sbjct: 27122134 ccat 27122131

---

>dbj|AP003914.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1521_G02
          Length = 117964

 Score =  143 bits (72), Expect = 8e-31
 Identities = 84/88 (95%)
 Strand = Plus / Minus

                                                                         
Query: 178   cgcggttgcccgagtcgccaccatccttgaagggtttcttcttcatctgcaacctcctct 237
             ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 23087 cgcggttccctgagtcaccaccatccttgaagggtttcttcttcatctgcaacctcctct 23028

                                         
Query: 238   ccggacacttgagcttgaagggcatgag 265
             | ||||||||||||||||||||||||||
Sbjct: 23027 ctggacacttgagcttgaagggcatgag 23000



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 355   ccttctcgattagatcattgctggtaagggggaaaggctccttgtcgaaatacccgcgac 414
             ||||||| || ||||||||||||||||| |||||||| |||||||| |   |||| || |
Sbjct: 22416 ccttctcaatgagatcattgctggtaagagggaaaggttccttgtccaggaacccacggc 22357

                                                          
Query: 415   ccttcttgtagataagctccttcacattcttcaaattggggaacc 459
             |||||||||| ||||| |||||||||||||||||||| |||||||
Sbjct: 22356 ccttcttgtaaataagatccttcacattcttcaaatttgggaacc 22312



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 136/163 (83%), Gaps = 4/163 (2%)
 Strand = Plus / Minus

                                                                         
Query: 195   ccaccatccttgaagggtttcttcttcatctgcaacctcctctccggacacttgagcttg 254
             |||||||||||| ||||||||||||||||||| |||||||| ||  ||||||||||||||
Sbjct: 30015 ccaccatccttgtagggtttcttcttcatctgtaacctcct-tcttgacacttgagcttg 29957

                                                                         
Query: 255   aagggcatgagaaagctcgccgtttccctgaagtgcggcccgaccgtggagatttcgtgc 314
             ||||||||||| ||| | |  | ||  |||||||| || ||||| || | |||||| |||
Sbjct: 29956 aagggcatgaggaagtttgaagcttgtctgaagtgtggaccgactgttgcgatttcatgc 29897

                                                        
Query: 315   acgacatcttctaaacatatgacgccgtgttctccaagagcct 357
                 ||||||| |||||||||| ||| |||||||| |||||||
Sbjct: 29896 ---tcatcttccaaacatatgatgccatgttctcctagagcct 29857



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                         
Query: 6     tgctatttcgtgatctgatcccaaacactcaggtagggtttccgaaacaaaggtacattc 65
             ||||||||| | ||||||||||||||| ||||||| | |||| |||| ||||||||| ||
Sbjct: 30215 tgctatttcataatctgatcccaaacattcaggtacgctttcagaaataaaggtacaatc 30156

                              
Query: 66    agctatgctattacaaa 82
              |||| |||||||||||
Sbjct: 30155 ggctaggctattacaaa 30139



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 510   gtggccttgaggaagactcctgtgaggacctgggtcagccgcagc 554
             |||||||||||||| || || ||||||||||| ||||||||||||
Sbjct: 22148 gtggccttgaggaacacgccggtgaggacctgcgtcagccgcagc 22104



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 56/64 (87%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                         
Query: 44    tttccgaaacaaaggtacattcagctatgctattacaaaaccgacacggtaataacggat 103
             |||| |||| ||||||||| || |||| ||||||||||||| |||| ||| |||||||||
Sbjct: 23226 tttcagaaataaaggtacaatcggctaggctattacaaaactgacaaggt-ataacggat 23168

                 
Query: 104   ccat 107
             ||||
Sbjct: 23167 ccat 23164

---

>dbj|AP003948.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
             clone:OJ1211_G06
          Length = 96421

 Score =  143 bits (72), Expect = 8e-31
 Identities = 84/88 (95%)
 Strand = Plus / Minus

                                                                         
Query: 178   cgcggttgcccgagtcgccaccatccttgaagggtttcttcttcatctgcaacctcctct 237
             ||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 93141 cgcggttccctgagtcaccaccatccttgaagggtttcttcttcatctgcaacctcctct 93082

                                         
Query: 238   ccggacacttgagcttgaagggcatgag 265
             | ||||||||||||||||||||||||||
Sbjct: 93081 ctggacacttgagcttgaagggcatgag 93054



 Score =  105 bits (53), Expect = 2e-19
 Identities = 92/105 (87%)
 Strand = Plus / Minus

                                                                         
Query: 355   ccttctcgattagatcattgctggtaagggggaaaggctccttgtcgaaatacccgcgac 414
             ||||||| || ||||||||||||||||| |||||||| |||||||| |   |||| || |
Sbjct: 92470 ccttctcaatgagatcattgctggtaagagggaaaggttccttgtccaggaacccacggc 92411

                                                          
Query: 415   ccttcttgtagataagctccttcacattcttcaaattggggaacc 459
             |||||||||| ||||| |||||||||||||||||||| |||||||
Sbjct: 92410 ccttcttgtaaataagatccttcacattcttcaaatttgggaacc 92366



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                          
Query: 510   gtggccttgaggaagactcctgtgaggacctgggtcagccgcagc 554
             |||||||||||||| || || ||||||||||| ||||||||||||
Sbjct: 92202 gtggccttgaggaacacgccggtgaggacctgcgtcagccgcagc 92158



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 56/64 (87%), Gaps = 1/64 (1%)
 Strand = Plus / Minus

                                                                         
Query: 44    tttccgaaacaaaggtacattcagctatgctattacaaaaccgacacggtaataacggat 103
             |||| |||| ||||||||| || |||| ||||||||||||| |||| ||| |||||||||
Sbjct: 93280 tttcagaaataaaggtacaatcggctaggctattacaaaactgacaaggt-ataacggat 93222

                 
Query: 104   ccat 107
             ||||
Sbjct: 93221 ccat 93218

---

>gb|AY111978.1| Zea mays CL45039_-2 mRNA sequence
          Length = 623

 Score =  127 bits (64), Expect = 5e-26
 Identities = 160/192 (83%)
 Strand = Plus / Plus

                                                                       
Query: 162 tcgttgatcttgtccccgcggttgcccgagtcgccaccatccttgaagggtttcttcttc 221
           |||||||  ||||| || |||||||| || ||||| ||||||||| | |||||| |||||
Sbjct: 250 tcgttgactttgtcgccacggttgcctgaatcgccgccatccttgtacggtttcctcttc 309

                                                                       
Query: 222 atctgcaacctcctctccggacacttgagcttgaagggcatgagaaagctcgccgtttcc 281
           ||||||| ||||||||||||||||||||||| |||||||||||| || ||||  | ||| 
Sbjct: 310 atctgcagcctcctctccggacacttgagctggaagggcatgaggaacctcgatgcttct 369

                                                                       
Query: 282 ctgaagtgcggcccgaccgtggagatttcgtgcacgacatcttctaaacatatgacgccg 341
           | ||||||||| || || |||| ||| |||||||| |  ||||| || ||||||| ||| 
Sbjct: 370 cggaagtgcgggcctacagtggcgatctcgtgcacaaggtcttccaagcatatgatgcca 429

                       
Query: 342 tgttctccaaga 353
           || |||||||||
Sbjct: 430 tgatctccaaga 441



 Score = 48.1 bits (24), Expect = 0.036
 Identities = 36/40 (90%)
 Strand = Plus / Plus

                                                   
Query: 406 acccgcgacccttcttgtagataagctccttcacattctt 445
           ||||||| || ||||||||||||||||| |||||| ||||
Sbjct: 494 acccgcggcctttcttgtagataagctctttcacactctt 533



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 59  tacattcagctatgctattacaaaaccgaca 89
           ||||| |||||||||||||||||||| ||||
Sbjct: 72  tacatccagctatgctattacaaaactgaca 102

---

>gb|AY104606.1| Zea mays PCO071007 mRNA sequence
          Length = 785

 Score =  115 bits (58), Expect = 2e-22
 Identities = 233/289 (80%), Gaps = 2/289 (0%)
 Strand = Plus / Minus

                                                                       
Query: 330 catatgacgccgtgttctccaagagccttctcgattagatcattgctggtaagggggaaa 389
           ||||||| |||||| | ||||||||| ||||| |||||||| || |||||||| ||||||
Sbjct: 773 catatgatgccgtgatntccaagagc-ttctcaattagatcgttactggtaagagggaaa 715

                                                                       
Query: 390 ggctccttgtcgaaatacccgcgacccttcttgtagataagctccttcacattcttcaaa 449
           || || ||||||||| |||| || ||||||||||| |||||||| ||||| |||||||| 
Sbjct: 714 gg-tctttgtcgaaaaacccacggcccttcttgtaaataagctctttcacgttcttcaag 656

                                                                       
Query: 450 ttggggaacccataggtgacaaacggcccaacagcagcaagcctcttgaggtttgcctcg 509
           || || ||||| ||||||||||| ||  | ||  ||  ||||||||| ||  |   ||||
Sbjct: 655 tttggaaacccgtaggtgacaaagggttcgaccacaagaagcctcttcagcgtcagctcg 596

                                                                       
Query: 510 gtggccttgaggaagactcctgtgaggacctgggtcagccgcagcctggccaagatcttc 569
           |||||| ||||||| || || |||||||||   |||||||| ||| |   ||||| ||||
Sbjct: 595 gtggccctgaggaatacgccggtgaggaccgtcgtcagccgtagcttcctcaagaccttc 536

                                                            
Query: 570 ctgatttgcgggtgcaagtcggcagtgcctgggatgcggatggcgaaga 618
           ||||| ||||| ||||||||  | | ||| |||||||| || |||||||
Sbjct: 535 ctgatgtgcggatgcaagtccacggagccagggatgcgaattgcgaaga 487

---

>ref|XM_483591.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 207

 Score = 93.7 bits (47), Expect = 7e-16
 Identities = 66/71 (92%), Gaps = 1/71 (1%)
 Strand = Plus / Minus

                                                                       
Query: 195 ccaccatccttgaagggtttcttcttcatctgcaacctcctctccggacacttgagcttg 254
           |||||||||||| ||||||||||||||||||| |||||||| ||  ||||||||||||||
Sbjct: 144 ccaccatccttgtagggtttcttcttcatctgtaacctcct-tcttgacacttgagcttg 86

                      
Query: 255 aagggcatgag 265
           |||||||||||
Sbjct: 85  aagggcatgag 75

---

>emb|BX065427.1|CNS09MNB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 197

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||||||||||||||  |||||||
Sbjct: 115 agctcgttgatcttgtccccgcggttgccgaagtcgcc 152

---

>emb|BX036885.1|CNS090MH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9AD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||||||||||||||  |||||||
Sbjct: 829 agctcgttgatcttgtccccgcggttgccgaagtcgcc 792

---

>emb|BX062168.1|CNS09K4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 559

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 159 agctcgttgatcttgtccccgcggttgcccga 190
           |||||||||||||||||| |||||||||||||
Sbjct: 182 agctcgttgatcttgtcctcgcggttgcccga 213

---

>emb|BX029473.1|CNS08UWL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 826

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 159 agctcgttgatcttgtccccgcggttgcccga 190
           |||||||||||||||||| |||||||||||||
Sbjct: 215 agctcgttgatcttgtcctcgcggttgcccga 246

---

>emb|BX019031.1|CNS08MUJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 240

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 159 agctcgttgatcttgtccccgcggttgcccga 190
           |||||||||||||||||| |||||||||||||
Sbjct: 185 agctcgttgatcttgtcctcgcggttgcccga 216

---

>emb|BX017181.1|CNS08LF5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA25DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 545

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Plus

                                           
Query: 159 agctcgttgatcttgtccccgcggttgcccga 190
           |||||||||||||||||| |||||||||||||
Sbjct: 210 agctcgttgatcttgtcctcgcggttgcccga 241

---

>emb|BX049251.1|CNS09A5Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 560

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 30/31 (96%)
 Strand = Plus / Plus

                                          
Query: 159 agctcgttgatcttgtccccgcggttgcccg 189
           |||||||||||||||||| ||||||||||||
Sbjct: 219 agctcgttgatcttgtcctcgcggttgcccg 249

---

>emb|BX053396.1|CNS09DD4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31AB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 678

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 208 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 245

---

>emb|BX072064.1|CNS09RRO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 817 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 780

---

>emb|BX071791.1|CNS09RK3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 202 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 239

---

>emb|BX071790.1|CNS09RK2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 829 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 792

---

>emb|BX071653.1|CNS09RG9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 808

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 199 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 236

---

>emb|BX071652.1|CNS09RG8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 804 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 767

---

>emb|BX071452.1|CNS09RAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 190 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 227

---

>emb|BX071451.1|CNS09RAN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 766 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 729

---

>emb|BX071396.1|CNS09R94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 921

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 823 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 786

---

>emb|BX071298.1|CNS09R6E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 718 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 681

---

>emb|BX071259.1|CNS09R5B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 204 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 241

---

>emb|BX071258.1|CNS09R5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 978

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 824 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 787

---

>emb|BX071034.1|CNS09QZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 182 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 219

---

>emb|BX071033.1|CNS09QZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 841 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 804

---

>emb|BX070988.1|CNS09QXS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 714

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 220 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 257

---

>emb|BX070987.1|CNS09QXR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 905

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 739 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 702

---

>emb|BX070913.1|CNS09QVP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 206 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 243

---

>emb|BX070912.1|CNS09QVO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 901

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 842 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 805

---

>emb|BX070805.1|CNS09QSP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 499

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 168 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 205

---

>emb|BX070804.1|CNS09QSO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AD01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 792 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 755

---

>emb|BX070631.1|CNS09QNV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 210 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 247

---

>emb|BX070630.1|CNS09QNU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 812 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 775

---

>emb|BX070560.1|CNS09QLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 363

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 193 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 230

---

>emb|BX070494.1|CNS09QK2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 189 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 226

---

>emb|BX070493.1|CNS09QK1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 911

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 746 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 709

---

>emb|BX070258.1|CNS09QDI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 222 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 259

---

>emb|BX070053.1|CNS09Q7T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 301

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 214 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 251

---

>emb|BX070052.1|CNS09Q7S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 843 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 806

---

>emb|BX070015.1|CNS09Q6R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 546

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 211 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 248

---

>emb|BX070014.1|CNS09Q6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 835 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 798

---

>emb|BX069981.1|CNS09Q5T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 828 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 791

---

>emb|BX069946.1|CNS09Q4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 879

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 838 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 801

---

>emb|BX069852.1|CNS09Q28 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 205 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 242

---

>emb|BX069851.1|CNS09Q27 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 900 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 863

---

>emb|BX069725.1|CNS09PYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 207 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 244

---

>emb|BX069724.1|CNS09PYO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 834 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 797

---

>emb|BX069627.1|CNS09PVZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 760

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 203 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 240

---

>emb|BX069626.1|CNS09PVY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 829 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 792

---

>emb|BX069444.1|CNS09PQW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 198 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 235

---

>emb|BX069443.1|CNS09PQV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 826 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 789

---

>emb|BX069442.1|CNS09PQU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 790

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 215 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 252

---

>emb|BX069441.1|CNS09PQT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 824 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 787

---

>emb|BX069361.1|CNS09POL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC6AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 785

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 206 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 243

---

>emb|BX069360.1|CNS09POK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 843 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 806

---

>emb|BX069131.1|CNS09PI7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 204 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 241

---

>emb|BX069130.1|CNS09PI6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1050

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 848 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 811

---

>emb|BX069121.1|CNS09PHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 452

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 226 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 263

---

>emb|BX069029.1|CNS09PFD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 243 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 280

---

>emb|BX069028.1|CNS09PFC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 782 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 745

---

>emb|BX068969.1|CNS09PDP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 477

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 228 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 265

---

>emb|BX068968.1|CNS09PDO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 804 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 767

---

>emb|BX068913.1|CNS09PC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 847 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 810

---

>emb|BX068796.1|CNS09P8W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 726 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 689

---

>emb|BX068679.1|CNS09P5N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 208 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 245

---

>emb|BX068678.1|CNS09P5M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1045

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 842 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 805

---

>emb|BX068669.1|CNS09P5D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 502

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 196 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 233

---

>emb|BX068455.1|CNS09OZF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1043

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 851 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 814

---

>emb|BX068359.1|CNS09OWR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52CB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 839 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 802

---

>emb|BX068150.1|CNS09OQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 831 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 794

---

>emb|BX068136.1|CNS09OQK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC52AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 210 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 247

---

>emb|BX068135.1|CNS09OQJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 922

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 843 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 806

---

>emb|BX067770.1|CNS09OGE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 763

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 195 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 232

---

>emb|BX067769.1|CNS09OGD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 890

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 818 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 781

---

>emb|BX067575.1|CNS09OAZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 207 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 244

---

>emb|BX067574.1|CNS09OAY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 805 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 768

---

>emb|BX067534.1|CNS09O9U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 289

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 66  agctcgttgatcttgtcctcgcggttgccgaagtcgcc 103

---

>emb|BX067533.1|CNS09O9T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 818 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 781

---

>emb|BX067446.1|CNS09O7E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 574

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 197 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 234

---

>emb|BX067445.1|CNS09O7D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 844

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 794 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 757

---

>emb|BX067333.1|CNS09O49 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 814 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 777

---

>emb|BX067064.1|CNS09NWS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 264

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 186 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 223

---

>emb|BX067063.1|CNS09NWR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1041

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 790 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 753

---

>emb|BX067001.1|CNS09NV1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 431

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 218 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 255

---

>emb|BX067000.1|CNS09NV0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 757 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 720

---

>emb|BX067241.1|CNS09O1P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 199 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 236

---

>emb|BX067240.1|CNS09O1O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1022

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 916 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 879

---

>emb|BX067178.1|CNS09NZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 198 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 235

---

>emb|BX067177.1|CNS09NZX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 602 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 565

---

>emb|BX067146.1|CNS09NZ2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 822

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 225 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 262

---

>emb|BX067145.1|CNS09NZ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1019

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 844 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 807

---

>emb|BX066849.1|CNS09NQT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 209 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 246

---

>emb|BX066848.1|CNS09NQS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 833 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 796

---

>emb|BX066768.1|CNS09NOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 593

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 204 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 241

---

>emb|BX066767.1|CNS09NOJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 812 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 775

---

>emb|BX066726.1|CNS09NNE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC50AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 802

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 192 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 229

---

>emb|BX066725.1|CNS09NND Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1017

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 827 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 790

---

>emb|BX066633.1|CNS09NKT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 838 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 801

---

>emb|BX066558.1|CNS09NIQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 679

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 66  agctcgttgatcttgtcctcgcggttgccgaagtcgcc 103

---

>emb|BX066557.1|CNS09NIP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 825 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 788

---

>emb|BX066512.1|CNS09NHG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 201 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 238

---

>emb|BX066511.1|CNS09NHF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 825 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 788

---

>emb|BX066367.1|CNS09NDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 537

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 191 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 228

---

>emb|BX066366.1|CNS09NDE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 634 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 597

---

>emb|BX066303.1|CNS09NBN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 596

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 198 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 235

---

>emb|BX066302.1|CNS09NBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 829 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 792

---

>emb|BX066297.1|CNS09NBH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 699

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 176 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 213

---

>emb|BX066296.1|CNS09NBG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 814 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 777

---

>emb|BX066130.1|CNS09N6U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 820

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 200 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 237

---

>emb|BX066129.1|CNS09N6T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 915 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 878

---

>emb|BX065912.1|CNS09N0S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 700

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 196 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 233

---

>emb|BX065603.1|CNS09MS7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 497

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 177 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 214

---

>emb|BX065559.1|CNS09MQZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 189 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 226

---

>emb|BX065558.1|CNS09MQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 821 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 784

---

>emb|BX065426.1|CNS09MNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 963

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 802 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 765

---

>emb|BX065421.1|CNS09MN5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 167 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 204

---

>emb|BX065420.1|CNS09MN4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 843 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 806

---

>emb|BX065376.1|CNS09MLW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 800

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 186 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 223

---

>emb|BX065375.1|CNS09MLV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 894

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 815 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 778

---

>emb|BX065329.1|CNS09MKL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 467

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 198 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 235

---

>emb|BX065312.1|CNS09MK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 828 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 791

---

>emb|BX065118.1|CNS09MEQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 883

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 837 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 800

---

>emb|BX065105.1|CNS09MED Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 865

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 796 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 759

---

>emb|BX064707.1|CNS09M3B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 364

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 188 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 225

---

>emb|BX064706.1|CNS09M3A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 784 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 747

---

>emb|BX064243.1|CNS09LQF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 207

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 123 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 160

---

>emb|BX064242.1|CNS09LQE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 818 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 781

---

>emb|BX064203.1|CNS09LPB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 286

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 204 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 241

---

>emb|BX064173.1|CNS09LOH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 289

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 204 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 241

---

>emb|BX064172.1|CNS09LOG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 812 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 775

---

>emb|BX064030.1|CNS09LKI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 550

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 193 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 230

---

>emb|BX064029.1|CNS09LKH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 801 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 764

---

>emb|BX063864.1|CNS09LFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 506

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 218 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 255

---

>emb|BX063860.1|CNS09LFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 260

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 205 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 242

---

>emb|BX063859.1|CNS09LFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 724 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 687

---

>emb|BX063580.1|CNS09L80 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 839

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 189 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 226

---

>emb|BX063579.1|CNS09L7Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 827 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 790

---

>emb|BX063193.1|CNS09KX9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 835

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 202 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 239

---

>emb|BX063192.1|CNS09KX8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 837 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 800

---

>emb|BX062982.1|CNS09KRE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 820 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 783

---

>emb|BX062974.1|CNS09KR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 220 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 257

---

>emb|BX062973.1|CNS09KR5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44CB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 956

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 823 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 786

---

>emb|BX062925.1|CNS09KPT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 190 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 227

---

>emb|BX062924.1|CNS09KPS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 810 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 773

---

>emb|BX062896.1|CNS09KP0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 348

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 184 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 221

---

>emb|BX062641.1|CNS09KHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 748 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 711

---

>emb|BX062575.1|CNS09KG3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 203 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 240

---

>emb|BX062574.1|CNS09KG2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 952

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 819 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 782

---

>emb|BX062497.1|CNS09KDX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 820 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 783

---

>emb|BX062308.1|CNS09K8O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 426

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 201 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 238

---

>emb|BX062215.1|CNS09K63 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 204 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 241

---

>emb|BX062214.1|CNS09K62 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 823 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 786

---

>emb|BX062069.1|CNS09K21 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 815

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 195 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 232

---

>emb|BX062068.1|CNS09K20 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 683 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 646

---

>emb|BX062040.1|CNS09K18 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 190 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 227

---

>emb|BX062039.1|CNS09K17 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 848

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 820 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 783

---

>emb|BX061714.1|CNS09JS6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 214 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 251

---

>emb|BX061713.1|CNS09JS5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 932

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 871 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 834

---

>emb|BX061678.1|CNS09JR6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 828 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 791

---

>emb|BX061619.1|CNS09JPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 214 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 251

---

>emb|BX061618.1|CNS09JPI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 843 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 806

---

>emb|BX061538.1|CNS09JNA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 159 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 196

---

>emb|BX061537.1|CNS09JN9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 838 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 801

---

>emb|BX061485.1|CNS09JLT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 871

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 205 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 242

---

>emb|BX061484.1|CNS09JLS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 833 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 796

---

>emb|BX061264.1|CNS09JFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 391

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 192 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 229

---

>emb|BX061263.1|CNS09JFN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 928

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 688 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 651

---

>emb|BX061104.1|CNS09JB8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 869

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 710 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 673

---

>emb|BX060853.1|CNS09J49 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 202 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 239

---

>emb|BX060852.1|CNS09J48 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41BF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 842 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 805

---

>emb|BX060835.1|CNS09J3R Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 866

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 201 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 238

---

>emb|BX060421.1|CNS09IS9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1074

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 829 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 792

---

>emb|BX060334.1|CNS09IPU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 201 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 238

---

>emb|BX060333.1|CNS09IPT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 830 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 793

---

>emb|BX059972.1|CNS09IFS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 493

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 225 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 262

---

>emb|BX059971.1|CNS09IFR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 972

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 822 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 785

---

>emb|BX059904.1|CNS09IDW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 757

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 213 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 250

---

>emb|BX059765.1|CNS09IA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 327

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 189 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 226

---

>emb|BX059761.1|CNS09I9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 205

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 147 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 184

---

>emb|BX059760.1|CNS09I9W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4DC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 803 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 766

---

>emb|BX059674.1|CNS09I7I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 806

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 729 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 692

---

>emb|BX059626.1|CNS09I66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 309

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 222 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 259

---

>emb|BX059625.1|CNS09I65 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 886

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 835 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 798

---

>emb|BX059607.1|CNS09I5N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 208 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 245

---

>emb|BX059606.1|CNS09I5M Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 874

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 781 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 744

---

>emb|BX059417.1|CNS09I0D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4BA07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 200 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 237

---

>emb|BX059393.1|CNS09HZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 717

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 222 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 259

---

>emb|BX059392.1|CNS09HZO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC4AH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 837 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 800

---

>emb|BX059211.1|CNS09HUN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 200 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 237

---

>emb|BX059210.1|CNS09HUM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 759 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 722

---

>emb|BX059153.1|CNS09HT1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 196 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 233

---

>emb|BX059152.1|CNS09HT0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1007

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 822 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 785

---

>emb|BX059116.1|CNS09HS0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 180 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 217

---

>emb|BX059115.1|CNS09HRZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1025

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 821 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 784

---

>emb|BX058758.1|CNS09HI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 779 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 742

---

>emb|BX058710.1|CNS09HGQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 565

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 172 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 209

---

>emb|BX058709.1|CNS09HGP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39BA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 800 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 763

---

>emb|BX058537.1|CNS09HBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC39AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 817 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 780

---

>emb|BX058436.1|CNS09H94 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 571

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 206 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 243

---

>emb|BX058409.1|CNS09H8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 440

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 225 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 262

---

>emb|BX056661.1|CNS09FVT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 892

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 205 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 242

---

>emb|BX056611.1|CNS09FUF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 776

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 156 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 193

---

>emb|BX056610.1|CNS09FUE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36AB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 828 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 791

---

>emb|BX057874.1|CNS09GTI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC38AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 727

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 115 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 152

---

>emb|BX057873.1|CNS09GTH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC38AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 805 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 768

---

>emb|BX057794.1|CNS09GRA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC37DF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 782

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 781 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 744

---

>emb|BX057529.1|CNS09GJX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC37CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 484

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 213 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 250

---

>emb|BX057073.1|CNS09G79 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 102

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 54  agctcgttgatcttgtcctcgcggttgccgaagtcgcc 91

---

>emb|BX056977.1|CNS09G4L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 611

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 217 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 254

---

>emb|BX056976.1|CNS09G4K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC36CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 860

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 851 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 814

---

>emb|BX056850.1|CNS09G12 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 321

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 184 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 221

---

>emb|BX056819.1|CNS09G07 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36BF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 316

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 191 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 228

---

>emb|BX056466.1|CNS09FQE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 803

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 189 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 226

---

>emb|BX056465.1|CNS09FQD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35DA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 962

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 817 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 780

---

>emb|BX056335.1|CNS09FMR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC35CC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 848 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 811

---

>emb|BX056260.1|CNS09FKO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC35BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 296

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 202 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 239

---

>emb|BX055500.1|CNS09EZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC34AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 819

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 203 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 240

---

>emb|BX055499.1|CNS09EZJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC34AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 810 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 773

---

>emb|BX055379.1|CNS09EW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33DH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 194

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 79  agctcgttgatcttgtcctcgcggttgccgaagtcgcc 116

---

>emb|BX055259.1|CNS09ESV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 891

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 754 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 717

---

>emb|BX053250.1|CNS09D92 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 855

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 210 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 247

---

>emb|BX053249.1|CNS09D91 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 937

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 835 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 798

---

>emb|BX053171.1|CNS09D6V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 398

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 208 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 245

---

>emb|BX053153.1|CNS09D6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 309

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 190 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 227

---

>emb|BX054879.1|CNS09EIB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 780

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 202 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 239

---

>emb|BX054878.1|CNS09EIA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 992

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 818 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 781

---

>emb|BX054828.1|CNS09EGW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 816 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 779

---

>emb|BX052909.1|CNS09CZL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 813

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 199 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 236

---

>emb|BX052908.1|CNS09CZK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC30BB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 861

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 816 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 779

---

>emb|BX054730.1|CNS09EE6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 821

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 188 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 225

---

>emb|BX054702.1|CNS09EDE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 634

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 178 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 215

---

>emb|BX054649.1|CNS09EBX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 807

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 205 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 242

---

>emb|BX054648.1|CNS09EBW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 836

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 834 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 797

---

>emb|BX054626.1|CNS09EBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 214 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 251

---

>emb|BX054625.1|CNS09EB9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32DE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 841

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 814 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 777

---

>emb|BX054462.1|CNS09E6Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 867

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 218 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 255

---

>emb|BX054461.1|CNS09E6P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 782 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 745

---

>emb|BX054393.1|CNS09E4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 830

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 215 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 252

---

>emb|BX054392.1|CNS09E4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 918

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 840 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 803

---

>emb|BX054176.1|CNS09DYS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 298

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 214 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 251

---

>emb|BX054175.1|CNS09DYR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1011

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 827 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 790

---

>emb|BX054174.1|CNS09DYQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 991

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 820 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 783

---

>emb|BX053953.1|CNS09DSL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 853

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 244 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 281

---

>emb|BX053952.1|CNS09DSK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC31DF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                 
Query: 159 agctcgttgatcttgtccccgcggttgcccgagtcgcc 196
           |||||||||||||||||| ||||||||||  |||||||
Sbjct: 850 agctcgttgatcttgtcctcgcggttgccgaagtcgcc 813


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,553,921
Number of Sequences: 3902068
Number of extensions: 5553921
Number of successful extensions: 128366
Number of sequences better than 10.0: 1010
Number of HSP's better than 10.0 without gapping: 1009
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 126896
Number of HSP's gapped (non-prelim): 1464
length of query: 649
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 626
effective length of database: 17,143,297,704
effective search space: 10731704362704
effective search space used: 10731704362704
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---