>gb|AC118627.6| Mus musculus chromosome 15, clone RP24-91E8, complete sequence
          Length = 256158

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 94     acatgaacttcactgtccaatcttctcag 122
              ||||||||||||||| |||||| ||||||
Sbjct: 212656 acatgaacttcactgcccaatcctctcag 212684

>gb|AC099020.2| Drosophila melanogaster clone BACR30H01, complete sequence
          Length = 155557

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 385    ctactcatttcacaaagatac 405
              |||||||||||||||||||||
Sbjct: 125166 ctactcatttcacaaagatac 125146

>gb|BT014109.1| Lycopersicon esculentum clone 133213F, mRNA sequence
          Length = 1299

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 225 catcccaacctgcttcctctt 245
           |||||||||||||||||||||
Sbjct: 369 catcccaacctgcttcctctt 389

>ref|XM_749213.1| Aspergillus fumigatus Af293 hypothetical protein (Afu3g13160)
           partial mRNA
          Length = 1851

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 130 aagatccgaatatcaacaact 150
           |||||||||||||||||||||
Sbjct: 620 aagatccgaatatcaacaact 640

>gb|AC099017.1| Drosophila melanogaster, chromosome 2L, region 37D-37E, BAC clone
              BACR27M12, complete sequence
          Length = 157766

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 385    ctactcatttcacaaagatac 405
              |||||||||||||||||||||
Sbjct: 145793 ctactcatttcacaaagatac 145813

>gb|AC009597.5|AC009597 Homo sapiens chromosome 8, clone RP11-33E15, complete sequence
          Length = 169479

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 139   atatcaacaactacctgccaaatac 163
             |||||||||| ||||||||||||||
Sbjct: 29818 atatcaacaaatacctgccaaatac 29842

>gb|AC022404.7|AC022404 Homo sapiens chromosome 14 clone CTD-2308C24 and RP11-757H14 map 14q31,
              complete sequence
          Length = 232309

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 43     ttacaatgatatattcaaaat 63
              |||||||||||||||||||||
Sbjct: 222923 ttacaatgatatattcaaaat 222903

>gb|AC011362.2|AC011362 Homo sapiens chromosome 5 clone CTC-503K11, complete sequence
          Length = 176029

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 177    attttccatggatttttgtatatgg 201
              ||||| |||||||||||||||||||
Sbjct: 103680 attttgcatggatttttgtatatgg 103656

>gb|AC008509.5|AC008509 Homo sapiens chromosome 5 clone CTC-449I11, complete sequence
          Length = 189456

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 177    attttccatggatttttgtatatgg 201
              ||||| |||||||||||||||||||
Sbjct: 175214 attttgcatggatttttgtatatgg 175238

>gb|AC116769.11| Mus musculus chromosome 15, clone RP23-415L16, complete sequence
          Length = 201535

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 94     acatgaacttcactgtccaatcttctcag 122
              ||||||||||||||| |||||| ||||||
Sbjct: 199590 acatgaacttcactgcccaatcctctcag 199562

>gb|AE003663.4| Drosophila melanogaster chromosome 2L, section 72 of 83 of the complete
              sequence
          Length = 290667

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 385    ctactcatttcacaaagatac 405
              |||||||||||||||||||||
Sbjct: 117412 ctactcatttcacaaagatac 117432

>gb|AC005128.1|AC005128 Drosophila melanogaster, chromosome 2L, region 37F1-37F6, P1 clone
             DS08491, complete sequence
          Length = 60040

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 385   ctactcatttcacaaagatac 405
             |||||||||||||||||||||
Sbjct: 30479 ctactcatttcacaaagatac 30459

>gb|AC007889.9| Drosophila melanogaster clone BACR48E12, complete sequence
          Length = 182182

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 254    caatgtggcaatgttgcaaa 273
              ||||||||||||||||||||
Sbjct: 122327 caatgtggcaatgttgcaaa 122346

>gb|AC007692.5| Drosophila melanogaster clone BACR06O05, complete sequence
          Length = 184662

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   caatgtggcaatgttgcaaa 273
             ||||||||||||||||||||
Sbjct: 39790 caatgtggcaatgttgcaaa 39809

>emb|BX936301.8| Zebrafish DNA sequence from clone CH211-261H10 in linkage group 9,
            complete sequence
          Length = 112250

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 53   atattcaaaatgtgtatcac 72
            ||||||||||||||||||||
Sbjct: 4193 atattcaaaatgtgtatcac 4174

>emb|CR847806.15| Zebrafish DNA sequence from clone CH211-267J10 in linkage group 8,
              complete sequence
          Length = 151455

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 290    actgattacaaatgctcaaa 309
              ||||||||||||||||||||
Sbjct: 140600 actgattacaaatgctcaaa 140581

>emb|Z82209.2|HS428A13 Human DNA sequence from clone RP3-428A13 on chromosome X Contains a
             intracellular membrane-associated calcium-independent
             phospholipase A2 (IPLA2) pseudogene, complete sequence
          Length = 154235

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 45    acaatgatatattcaaaatg 64
             ||||||||||||||||||||
Sbjct: 98596 acaatgatatattcaaaatg 98615

>emb|AL607022.11| Human DNA sequence from clone RP11-323N10 on chromosome 10 Contains the
             5' end of the gene for alpha-catenin-like protein
             (MGC26194) (VR22), a aldo-keto reductase family 1, member
             B10 (aldose reductase) (AKR1B10) pseudogene and a CpG
             island, complete sequence
          Length = 121210

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 103   tcactgtccaatcttctcagctgc 126
             |||||||||||||||| |||||||
Sbjct: 49603 tcactgtccaatcttcccagctgc 49626

>emb|AL499604.9| Human DNA sequence from clone RP11-23B15 on chromosome 9 Contains FOXE1
             gene for forkhead box E1 (thyroid transcription factor 2),
             HEMGN gene for hemogen, 2 novel genes and 5 CpG islands,
             complete sequence
          Length = 160796

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 385   ctactcatttcacaaagata 404
             ||||||||||||||||||||
Sbjct: 49047 ctactcatttcacaaagata 49066

>emb|AL732570.12| Mouse DNA sequence from clone RP23-464J2 on chromosome 11 Contains the
             gene for a novel protein (C630032K07Rik), a novel gene,
             the 3' end of the gene for a novel protein (1700019F09Rik)
             and a CpG island, complete sequence
          Length = 102563

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 211   tgacaagttttacacatcccaacc 234
             ||||||||||| ||||||||||||
Sbjct: 41109 tgacaagttttccacatcccaacc 41132

>emb|AL445064.1|TACID2 Thermoplasma acidophilum complete genome; segment 2/5
          Length = 338100

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 43     ttacaatgatatattcaaaa 62
              ||||||||||||||||||||
Sbjct: 203638 ttacaatgatatattcaaaa 203619

>emb|AJ851427.1| Gallus gallus mRNA for hypothetical protein, clone 2i13
          Length = 5437

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 177  attttccatggatttttgta 196
            ||||||||||||||||||||
Sbjct: 5403 attttccatggatttttgta 5384

>gb|AE015928.1| Bacteroides thetaiotaomicron VPI-5482, complete genome
          Length = 6260361

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 137     gaatatcaacaactacctgc 156
               ||||||||||||||||||||
Sbjct: 1369793 gaatatcaacaactacctgc 1369812

>gb|AC008189.3|AC008189 Drosophila melanogaster, chromosome 3R, region 82C-82D, BAC clone
              BACR02C19, complete sequence
          Length = 188359

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 323    cagccttgcgaataattcgt 342
              ||||||||||||||||||||
Sbjct: 107486 cagccttgcgaataattcgt 107467

>gb|AC096558.1| Homo sapiens BAC clone RP11-186C15 from 2, complete sequence
          Length = 169453

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 9      tgtttgaatttactagactg 28
              ||||||||||||||||||||
Sbjct: 164112 tgtttgaatttactagactg 164131

>gb|AC015971.4| Homo sapiens BAC clone RP11-269K22 from 2, complete sequence
          Length = 163852

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 289   cactgattacaaatgctcaa 308
             ||||||||||||||||||||
Sbjct: 29592 cactgattacaaatgctcaa 29573

>gb|AC007642.5|AC007642 Homo sapiens chromosome 17, clone hRPK.420_O_5, complete sequence
          Length = 64011

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 179   tttccatggatttttgtata 198
             ||||||||||||||||||||
Sbjct: 38361 tttccatggatttttgtata 38380

>emb|BX088539.6| Mouse DNA sequence from clone RP23-152D15 on chromosome X, complete
              sequence
          Length = 151751

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 430    cagggtgggtgtcacttctt 449
              ||||||||||||||||||||
Sbjct: 123210 cagggtgggtgtcacttctt 123229

>ref|NM_001012541.1| Gallus gallus nucleoporin 50kDa (NUP50), mRNA
          Length = 5437

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 177  attttccatggatttttgta 196
            ||||||||||||||||||||
Sbjct: 5403 attttccatggatttttgta 5384

>gb|AE003694.4| Drosophila melanogaster chromosome 3R, section 32 of 118 of the
             complete sequence
          Length = 226075

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 254   caatgtggcaatgttgcaaa 273
             ||||||||||||||||||||
Sbjct: 48751 caatgtggcaatgttgcaaa 48770

>emb|AL079343.4|CNS00M8T Human chromosome 14 DNA sequence BAC R-483C6 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 173480

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 154    tgccaaataccagcctttttggaatttt 181
              ||||||||||||||| ||||| ||||||
Sbjct: 150483 tgccaaataccagcccttttgtaatttt 150510

>gb|AE003605.3| Drosophila melanogaster chromosome 3R, section 3 of 118 of the complete
              sequence
          Length = 273418

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 323    cagccttgcgaataattcgt 342
              ||||||||||||||||||||
Sbjct: 194387 cagccttgcgaataattcgt 194368

>emb|AL671998.10| Mouse DNA sequence from clone RP23-71G11 on chromosome X, complete
             sequence
          Length = 220669

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 176   aattttccatggatttttgt 195
             ||||||||||||||||||||
Sbjct: 12284 aattttccatggatttttgt 12265


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,893,299
Number of Sequences: 3902068
Number of extensions: 4893299
Number of successful extensions: 107287
Number of sequences better than 10.0: 33
Number of HSP's better than 10.0 without gapping: 33
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 107194
Number of HSP's gapped (non-prelim): 93
length of query: 457
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 435
effective length of database: 17,147,199,772
effective search space: 7459031900820
effective search space used: 7459031900820
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)