ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah63i21
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|BT009459.1| Triticum aestivum clone wlsu2.pk0003.a5:fis, full... 375 e-100
2ref|XM_479223.1| Oryza sativa (japonica cultivar-group), mRNA 222 1e-54
3dbj|AK066361.1| Oryza sativa (japonica cultivar-group) cDNA clon... 222 1e-54
4gb|AY109675.1| Zea mays CL822_1 mRNA sequence 178 1e-41
5ref|NM_120112.2| Arabidopsis thaliana GTP binding AT4G39520 mRNA... 119 1e-23
6gb|AY035034.1| Arabidopsis thaliana putative GTP-binding protein... 119 1e-23
7emb|BX827633.1|CNS0A3PN Arabidopsis thaliana Full-length cDNA Co... 119 1e-23
8emb|BX829215.1|CNS0A3J3 Arabidopsis thaliana Full-length cDNA Co... 119 1e-23
9dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
10dbj|AP004306.3| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
11dbj|AP004260.2| Oryza sativa (japonica cultivar-group) genomic D... 101 2e-18
12emb|AL161595.2|ATCHRIV91 Arabidopsis thaliana DNA chromosome 4, ... 70 9e-09
13emb|AL078620.2|ATF23K16 Arabidopsis thaliana DNA chromosome 4, B... 70 9e-09
14gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete se... 54 5e-04
15gb|CP000081.1| Leishmania major chromosome 35, complete sequence 48 0.032
16ref|XM_838539.1| Leishmania major strain Friedlin GTP-binding pr... 48 0.032
17gb|DQ215860.1| Taeniopygia guttata clone 0063P0006D10 developmen... 44 0.50
18gb|DQ215858.1| Taeniopygia guttata clone 0058P0009E11 developmen... 44 0.50
19gb|DQ215857.1| Taeniopygia guttata clone 0058P0047A05 developmen... 44 0.50
20ref|NM_101609.2| Arabidopsis thaliana ATDRG1 (ARABIDOPSIS THALIA... 42 2.0
21gb|AC104272.5| Oryza sativa (japonica cultivar-group) chromosome... 42 2.0
22gb|AC103576.8| Rattus norvegicus 12 BAC CH230-63N13 (Children's ... 42 2.0
23emb|AL162418.17| Human DNA sequence from clone RP11-335H2 on chr... 42 2.0
24gb|AF370258.1| Arabidopsis thaliana putative developmentally reg... 42 2.0
25gb|AC117569.3| Homo sapiens chromosome 18, clone RP11-784B15, co... 42 2.0
26dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
27emb|BX815300.1|CNS0ADXZ Arabidopsis thaliana Full-length cDNA Co... 42 2.0
28emb|BX815499.1|CNS0ABD6 Arabidopsis thaliana Full-length cDNA Co... 42 2.0
29gb|AC007843.6|AC007843 Arabidopsis thaliana chromosome I BAC F28... 42 2.0
30gb|AC022492.5|AC022492 Genomic sequence for Arabidopsis thaliana... 42 2.0
31dbj|BS000240.1| Pan troglodytes chromosome 22 clone:RP43-055A16,... 42 2.0
32dbj|AK112055.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
33dbj|AK111540.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
34dbj|AK105299.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
35emb|AL163303.2|HS21C103 Homo sapiens chromosome 21 segment HS21C103 42 2.0
36gb|BT021092.1| Arabidopsis thaliana At1g17470 gene, complete cds 42 2.0
37gb|U66408.1|ATU66408 Arabidopsis thaliana GTP-binding protein (A... 42 2.0
38gb|AF014822.1|AF014822 Arabidopsis thaliana developmentally regu... 42 2.0
39gb|AC092203.16| Mus musculus strain C57BL/6J chromosome 3 clone ... 42 2.0
40emb|AJ011932.1|HSQ4H9 Homo sapiens chromosome 21q22.3, cosmid cl... 42 2.0
41gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome... 42 2.0
42dbj|AP000468.1| Homo sapiens genomic DNA, chromosome 21q22.3, cl... 42 2.0
43emb|AL672056.4| Mouse DNA sequence from clone RP23-467O2 on chro... 42 2.0
44ref|NM_179119.2| Arabidopsis thaliana WRKY20; transcription fact... 40 7.8
45gb|AC164398.8| Mus musculus chromosome 7, clone RP23-307M24, com... 40 7.8
46ref|XM_877105.1| PREDICTED: Bos taurus similar to developmentall... 40 7.8
47ref|XM_865811.1| PREDICTED: Bos taurus similar to developmentall... 40 7.8
48gb|BC053264.1| Danio rerio developmentally regulated GTP binding... 40 7.8
49gb|AC185987.2| Pan troglodytes BAC clone CH251-400P17 from chrom... 40 7.8
50gb|AC140073.4| Mus musculus BAC clone RP23-282N20 from chromosom... 40 7.8
51gb|AC183602.2| Pan troglodytes BAC clone CH251-350L8 from chromo... 40 7.8
52gb|CP000238.1| Baumannia cicadellinicola str. Hc (Homalodisca co... 40 7.8
53emb|CR450685.13| Zebrafish DNA sequence from clone DKEY-83K24 in... 40 7.8
54gb|AC132116.3| Mus musculus BAC clone RP24-158K7 from chromosome... 40 7.8
55gb|AC127422.4| Mus musculus BAC clone RP24-383K20 from chromosom... 40 7.8
56emb|CR376783.22| Zebrafish DNA sequence from clone DKEY-41N20 in... 40 7.8
57gb|AC136139.24| Medicago truncatula clone mth2-22c2, complete se... 40 7.8
58emb|CR788264.3| Human DNA sequence from clone RP11-436G20 on chr... 40 7.8
59emb|AL772307.15| Human DNA sequence from clone RP11-416B15 on ch... 40 7.8
60emb|AL929000.6| Human DNA sequence from clone RP11-451N24 on chr... 40 7.8
61emb|AL591438.6| Human DNA sequence from clone RP11-452D2 on chro... 40 7.8
62emb|AL590399.4| Human DNA sequence from clone RP11-111F5 on chro... 40 7.8
63gb|AC183767.2| Pan troglodytes BAC clone CH251-373L9 from chromo... 40 7.8
64emb|AL049635.8|HSJ1083G3 Human DNA sequence from clone RP5-1083G... 40 7.8
65ref|XM_775591.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.8
66gb|AC183605.3| Pan troglodytes BAC clone CH251-334E18 from chrom... 40 7.8
67gb|AC118487.4| Rattus norvegicus 2 BAC CH230-285C2 (Children's H... 40 7.8
68ref|XM_778083.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 7.8
69gb|AC183610.3| Pan troglodytes BAC clone CH251-223D9 from chromo... 40 7.8
70emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, ... 40 7.8
71emb|AL078465.1|ATT15N24 Arabidopsis thaliana DNA chromosome 4, B... 40 7.8
72emb|AJ237705.1|AGA237705 Anopheles gambiae apy gene for putative... 40 7.8
73emb|AJ237704.1|AGA237704 Anopheles gambiae mRNA for putative apy... 40 7.8
74emb|AL773537.4| Human DNA sequence from clone RP11-268E1 on chro... 40 7.8
75gb|AC010052.7| Drosophila melanogaster 3L BAC RP98-5G1 (Roswell ... 40 7.8
76gb|AC092709.2| Homo sapiens chromosome 8, clone RP11-509P12, com... 40 7.8
77gb|AC087368.7| Homo sapiens chromosome 8, clone RP11-711G22, com... 40 7.8
78gb|AC098860.2| Homo sapiens BAC clone RP11-229G4 from 4, complet... 40 7.8
79gb|AC117588.11| Mus musculus chromosome 15, clone RP23-177B8, co... 40 7.8
80emb|CR382285.2| Human DNA sequence from clone bP-21201H5 on chro... 40 7.8
81gb|BC105158.1| Bos taurus developmentally regulated GTP binding ... 40 7.8
82emb|BX826663.1|CNS0A43T Arabidopsis thaliana Full-length cDNA Co... 40 7.8
83emb|BX827276.1|CNS0A2HA Arabidopsis thaliana Full-length cDNA Co... 40 7.8
84gb|AY224593.1| Danio rerio developmentally regulated GTP-binding... 40 7.8
85gb|AC107739.9| Mus musculus chromosome 7, clone RP23-345M1, comp... 40 7.8
86gb|AC008262.4|AC008262 Genomic sequence for Arabidopsis thaliana... 40 7.8
87emb|BX005215.13| Mouse DNA sequence from clone RP23-280F9 on chr... 40 7.8
88gb|AC140260.3| Mus musculus BAC clone RP23-311O16 from 6, comple... 40 7.8
89emb|AL590148.8| Zebrafish DNA sequence from clone RP71-30I22 in ... 40 7.8
90gb|AF014821.1|AF014821 Pisum sativum developmentally regulated G... 40 7.8
91gb|AE003549.4| Drosophila melanogaster chromosome 3L, section 36... 40 7.8
92gb|AC145736.4| Mus musculus BAC clone RP24-296K18 from 9, comple... 40 7.8
93ref|NM_001034691.1| Bos taurus developmentally regulated GTP bin... 40 7.8
94dbj|AP004950.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 7.8
95ref|NM_200038.1| Danio rerio developmentally regulated GTP bindi... 40 7.8
96emb|AL671520.6| Mouse DNA sequence from clone RP23-99G21 on chro... 40 7.8
97emb|AL772214.3| Mouse DNA sequence from clone RP23-370C18 on chr... 40 7.8
98emb|AL365201.14| Human DNA sequence from clone RP11-39C22 on chr... 40 7.8
99emb|AL669891.12| Mouse DNA sequence from clone RP23-271F3 on chr... 40 7.8
100emb|AL513352.12| Mouse DNA sequence from clone RP23-180L12 on ch... 40 7.8
101gb|AC159709.8| Mus musculus 10 BAC RP23-136O17 (Roswell Park Can... 40 7.8 
>gb|BT009459.1| Triticum aestivum clone wlsu2.pk0003.a5:fis, full insert mRNA
           sequence
          Length = 1142

 Score =  375 bits (189), Expect = e-100
 Identities = 266/287 (92%), Gaps = 6/287 (2%)
 Strand = Plus / Minus

                                                                       
Query: 293 tagctgcttctcaaaaagttccatagctgagagcttcttcctgatctgcaaaacaaaatc 352
           |||||||||||||||||||| ||||||||||| || ||||||||||||||||||| ||||
Sbjct: 844 tagctgcttctcaaaaagtttcatagctgagaactccttcctgatctgcaaaacagaatc 785

                                                                       
Query: 353 attgctcgcc-cca-ggtgtatagct-atattttcttaatgatctgaacaacatcctcgt 409
              ||||| | ||| ||||| ||||| ||||||||||||||||||||||||| |||||||
Sbjct: 784 ---gctcggcaccacggtgtgtagcttatattttcttaatgatctgaacaacgtcctcgt 728

                                                                       
Query: 410 cctcaagctcatgttccttcccgactctctgaggcttgtgcttcacgctagaaccccaca 469
           ||||||||||||| ||||| || |||||||||||||| ||||||||||||||||||||||
Sbjct: 727 cctcaagctcatgctccttgccaactctctgaggcttatgcttcacgctagaaccccaca 668

                                                                       
Query: 470 ccagcgcatatttaaactgtttcgccatgtccttgtggatttggttgcagaagtcttcta 529
           |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
Sbjct: 667 ccagtgcatatttaaactgtttcgccatgtccttgtggatttggttgcagaagtcttcca 608

                                                          
Query: 530 ctgttttcctcttggatgataagatgacaggatcctcgtaatctggg 576
           ||||||||||||||||||||||||| |||||||||||||| ||||||
Sbjct: 607 ctgttttcctcttggatgataagatcacaggatcctcgtagtctggg 561



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 84   agaaccatcttatcaccttctcaagatagacaagcatctttccatgtgttcgg 136
            |||||||||||| || |||||| ||||||| | ||||||||||||||||||||
Sbjct: 1072 agaaccatcttagcatcttctcgagatagatatgcatctttccatgtgttcgg 1020



 Score = 46.1 bits (23), Expect = 0.13
 Identities = 48/55 (87%), Gaps = 1/55 (1%)
 Strand = Plus / Minus

                                                                  
Query: 189 aaaaactgtccacattctgtctttcgatggaaacc-gggttttatgcaaacagcg 242
           |||||||||||||||| ||||||  ||| |||||| |  ||||||||||||||||
Sbjct: 949 aaaaactgtccacattttgtcttgtgatcgaaaccagatttttatgcaaacagcg 895
to top
>ref|XM_479223.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1548

 Score =  222 bits (112), Expect = 1e-54
 Identities = 175/196 (89%)
 Strand = Plus / Minus

                                                                        
Query: 381  tttcttaatgatctgaacaacatcctcgtcctcaagctcatgttccttcccgactctctg 440
            |||||| |||||||| ||||| ||||| |||||||||||||||||||| || ||||||||
Sbjct: 1226 tttcttgatgatctggacaacgtcctcatcctcaagctcatgttccttgccaactctctg 1167

                                                                        
Query: 441  aggcttgtgcttcacgctagaaccccacaccagcgcatatttaaactgtttcgccatgtc 500
            |||||| |||||||||||||||||||||||||  ||||||||||| |||||| |||||||
Sbjct: 1166 aggcttatgcttcacgctagaaccccacaccaatgcatatttaaattgtttcaccatgtc 1107

                                                                        
Query: 501  cttgtggatttggttgcagaagtcttctactgttttcctcttggatgataagatgacagg 560
            ||||||||||  ||||||||||||||| ||||||||| |||| || |||| ||| |||||
Sbjct: 1106 cttgtggattctgttgcagaagtcttccactgttttcttcttagaggatacgattacagg 1047

                            
Query: 561  atcctcgtaatctggg 576
             ||||| |||||||||
Sbjct: 1046 gtcctcataatctggg 1031



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 115  aagcatctttccatgtgttc 134
            ||||||||||||||||||||
Sbjct: 1510 aagcatctttccatgtgttc 1491
to top
>dbj|AK066361.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013063L05, full
            insert sequence
          Length = 1548

 Score =  222 bits (112), Expect = 1e-54
 Identities = 175/196 (89%)
 Strand = Plus / Minus

                                                                        
Query: 381  tttcttaatgatctgaacaacatcctcgtcctcaagctcatgttccttcccgactctctg 440
            |||||| |||||||| ||||| ||||| |||||||||||||||||||| || ||||||||
Sbjct: 1226 tttcttgatgatctggacaacgtcctcatcctcaagctcatgttccttgccaactctctg 1167

                                                                        
Query: 441  aggcttgtgcttcacgctagaaccccacaccagcgcatatttaaactgtttcgccatgtc 500
            |||||| |||||||||||||||||||||||||  ||||||||||| |||||| |||||||
Sbjct: 1166 aggcttatgcttcacgctagaaccccacaccaatgcatatttaaattgtttcaccatgtc 1107

                                                                        
Query: 501  cttgtggatttggttgcagaagtcttctactgttttcctcttggatgataagatgacagg 560
            ||||||||||  ||||||||||||||| ||||||||| |||| || |||| ||| |||||
Sbjct: 1106 cttgtggattctgttgcagaagtcttccactgttttcttcttagaggatacgattacagg 1047

                            
Query: 561  atcctcgtaatctggg 576
             ||||| |||||||||
Sbjct: 1046 gtcctcataatctggg 1031



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 115  aagcatctttccatgtgttc 134
            ||||||||||||||||||||
Sbjct: 1510 aagcatctttccatgtgttc 1491
to top
>gb|AY109675.1| Zea mays CL822_1 mRNA sequence
          Length = 1597

 Score =  178 bits (90), Expect = 1e-41
 Identities = 174/202 (86%)
 Strand = Plus / Minus

                                                                        
Query: 375  ctatattttcttaatgatctgaacaacatcctcgtcctcaagctcatgttccttcccgac 434
            |||||||||||||||||||||||| || ||||| || ||||||||||| ||||| || ||
Sbjct: 1261 ctatattttcttaatgatctgaacgacgtcctcatcgtcaagctcatgctccttgccaac 1202

                                                                        
Query: 435  tctctgaggcttgtgcttcacgctagaaccccacaccagcgcatatttaaactgtttcgc 494
            |||||||||||| || ||||| || |||||||| ||||| || |||||||| |||||  |
Sbjct: 1201 tctctgaggcttatgtttcacactggaaccccataccagagcgtatttaaattgtttgac 1142

                                                                        
Query: 495  catgtccttgtggatttggttgcagaagtcttctactgttttcctcttggatgataagat 554
            ||||||||||||||||  || |||||| ||||| || |||||| |||| ||||||| |||
Sbjct: 1141 catgtccttgtggattctgtcgcagaaatcttccacggttttcttcttagatgatacgat 1082

                                  
Query: 555  gacaggatcctcgtaatctggg 576
             ||||||||||| |||||||||
Sbjct: 1081 aacaggatcctcataatctggg 1060
to top
>ref|NM_120112.2| Arabidopsis thaliana GTP binding AT4G39520 mRNA, complete cds
          Length = 1611

 Score =  119 bits (60), Expect = 1e-23
 Identities = 156/188 (82%)
 Strand = Plus / Minus

                                                                        
Query: 385  ttaatgatctgaacaacatcctcgtcctcaagctcatgttccttcccgactctctgaggc 444
            |||| |||||||||||||||||||||||||||||| |||||||| || ||||| || |||
Sbjct: 1240 ttaacgatctgaacaacatcctcgtcctcaagctcgtgttcctttccaactctttgtggc 1181

                                                                        
Query: 445  ttgtgcttcacgctagaaccccacaccagcgcatatttaaactgtttcgccatgtccttg 504
            ||||| ||  | || |||||||| ||||| || || || || |||||   |||||| |||
Sbjct: 1180 ttgtgtttggcacttgaaccccaaaccagagcgtacttgaattgtttaagcatgtctttg 1121

                                                                        
Query: 505  tggatttggttgcagaagtcttctactgttttcctcttggatgataagatgacaggatcc 564
            || ||  || |||||||||| ||||||||| || |||||||||||||||| || ||||| 
Sbjct: 1120 tgaatccggatgcagaagtcctctactgttctcttcttggatgataagattacgggatca 1061

                    
Query: 565  tcgtaatc 572
            || |||||
Sbjct: 1060 tcataatc 1053
to top
>gb|AY035034.1| Arabidopsis thaliana putative GTP-binding protein (At4g39520) mRNA,
            complete cds
          Length = 1474

 Score =  119 bits (60), Expect = 1e-23
 Identities = 156/188 (82%)
 Strand = Plus / Minus

                                                                        
Query: 385  ttaatgatctgaacaacatcctcgtcctcaagctcatgttccttcccgactctctgaggc 444
            |||| |||||||||||||||||||||||||||||| |||||||| || ||||| || |||
Sbjct: 1239 ttaacgatctgaacaacatcctcgtcctcaagctcgtgttcctttccaactctttgtggc 1180

                                                                        
Query: 445  ttgtgcttcacgctagaaccccacaccagcgcatatttaaactgtttcgccatgtccttg 504
            ||||| ||  | || |||||||| ||||| || || || || |||||   |||||| |||
Sbjct: 1179 ttgtgtttggcacttgaaccccaaaccagagcgtacttgaattgtttaagcatgtctttg 1120

                                                                        
Query: 505  tggatttggttgcagaagtcttctactgttttcctcttggatgataagatgacaggatcc 564
            || ||  || |||||||||| ||||||||| || |||||||||||||||| || ||||| 
Sbjct: 1119 tgaatccggatgcagaagtcctctactgttctcttcttggatgataagattacgggatca 1060

                    
Query: 565  tcgtaatc 572
            || |||||
Sbjct: 1059 tcataatc 1052
to top
>emb|BX827633.1|CNS0A3PN Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS87ZF10 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1584

 Score =  119 bits (60), Expect = 1e-23
 Identities = 156/188 (82%)
 Strand = Plus / Minus

                                                                        
Query: 385  ttaatgatctgaacaacatcctcgtcctcaagctcatgttccttcccgactctctgaggc 444
            |||| |||||||||||||||||||||||||||||| |||||||| || ||||| || |||
Sbjct: 1239 ttaacgatctgaacaacatcctcgtcctcaagctcgtgttcctttccaactctttgtggc 1180

                                                                        
Query: 445  ttgtgcttcacgctagaaccccacaccagcgcatatttaaactgtttcgccatgtccttg 504
            ||||| ||  | || |||||||| ||||| || || || || |||||   |||||| |||
Sbjct: 1179 ttgtgtttggcacttgaaccccaaaccagagcgtacttgaattgtttaagcatgtctttg 1120

                                                                        
Query: 505  tggatttggttgcagaagtcttctactgttttcctcttggatgataagatgacaggatcc 564
            || ||  || |||||||||| ||||||||| || |||||||||||||||| || ||||| 
Sbjct: 1119 tgaatccggatgcagaagtcctctactgttctcttcttggatgataagattacgggatca 1060

                    
Query: 565  tcgtaatc 572
            || |||||
Sbjct: 1059 tcataatc 1052
to top
>emb|BX829215.1|CNS0A3J3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTSIL81ZE07 of Silique of strain col-0 of Arabidopsis
            thaliana (thale cress)
          Length = 1407

 Score =  119 bits (60), Expect = 1e-23
 Identities = 156/188 (82%)
 Strand = Plus / Minus

                                                                        
Query: 385  ttaatgatctgaacaacatcctcgtcctcaagctcatgttccttcccgactctctgaggc 444
            |||| |||||||||||||||||||||||||||||| |||||||| || ||||| || |||
Sbjct: 1211 ttaacgatctgaacaacatcctcgtcctcaagctcgtgttcctttccaactctttgtggc 1152

                                                                        
Query: 445  ttgtgcttcacgctagaaccccacaccagcgcatatttaaactgtttcgccatgtccttg 504
            ||||| ||  | || |||||||| ||||| || || || || |||||   |||||| |||
Sbjct: 1151 ttgtgtttggcacttgaaccccaaaccagagcgtacttgaattgtttaagcatgtctttg 1092

                                                                        
Query: 505  tggatttggttgcagaagtcttctactgttttcctcttggatgataagatgacaggatcc 564
            || ||  || |||||||||| ||||||||| || |||||||||||||||| || ||||| 
Sbjct: 1091 tgaatccggatgcagaagtcctctactgttctcttcttggatgataagattacgggatca 1032

                    
Query: 565  tcgtaatc 572
            || |||||
Sbjct: 1031 tcataatc 1024
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                            
Query: 478      tatttaaactgtttcgccatgtccttgtggatttggttgcagaagtcttctactgttttc 537
                |||||||| |||||| |||||||||||||||||  ||||||||||||||| |||||||||
Sbjct: 25966612 tatttaaattgtttcaccatgtccttgtggattctgttgcagaagtcttccactgttttc 25966671

                                                       
Query: 538      ctcttggatgataagatgacaggatcctcgtaatctggg 576
                 |||| || |||| ||| ||||| ||||| |||||||||
Sbjct: 25966672 ttcttagaggatacgattacagggtcctcataatctggg 25966710



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                        
Query: 433      actctctgaggcttgtgcttcacgctagaaccccacacca 472
                |||||||||||||| |||||||||||||||||||||||||
Sbjct: 25966484 actctctgaggcttatgcttcacgctagaaccccacacca 25966523



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                               
Query: 381      tttcttaatgatctgaacaacatcctcgtcctcaagctcatgttcct 427
                |||||| |||||||| ||||| ||||| |||||||||||||||||||
Sbjct: 25966338 tttcttgatgatctggacaacgtcctcatcctcaagctcatgttcct 25966384



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 115      aagcatctttccatgtgttc 134
                ||||||||||||||||||||
Sbjct: 25966054 aagcatctttccatgtgttc 25966073
to top
>dbj|AP004306.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0506F02
          Length = 151612

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                         
Query: 478   tatttaaactgtttcgccatgtccttgtggatttggttgcagaagtcttctactgttttc 537
             |||||||| |||||| |||||||||||||||||  ||||||||||||||| |||||||||
Sbjct: 43624 tatttaaattgtttcaccatgtccttgtggattctgttgcagaagtcttccactgttttc 43683

                                                    
Query: 538   ctcttggatgataagatgacaggatcctcgtaatctggg 576
              |||| || |||| ||| ||||| ||||| |||||||||
Sbjct: 43684 ttcttagaggatacgattacagggtcctcataatctggg 43722



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                     
Query: 433   actctctgaggcttgtgcttcacgctagaaccccacacca 472
             |||||||||||||| |||||||||||||||||||||||||
Sbjct: 43496 actctctgaggcttatgcttcacgctagaaccccacacca 43535



 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Plus

                                                            
Query: 381   tttcttaatgatctgaacaacatcctcgtcctcaagctcatgttcct 427
             |||||| |||||||| ||||| ||||| |||||||||||||||||||
Sbjct: 43350 tttcttgatgatctggacaacgtcctcatcctcaagctcatgttcct 43396



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 115   aagcatctttccatgtgttc 134
             ||||||||||||||||||||
Sbjct: 43066 aagcatctttccatgtgttc 43085
to top
>dbj|AP004260.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7,
           PAC clone:P0011H09
          Length = 147992

 Score =  101 bits (51), Expect = 2e-18
 Identities = 87/99 (87%)
 Strand = Plus / Plus

                                                                       
Query: 478 tatttaaactgtttcgccatgtccttgtggatttggttgcagaagtcttctactgttttc 537
           |||||||| |||||| |||||||||||||||||  ||||||||||||||| |||||||||
Sbjct: 174 tatttaaattgtttcaccatgtccttgtggattctgttgcagaagtcttccactgttttc 233

                                                  
Query: 538 ctcttggatgataagatgacaggatcctcgtaatctggg 576
            |||| || |||| ||| ||||| ||||| |||||||||
Sbjct: 234 ttcttagaggatacgattacagggtcctcataatctggg 272



 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 39/40 (97%)
 Strand = Plus / Plus

                                                   
Query: 433 actctctgaggcttgtgcttcacgctagaaccccacacca 472
           |||||||||||||| |||||||||||||||||||||||||
Sbjct: 46  actctctgaggcttatgcttcacgctagaaccccacacca 85
to top
>emb|AL161595.2|ATCHRIV91 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 91
          Length = 198151

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                        
Query: 385   ttaatgatctgaacaacatcctcgtcctcaagctcatgttcct 427
             |||| |||||||||||||||||||||||||||||| |||||||
Sbjct: 91509 ttaacgatctgaacaacatcctcgtcctcaagctcgtgttcct 91551



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                       
Query: 515   tgcagaagtcttctactgttttcctcttggatgataagatgacaggatcctcgtaatc 572
             |||||||||| ||||||||| || |||||||||||||||| || ||||| || |||||
Sbjct: 91845 tgcagaagtcctctactgttctcttcttggatgataagattacgggatcatcataatc 91902
to top
>emb|AL078620.2|ATF23K16 Arabidopsis thaliana DNA chromosome 4, BAC clone F23K16 (ESSA project)
          Length = 129047

 Score = 69.9 bits (35), Expect = 9e-09
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                        
Query: 385   ttaatgatctgaacaacatcctcgtcctcaagctcatgttcct 427
             |||| |||||||||||||||||||||||||||||| |||||||
Sbjct: 66295 ttaacgatctgaacaacatcctcgtcctcaagctcgtgttcct 66337



 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                       
Query: 515   tgcagaagtcttctactgttttcctcttggatgataagatgacaggatcctcgtaatc 572
             |||||||||| ||||||||| || |||||||||||||||| || ||||| || |||||
Sbjct: 66631 tgcagaagtcctctactgttctcttcttggatgataagattacgggatcatcataatc 66688
to top
>gb|AC146748.16| Medicago truncatula clone mth2-65k8, complete sequence
          Length = 113744

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                            
Query: 381   tttcttaatgatctgaacaacatcctcgtcctcaagctcatgttcct 427
             |||||| |||||||||||||| || ||||| ||||| ||||||||||
Sbjct: 81777 tttcttgatgatctgaacaacgtcttcgtcttcaagttcatgttcct 81731



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 425   ccttcccgactctctgaggcttgtg 449
             |||| ||||||||||||||||||||
Sbjct: 81596 ccttgccgactctctgaggcttgtg 81572



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 74/92 (80%)
 Strand = Plus / Minus

                                                                         
Query: 481   ttaaactgtttcgccatgtccttgtggatttggttgcagaagtcttctactgttttcctc 540
             |||||||||||   |||||||||||| ||  | | |||||| ||||| ||||| ||| ||
Sbjct: 81017 ttaaactgtttaagcatgtccttgtgaatgcgatcgcagaaatcttcaactgtcttcttc 80958

                                             
Query: 541   ttggatgataagatgacaggatcctcgtaatc 572
             || ||||| || || ||||| || ||||||||
Sbjct: 80957 ttagatgacaatattacagggtcttcgtaatc 80926
to top
>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 388     atgatctgaacaacatcctcgtcctcaagctcatgt 423
               ||||| |||| ||||||||||||||| |||||||||
Sbjct: 2049450 atgatttgaagaacatcctcgtcctctagctcatgt 2049415
to top
>ref|XM_838539.1| Leishmania major strain Friedlin GTP-binding protein (LMJ_1459)
            partial mRNA
          Length = 1125

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                
Query: 388  atgatctgaacaacatcctcgtcctcaagctcatgt 423
            ||||| |||| ||||||||||||||| |||||||||
Sbjct: 1103 atgatttgaagaacatcctcgtcctctagctcatgt 1068
to top
>gb|DQ215860.1| Taeniopygia guttata clone 0063P0006D10 developmentally regulated GTP
            binding protein 1-like mRNA, complete sequence
          Length = 1212

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 460  gaaccccacaccagcgcatatttaaa 485
            |||||||| |||||||||||||||||
Sbjct: 1099 gaaccccagaccagcgcatatttaaa 1074
to top
>gb|DQ215858.1| Taeniopygia guttata clone 0058P0009E11 developmentally regulated GTP
            binding protein 1-like mRNA, complete sequence
          Length = 1184

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 460  gaaccccacaccagcgcatatttaaa 485
            |||||||| |||||||||||||||||
Sbjct: 1070 gaaccccagaccagcgcatatttaaa 1045
to top
>gb|DQ215857.1| Taeniopygia guttata clone 0058P0047A05 developmentally regulated GTP
            binding protein 1-like mRNA, complete sequence
          Length = 1195

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 460  gaaccccacaccagcgcatatttaaa 485
            |||||||| |||||||||||||||||
Sbjct: 1082 gaaccccagaccagcgcatatttaaa 1057
to top
>ref|NM_101609.2| Arabidopsis thaliana ATDRG1 (ARABIDOPSIS THALIANA DEVELOPMENTALLY
            REGULATED G-PROTEIN 1); GTP binding AT1G17470 (ATDRG1)
            mRNA, complete cds
          Length = 1561

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  ttttcttaatgatctgaacaacatcctcgtcctcaag 416
            ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 1213 ttttcttgacgatctgaacaacatcttcgtcttcaag 1177
to top
>gb|AC104272.5| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1045_C06,
             complete sequence
          Length = 143130

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 505   tggatttggttgcagaagtcttctactgt 533
             ||||| ||||||||||||||||| |||||
Sbjct: 48357 tggatatggttgcagaagtcttcaactgt 48329
to top
>gb|AC103576.8| Rattus norvegicus 12 BAC CH230-63N13 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 219287

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 316    tagctgagagcttcttcctgatctgcaaa 344
              ||||||| |||||| ||||||||||||||
Sbjct: 214880 tagctgaaagcttcctcctgatctgcaaa 214908
to top
>emb|AL162418.17| Human DNA sequence from clone RP11-335H2 on chromosome 9 Contains part
             of the gene for a novel protein similar to basonuclin
             (BNC) (FLJ34928) and a LSM1 homolog, U6 small nuclear RNA
             associated (S. cerevisiae) pseudogene, complete sequence
          Length = 57850

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 86    aaccatcttatcaccttctca 106
             |||||||||||||||||||||
Sbjct: 19577 aaccatcttatcaccttctca 19597
to top
>gb|AF370258.1| Arabidopsis thaliana putative developmentally regulated GTP-binding
            protein (At1g17470) mRNA, complete cds
          Length = 1522

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  ttttcttaatgatctgaacaacatcctcgtcctcaag 416
            ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 1213 ttttcttgacgatctgaacaacatcttcgtcttcaag 1177
to top
>gb|AC117569.3| Homo sapiens chromosome 18, clone RP11-784B15, complete sequence
          Length = 176898

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 508   atttggttgcagaagtcttct 528
             |||||||||||||||||||||
Sbjct: 65044 atttggttgcagaagtcttct 65064
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 322      agagcttcttcctgatctgca 342
                |||||||||||||||||||||
Sbjct: 23489893 agagcttcttcctgatctgca 23489873



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                             
Query: 505      tggatttggttgcagaagtcttctactgt 533
                ||||| ||||||||||||||||| |||||
Sbjct: 16835861 tggatatggttgcagaagtcttcaactgt 16835833
to top
>emb|BX815300.1|CNS0ADXZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS4ZH11 of Adult vegetative tissue of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1448

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  ttttcttaatgatctgaacaacatcctcgtcctcaag 416
            ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 1157 ttttcttgacgatctgaacaacatcttcgtcttcaag 1121
to top
>emb|BX815499.1|CNS0ABD6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS67ZF05 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 843

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 380 ttttcttaatgatctgaacaacatcctcgtcctcaag 416
           ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 569 ttttcttgacgatctgaacaacatcttcgtcttcaag 533
to top
>gb|AC007843.6|AC007843 Arabidopsis thaliana chromosome I BAC F28G4 genomic sequence,
            complete sequence
          Length = 84974

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                 
Query: 380  ttttcttaatgatctgaacaacatcctcgtcctcaag 416
            ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 9672 ttttcttgacgatctgaacaacatcttcgtcttcaag 9708
to top
>gb|AC022492.5|AC022492 Genomic sequence for Arabidopsis thaliana BAC F1L3 from chromosome I,
             complete sequence
          Length = 127968

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                  
Query: 380   ttttcttaatgatctgaacaacatcctcgtcctcaag 416
             ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 59686 ttttcttgacgatctgaacaacatcttcgtcttcaag 59650
to top
>dbj|BS000240.1| Pan troglodytes chromosome 22 clone:RP43-055A16, map 22, complete
             sequences
          Length = 185079

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 508   atttggttgcagaagtcttct 528
             |||||||||||||||||||||
Sbjct: 81095 atttggttgcagaagtcttct 81115
to top
>dbj|AK112055.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-109-E05, full
           insert sequence
          Length = 676

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 505 tggatttggttgcagaagtcttctactgt 533
           ||||| ||||||||||||||||| |||||
Sbjct: 559 tggatatggttgcagaagtcttcaactgt 531
to top
>dbj|AK111540.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013037H01, full
            insert sequence
          Length = 1796

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 505  tggatttggttgcagaagtcttctactgt 533
            ||||| ||||||||||||||||| |||||
Sbjct: 1138 tggatatggttgcagaagtcttcaactgt 1110
to top
>dbj|AK105299.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-116-H10, full
            insert sequence
          Length = 1609

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 505  tggatttggttgcagaagtcttctactgt 533
            ||||| ||||||||||||||||| |||||
Sbjct: 1166 tggatatggttgcagaagtcttcaactgt 1138
to top
>emb|AL163303.2|HS21C103 Homo sapiens chromosome 21 segment HS21C103
          Length = 340000

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 508    atttggttgcagaagtcttct 528
              |||||||||||||||||||||
Sbjct: 324016 atttggttgcagaagtcttct 324036
to top
>gb|BT021092.1| Arabidopsis thaliana At1g17470 gene, complete cds
          Length = 1276

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  ttttcttaatgatctgaacaacatcctcgtcctcaag 416
            ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 1112 ttttcttgacgatctgaacaacatcttcgtcttcaag 1076
to top
>gb|U66408.1|ATU66408 Arabidopsis thaliana GTP-binding protein (ATDRG1) mRNA, complete cds
          Length = 1493

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  ttttcttaatgatctgaacaacatcctcgtcctcaag 416
            ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 1216 ttttcttgacgatctgaacaacatcttcgtcttcaag 1180
to top
>gb|AF014822.1|AF014822 Arabidopsis thaliana developmentally regulated GTP binding protein
            (AtDRG1) mRNA, complete cds
          Length = 1495

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                 
Query: 380  ttttcttaatgatctgaacaacatcctcgtcctcaag 416
            ||||||| | ||||||||||||||| ||||| |||||
Sbjct: 1202 ttttcttgacgatctgaacaacatcttcgtcttcaag 1166
to top
>gb|AC092203.16| Mus musculus strain C57BL/6J chromosome 3 clone rp23-422n18, complete
             sequence
          Length = 188880

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 315   atagctgagagcttcttcctgatctgcaa 343
             ||||||||||||| | |||||||||||||
Sbjct: 65272 atagctgagagctacatcctgatctgcaa 65300
to top
>emb|AJ011932.1|HSQ4H9 Homo sapiens chromosome 21q22.3, cosmid clone Q4H9 complete sequence
             bases 1..41604
          Length = 41604

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 508   atttggttgcagaagtcttct 528
             |||||||||||||||||||||
Sbjct: 13558 atttggttgcagaagtcttct 13578
to top
>gb|AC137619.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0095J22, complete sequence
          Length = 151730

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 322   agagcttcttcctgatctgca 342
             |||||||||||||||||||||
Sbjct: 25617 agagcttcttcctgatctgca 25597
to top
>dbj|AP000468.1| Homo sapiens genomic DNA, chromosome 21q22.3, clone:f60A9, complete
             sequence
          Length = 19636

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 508   atttggttgcagaagtcttct 528
             |||||||||||||||||||||
Sbjct: 11483 atttggttgcagaagtcttct 11503
to top
>emb|AL672056.4| Mouse DNA sequence from clone RP23-467O2 on chromosome X, complete
              sequence
          Length = 150695

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 316    tagctgagagcttcttcctgatctgcaaa 344
              |||||||||||| | ||||||||||||||
Sbjct: 132249 tagctgagagctacatcctgatctgcaaa 132221
to top
>ref|NM_179119.2| Arabidopsis thaliana WRKY20; transcription factor AT4G26640
           (WRKY20) transcript variant AT4G26640.2 mRNA, complete
           cds
          Length = 2006

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 313 ccatagctgagagcttcttc 332
           ||||||||||||||||||||
Sbjct: 28  ccatagctgagagcttcttc 47
to top
>gb|AC164398.8| Mus musculus chromosome 7, clone RP23-307M24, complete sequence
          Length = 196756

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 319   ctgagagcttcttcctgatctgca 342
             ||||||||| ||||||||||||||
Sbjct: 23407 ctgagagctacttcctgatctgca 23430
to top
>ref|XM_877105.1| PREDICTED: Bos taurus similar to developmentally regulated GTP
           binding protein 1 (predicted), transcript variant 3
           (LOC614209), mRNA
          Length = 1402

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 462 accccacaccagcgcatatttaaa 485
           |||||||||||| |||||||||||
Sbjct: 973 accccacaccagagcatatttaaa 950
to top
>ref|XM_865811.1| PREDICTED: Bos taurus similar to developmentally regulated GTP
            binding protein 1 (predicted), transcript variant 2
            (LOC614209), mRNA
          Length = 1551

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 462  accccacaccagcgcatatttaaa 485
            |||||||||||| |||||||||||
Sbjct: 1122 accccacaccagagcatatttaaa 1099
to top
>gb|BC053264.1| Danio rerio developmentally regulated GTP binding protein 1, mRNA
            (cDNA clone MGC:64124 IMAGE:6795520), complete cds
          Length = 1527

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 463  ccccacaccagcgcatattt 482
            ||||||||||||||||||||
Sbjct: 1132 ccccacaccagcgcatattt 1113
to top
>gb|AC185987.2| Pan troglodytes BAC clone CH251-400P17 from chromosome 9, complete
             sequence
          Length = 161307

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 79464 ctactgttttcctcttggat 79445
to top
>gb|AC140073.4| Mus musculus BAC clone RP23-282N20 from chromosome 19, complete sequence
          Length = 245582

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 316    tagctgagagcttcttcctgatctgcaa 343
              |||||||||||| | |||||||||||||
Sbjct: 147154 tagctgagagctacatcctgatctgcaa 147181
to top
>gb|AC183602.2| Pan troglodytes BAC clone CH251-350L8 from chromosome 9, complete
             sequence
          Length = 165959

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 91266 ctactgttttcctcttggat 91247
to top
>gb|CP000238.1| Baumannia cicadellinicola str. Hc (Homalodisca coagulata), complete
             genome
          Length = 686194

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 373   agctatattttcttaatgatctga 396
             |||||||||||||| |||||||||
Sbjct: 80211 agctatattttctttatgatctga 80234
to top
>emb|CR450685.13| Zebrafish DNA sequence from clone DKEY-83K24 in linkage group 8, complete
              sequence
          Length = 195473

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 377    atattttcttaatgatctgaacaa 400
              ||||||||| ||||||||||||||
Sbjct: 109570 atattttctaaatgatctgaacaa 109593
to top
>gb|AC132116.3| Mus musculus BAC clone RP24-158K7 from chromosome 2, complete sequence
          Length = 165307

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 316    tagctgagagcttcttcctgatctgcaa 343
              |||||||||||| |||| ||||||||||
Sbjct: 154121 tagctgagagctacttcttgatctgcaa 154094
to top
>gb|AC127422.4| Mus musculus BAC clone RP24-383K20 from chromosome 9, complete sequence
          Length = 198803

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 316    tagctgagagcttcttcctgatctgcaa 343
              |||||||||||| | |||||||||||||
Sbjct: 174081 tagctgagagctgcatcctgatctgcaa 174108
to top
>emb|CR376783.22| Zebrafish DNA sequence from clone DKEY-41N20 in linkage group 13,
              complete sequence
          Length = 205064

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 71     ttgcaatgtcataagaaccatctt 94
              |||||||||||||||||| |||||
Sbjct: 154345 ttgcaatgtcataagaacaatctt 154322
to top
>gb|AC136139.24| Medicago truncatula clone mth2-22c2, complete sequence
          Length = 66079

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 336   atctgcaaaacaaaatcatt 355
             ||||||||||||||||||||
Sbjct: 29795 atctgcaaaacaaaatcatt 29776
to top
>emb|CR788264.3| Human DNA sequence from clone RP11-436G20 on chromosome 9 Contains a
             pseudogene similar to part of ribosomal protein L7a
             (RPL7A), complete sequence
          Length = 171101

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 91246 ctactgttttcctcttggat 91227
to top
>emb|AL772307.15| Human DNA sequence from clone RP11-416B15 on chromosome 9 Contains a
             pseudogene similar to part of ribosomal protein L7a
             (RPL7A) and a CpG island, complete sequence
          Length = 161380

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 10559 ctactgttttcctcttggat 10578
to top
>emb|AL929000.6| Human DNA sequence from clone RP11-451N24 on chromosome 9, complete
             sequence
          Length = 64208

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 57733 ctactgttttcctcttggat 57752
to top
>emb|AL591438.6| Human DNA sequence from clone RP11-452D2 on chromosome 9 Contains a
              pseudogene similar to part of ribosomal protein L7a
              (RPL7A), a novel pseudogene and a CpG island, complete
              sequence
          Length = 176097

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 527    ctactgttttcctcttggat 546
              ||||||||||||||||||||
Sbjct: 144077 ctactgttttcctcttggat 144058
to top
>emb|AL590399.4| Human DNA sequence from clone RP11-111F5 on chromosome 9 Contains a
             pseudogene similar to part of ribosomal protein L7a
             (RPL7A), four novel genes, a pseudogene similar to part of
             ribosomal protein L10 (RPL10), a novel pseudogene and a
             pseudogene similar to part of fibroblast growth factor 7
             (keratinocyte growth factor) (FGF7), complete sequence
          Length = 187505

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 24953 ctactgttttcctcttggat 24934
to top
>gb|AC183767.2| Pan troglodytes BAC clone CH251-373L9 from chromosome 9, complete
             sequence
          Length = 162355

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 23693 ctactgttttcctcttggat 23674
to top
>emb|AL049635.8|HSJ1083G3 Human DNA sequence from clone RP5-1083G3 on chromosome 11p13 Contains
             GSSs and a putative CpG island, complete sequence
          Length = 98413

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 312   tccatagctgagagcttcttcctg 335
             |||| |||||||||||||||||||
Sbjct: 76272 tccagagctgagagcttcttcctg 76295
to top
>ref|XM_775591.1| PREDICTED: Strongylocentrotus purpuratus similar to cytochrome
           P450, family 4, subfamily v, polypeptide 2 (LOC575176),
           mRNA
          Length = 384

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 417 ctcatgttccttcccgactc 436
           ||||||||||||||||||||
Sbjct: 153 ctcatgttccttcccgactc 134
to top
>gb|AC183605.3| Pan troglodytes BAC clone CH251-334E18 from chromosome 4, complete
              sequence
          Length = 191017

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 527    ctactgttttcctcttggat 546
              ||||||||||||||||||||
Sbjct: 107628 ctactgttttcctcttggat 107647
to top
>gb|AC118487.4| Rattus norvegicus 2 BAC CH230-285C2 (Children's Hospital Oakland
            Research Institute) complete sequence
          Length = 177865

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 411  ctcaagctcatgttccttcc 430
            ||||||||||||||||||||
Sbjct: 8775 ctcaagctcatgttccttcc 8794
to top
>ref|XM_778083.1| PREDICTED: Strongylocentrotus purpuratus similar to cytochrome
           P450, family 4, subfamily v, polypeptide 2 (LOC577879),
           mRNA
          Length = 1617

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 417 ctcatgttccttcccgactc 436
           ||||||||||||||||||||
Sbjct: 738 ctcatgttccttcccgactc 719
to top
>gb|AC183610.3| Pan troglodytes BAC clone CH251-223D9 from chromosome 9, complete
              sequence
          Length = 159456

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 527    ctactgttttcctcttggat 546
              ||||||||||||||||||||
Sbjct: 149998 ctactgttttcctcttggat 149979
to top
>emb|AL161565.2|ATCHRIV65 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 65
          Length = 198320

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 313    ccatagctgagagcttcttc 332
              ||||||||||||||||||||
Sbjct: 137946 ccatagctgagagcttcttc 137927
to top
>emb|AL078465.1|ATT15N24 Arabidopsis thaliana DNA chromosome 4, BAC clone T15N24 (ESSA project)
          Length = 92657

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 313   ccatagctgagagcttcttc 332
             ||||||||||||||||||||
Sbjct: 69814 ccatagctgagagcttcttc 69795
to top
>emb|AJ237705.1|AGA237705 Anopheles gambiae apy gene for putative apyrase protein
          Length = 3543

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 189  aaaaactgtccacattctgt 208
            ||||||||||||||||||||
Sbjct: 3242 aaaaactgtccacattctgt 3223
to top
>emb|AJ237704.1|AGA237704 Anopheles gambiae mRNA for putative apyrase protein
          Length = 2272

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 189  aaaaactgtccacattctgt 208
            ||||||||||||||||||||
Sbjct: 2113 aaaaactgtccacattctgt 2094
to top
>emb|AL773537.4| Human DNA sequence from clone RP11-268E1 on chromosome 9 Contains three
              novel pseudogene, a novel gene, a pseudogene similar to
              part ofribosomal protein L10 (QM, NOV, DXS648, DXS648E,
              FLJ23544) (RPL10) and a CpG island, complete sequence
          Length = 166231

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 527    ctactgttttcctcttggat 546
              ||||||||||||||||||||
Sbjct: 162515 ctactgttttcctcttggat 162534
to top
>gb|AC010052.7| Drosophila melanogaster 3L BAC RP98-5G1 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 164941

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 377   atattttcttaatgatctga 396
             ||||||||||||||||||||
Sbjct: 39892 atattttcttaatgatctga 39911
to top
>gb|AC092709.2| Homo sapiens chromosome 8, clone RP11-509P12, complete sequence
          Length = 178904

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 381    tttcttaatgatctgaacaa 400
              ||||||||||||||||||||
Sbjct: 158811 tttcttaatgatctgaacaa 158830
to top
>gb|AC087368.7| Homo sapiens chromosome 8, clone RP11-711G22, complete sequence
          Length = 185315

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 381   tttcttaatgatctgaacaa 400
             ||||||||||||||||||||
Sbjct: 65839 tttcttaatgatctgaacaa 65858
to top
>gb|AC098860.2| Homo sapiens BAC clone RP11-229G4 from 4, complete sequence
          Length = 119491

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 69701 ctactgttttcctcttggat 69720
to top
>gb|AC117588.11| Mus musculus chromosome 15, clone RP23-177B8, complete sequence
          Length = 211177

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                              
Query: 316    tagctgagagcttcttcctgatctgcaaaaca 347
              |||||||||||| | ||||||||| |||||||
Sbjct: 156104 tagctgagagctacatcctgatctacaaaaca 156135
to top
>emb|CR382285.2| Human DNA sequence from clone bP-21201H5 on chromosome 21, complete
             sequence
          Length = 178865

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 76638 ctactgttttcctcttggat 76619
to top
>gb|BC105158.1| Bos taurus developmentally regulated GTP binding protein 1, mRNA
            (cDNA clone MGC:127808 IMAGE:30957527), complete cds
          Length = 1481

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 462  accccacaccagcgcatatttaaa 485
            |||||||||||| |||||||||||
Sbjct: 1170 accccacaccagagcatatttaaa 1147
to top
>emb|BX826663.1|CNS0A43T Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB52ZA12 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1975

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 313 ccatagctgagagcttcttc 332
           ||||||||||||||||||||
Sbjct: 20  ccatagctgagagcttcttc 39
to top
>emb|BX827276.1|CNS0A2HA Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS31ZF04 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 2006

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 313 ccatagctgagagcttcttc 332
           ||||||||||||||||||||
Sbjct: 27  ccatagctgagagcttcttc 46
to top
>gb|AY224593.1| Danio rerio developmentally regulated GTP-binding protein 1 (drg1)
            mRNA, complete cds
          Length = 1517

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 463  ccccacaccagcgcatattt 482
            ||||||||||||||||||||
Sbjct: 1144 ccccacaccagcgcatattt 1125
to top
>gb|AC107739.9| Mus musculus chromosome 7, clone RP23-345M1, complete sequence
          Length = 205227

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 319    ctgagagcttcttcctgatctgca 342
              ||||||||| ||||||||||||||
Sbjct: 132966 ctgagagctacttcctgatctgca 132989
to top
>gb|AC008262.4|AC008262 Genomic sequence for Arabidopsis thaliana BAC F4N2 from chromosome I,
             complete sequence
          Length = 99698

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 522   gtcttctactgttttcctct 541
             ||||||||||||||||||||
Sbjct: 51297 gtcttctactgttttcctct 51278
to top
>emb|BX005215.13| Mouse DNA sequence from clone RP23-280F9 on chromosome X, complete
             sequence
          Length = 189900

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 17    agcagtcccatcattaagga 36
             ||||||||||||||||||||
Sbjct: 72645 agcagtcccatcattaagga 72664
to top
>gb|AC140260.3| Mus musculus BAC clone RP23-311O16 from 6, complete sequence
          Length = 252791

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 527    ctactgttttcctcttggat 546
              ||||||||||||||||||||
Sbjct: 183242 ctactgttttcctcttggat 183261
to top
>emb|AL590148.8| Zebrafish DNA sequence from clone RP71-30I22 in linkage group 8
             Contains part of a novel gene for a protein similar to
             human FLJ12550, the pim1 gene for pim-1 oncogene (proviral
             integration site 1), part of a novel gene for a protein
             similar to vertebrate UDP-galactose transporters, a novel
             gene for a protein similar to vertebrate caldesmon 1
             (CALD1) and a CpG island, complete sequence
          Length = 140984

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 377   atattttcttaatgatctgaacaa 400
             ||||||||| ||||||||||||||
Sbjct: 56426 atattttctaaatgatctgaacaa 56449
to top
>gb|AF014821.1|AF014821 Pisum sativum developmentally regulated GTP binding protein
           (PsDRG1) mRNA, complete cds
          Length = 1482

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 511 tggttgcagaagtcttctac 530
           ||||||||||||||||||||
Sbjct: 998 tggttgcagaagtcttctac 979
to top
>gb|AE003549.4| Drosophila melanogaster chromosome 3L, section 36 of 83 of the complete
              sequence
          Length = 295143

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 377    atattttcttaatgatctga 396
              ||||||||||||||||||||
Sbjct: 271969 atattttcttaatgatctga 271988
to top
>gb|AC145736.4| Mus musculus BAC clone RP24-296K18 from 9, complete sequence
          Length = 177964

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 316    tagctgagagcttcttcctgatctgcaa 343
              |||||||||||| | |||||||||||||
Sbjct: 130209 tagctgagagctgcatcctgatctgcaa 130182
to top
>ref|NM_001034691.1| Bos taurus developmentally regulated GTP binding protein 1 (DRG1),
            mRNA
          Length = 1481

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 462  accccacaccagcgcatatttaaa 485
            |||||||||||| |||||||||||
Sbjct: 1170 accccacaccagagcatatttaaa 1147
to top
>dbj|AP004950.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT42E10, TM0123,
             complete sequence
          Length = 79601

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   tatattttcttaatgatctgaaca 399
             ||||||||||| ||||||||||||
Sbjct: 34900 tatattttcttgatgatctgaaca 34923
to top
>ref|NM_200038.1| Danio rerio developmentally regulated GTP binding protein 1 (drg1),
            mRNA
          Length = 1527

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 463  ccccacaccagcgcatattt 482
            ||||||||||||||||||||
Sbjct: 1132 ccccacaccagcgcatattt 1113
to top
>emb|AL671520.6| Mouse DNA sequence from clone RP23-99G21 on chromosome 4, complete
             sequence
          Length = 213303

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 264   ctagtgaaagaaacacacgagttc 287
             ||||||||||||||| ||||||||
Sbjct: 48033 ctagtgaaagaaacagacgagttc 48010
to top
>emb|AL772214.3| Mouse DNA sequence from clone RP23-370C18 on chromosome 2, complete
             sequence
          Length = 181349

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 316   tagctgagagcttcttcctgatctgcaa 343
             |||||||||||| |||| ||||||||||
Sbjct: 55961 tagctgagagctacttcttgatctgcaa 55988
to top
>emb|AL365201.14| Human DNA sequence from clone RP11-39C22 on chromosome 9, complete
             sequence
          Length = 114026

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 527   ctactgttttcctcttggat 546
             ||||||||||||||||||||
Sbjct: 74979 ctactgttttcctcttggat 74998
to top
>emb|AL669891.12| Mouse DNA sequence from clone RP23-271F3 on chromosome X, complete
             sequence
          Length = 221898

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 367   gtgtatagctatattttcttaatg 390
             |||||||| |||||||||||||||
Sbjct: 54997 gtgtatagatatattttcttaatg 54974
to top
>emb|AL513352.12| Mouse DNA sequence from clone RP23-180L12 on chromosome 15, complete
             sequence
          Length = 240977

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 316   tagctgagagcttcttcctgatctgcaa 343
             |||||||||||| | |||||||||||||
Sbjct: 46226 tagctgagagctacatcctgatctgcaa 46199
to top
>gb|AC159709.8| Mus musculus 10 BAC RP23-136O17 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 202716

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 410    cctcaagctcatgttccttc 429
              ||||||||||||||||||||
Sbjct: 140726 cctcaagctcatgttccttc 140745


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,544,601
Number of Sequences: 3902068
Number of extensions: 5544601
Number of successful extensions: 100645
Number of sequences better than 10.0: 101
Number of HSP's better than 10.0 without gapping: 102
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 100359
Number of HSP's gapped (non-prelim): 285
length of query: 576
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 553
effective length of database: 17,143,297,704
effective search space: 9480243630312
effective search space used: 9480243630312
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top