Clone Name | rbah63h08 |
---|---|
Clone Library Name | barley_pub |
>gb|BC002975.1| Homo sapiens CD79b molecule, immunoglobulin-associated beta, transcript variant 1, mRNA (cDNA clone MGC:2173 IMAGE:3542354), complete cds Length = 1290 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaagagctggacaccagggg 156 ||||||||||||||||||||| Sbjct: 908 gcaagagctggacaccagggg 888
>emb|AL669907.6| Mouse DNA sequence from clone RP23-245A5 on chromosome 11 Contains part of a crumbs-like protein precursor pseudogene, complete sequence Length = 156193 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Plus Query: 337 ttcttgcctctcttgcttctc 357 ||||||||||||||||||||| Sbjct: 30697 ttcttgcctctcttgcttctc 30717
>gb|AC161057.2| Mus musculus BAC clone RP23-248K11 from chromosome 12, complete sequence Length = 217206 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 tgacaaagatgcctaattatt 83 ||||||||||||||||||||| Sbjct: 71107 tgacaaagatgcctaattatt 71087
>gb|L27587.1|HUMCD79B Human CD79b/Ig beta/B29 gene, complete coding sequence Length = 3938 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaagagctggacaccagggg 156 ||||||||||||||||||||| Sbjct: 3536 gcaagagctggacaccagggg 3516
>gb|M80461.1|HUMB29 Human B29 mRNA, complete cds Length = 1218 Score = 42.1 bits (21), Expect = 1.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 136 gcaagagctggacaccagggg 156 ||||||||||||||||||||| Sbjct: 871 gcaagagctggacaccagggg 851
>gb|AC148478.2| X. tropicalis BAC clone ISB1-157C4 containing the sox9 gene, complete sequence Length = 76760 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 160 aaaccgtaaaaataaatatg 179 |||||||||||||||||||| Sbjct: 39159 aaaccgtaaaaataaatatg 39178
>gb|AC144809.2| Mus musculus BAC clone RP24-391L5 from chromosome 9, complete sequence Length = 185599 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 338 tcttgcctctcttgcttctc 357 |||||||||||||||||||| Sbjct: 94395 tcttgcctctcttgcttctc 94376
>gb|AC125019.6| Mus musculus chromosome 19, clone RP24-158H8, complete sequence Length = 162617 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 338 tcttgcctctcttgcttctc 357 |||||||||||||||||||| Sbjct: 144900 tcttgcctctcttgcttctc 144919
>gb|AC121597.2| Mus musculus BAC clone RP23-300D5 from 9, complete sequence Length = 168730 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 338 tcttgcctctcttgcttctc 357 |||||||||||||||||||| Sbjct: 18975 tcttgcctctcttgcttctc 18956
>gb|AC111092.10| Mus musculus chromosome 12, clone RP23-168O9, complete sequence Length = 211926 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 138 aagagctggacaccagggga 157 |||||||||||||||||||| Sbjct: 109342 aagagctggacaccagggga 109361
>emb|Z83846.1|HS415G2 Human DNA sequence from clone CTA-415G2 on chromosome 22 Contains the 5' end of the SYN3 gene for Synapsin III, a novel pseudogene and a CpG island, complete sequence Length = 129957 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 aatgactaatatcatatata 247 |||||||||||||||||||| Sbjct: 110689 aatgactaatatcatatata 110708
>emb|AL161624.7| Human DNA sequence from clone RP11-487I9 on chromosome X Contains part of the DIAPH2 gene for Drosophila diaphanous homolog 2 and the 3' end of a novel gene (EPAG), complete sequence Length = 133021 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 167 aaaaataaatatgtgcaacaagat 190 ||||||||||||||| |||||||| Sbjct: 28176 aaaaataaatatgtgaaacaagat 28199
>emb|BX071372.1|CNS09R8G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8DE07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 432 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 cgtgtttgaaggcacacaccacag 298 |||||||||||||| ||||||||| Sbjct: 345 cgtgtttgaaggcagacaccacag 322
>emb|BX053795.1|CNS09DO7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC31CG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 275 cgtgtttgaaggcacacaccacag 298 |||||||||||||| ||||||||| Sbjct: 368 cgtgtttgaaggcagacaccacag 345
>gb|AC175467.3| Pan troglodytes BAC clone CH251-302C22 from chromosome unknown, complete sequence Length = 186532 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 aatgactaatatcatatata 247 |||||||||||||||||||| Sbjct: 185333 aatgactaatatcatatata 185352
>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 Length = 2661830 Score = 40.1 bits (20), Expect = 5.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 244 tatagacttgcagagagagcacacttga 271 |||||||||||||| ||||||| ||||| Sbjct: 2636045 tatagacttgcagatagagcacgcttga 2636018
>gb|AC080021.3| Genomic sequence for Mus musculus, clone RP23-422L7, complete sequence Length = 200065 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 338 tcttgcctctcttgcttctc 357 |||||||||||||||||||| Sbjct: 91521 tcttgcctctcttgcttctc 91540
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 gtgcaacaagatgaggaaaa 198 |||||||||||||||||||| Sbjct: 17619101 gtgcaacaagatgaggaaaa 17619120
>gb|AC159375.1| Pan troglodytes BAC clone CH251-557H18 from chromosome unknown, complete sequence Length = 184511 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 228 aatgactaatatcatatata 247 |||||||||||||||||||| Sbjct: 6725 aatgactaatatcatatata 6744
>dbj|AP003217.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0094H06 Length = 147245 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 gtgcaacaagatgaggaaaa 198 |||||||||||||||||||| Sbjct: 636 gtgcaacaagatgaggaaaa 655
>dbj|AP003054.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0436D06 Length = 148246 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 179 gtgcaacaagatgaggaaaa 198 |||||||||||||||||||| Sbjct: 136673 gtgcaacaagatgaggaaaa 136692
>gb|AC102549.6| Mus musculus chromosome 18, clone RP23-138E12, complete sequence Length = 172181 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 338 tcttgcctctcttgcttctc 357 |||||||||||||||||||| Sbjct: 48953 tcttgcctctcttgcttctc 48972
>ref|XM_319508.2| Anopheles gambiae str. PEST ENSANGP00000017796 (ENSANGG00000015307), partial mRNA Length = 387 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 275 cgtgtttgaaggcacacaccacag 298 |||||||||||||| ||||||||| Sbjct: 342 cgtgtttgaaggcagacaccacag 365
>emb|Z55129.1|HS19D5R H.sapiens CpG island DNA genomic Mse1 fragment, clone 19d5, reverse read cpg19d5.rt1a Length = 301 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 187 agatgaggaaaactgcaatc 206 |||||||||||||||||||| Sbjct: 24 agatgaggaaaactgcaatc 43
>emb|AL807747.10| Mouse DNA sequence from clone RP23-300N21 on chromosome 4, complete sequence Length = 228003 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 128 ggactggagcaagagctgga 147 |||||||||||||||||||| Sbjct: 182303 ggactggagcaagagctgga 182322
>dbj|AP004963.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT48D11, TM0142, complete sequence Length = 78601 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 221 tattttcaatgactaatatcatat 244 |||||||| ||||||||||||||| Sbjct: 59279 tattttcagtgactaatatcatat 59256
>emb|AL683857.8| Mouse DNA sequence from clone RP23-46O18 on chromosome X, complete sequence Length = 238677 Score = 40.1 bits (20), Expect = 5.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 167 aaaaataaatatgtgcaacaagat 190 ||||||||||||||| |||||||| Sbjct: 120508 aaaaataaatatgtgaaacaagat 120531
>emb|AL732449.5| Mouse DNA sequence from clone RP23-191F11 on chromosome X, complete sequence Length = 160779 Score = 40.1 bits (20), Expect = 5.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 338 tcttgcctctcttgcttctc 357 |||||||||||||||||||| Sbjct: 46617 tcttgcctctcttgcttctc 46636 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,216,024 Number of Sequences: 3902068 Number of extensions: 4216024 Number of successful extensions: 75099 Number of sequences better than 10.0: 28 Number of HSP's better than 10.0 without gapping: 28 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 75022 Number of HSP's gapped (non-prelim): 77 length of query: 386 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 364 effective length of database: 17,147,199,772 effective search space: 6241580717008 effective search space used: 6241580717008 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)