ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah63h08
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC002975.1| Homo sapiens CD79b molecule, immunoglobulin-assoc... 42 1.3
2emb|AL669907.6| Mouse DNA sequence from clone RP23-245A5 on chro... 42 1.3
3gb|AC161057.2| Mus musculus BAC clone RP23-248K11 from chromosom... 42 1.3
4gb|L27587.1|HUMCD79B Human CD79b/Ig beta/B29 gene, complete codi... 42 1.3
5gb|M80461.1|HUMB29 Human B29 mRNA, complete cds 42 1.3
6gb|AC148478.2| X. tropicalis BAC clone ISB1-157C4 containing the... 40 5.2
7gb|AC144809.2| Mus musculus BAC clone RP24-391L5 from chromosome... 40 5.2
8gb|AC125019.6| Mus musculus chromosome 19, clone RP24-158H8, com... 40 5.2
9gb|AC121597.2| Mus musculus BAC clone RP23-300D5 from 9, complet... 40 5.2
10gb|AC111092.10| Mus musculus chromosome 12, clone RP23-168O9, co... 40 5.2
11emb|Z83846.1|HS415G2 Human DNA sequence from clone CTA-415G2 on ... 40 5.2
12emb|AL161624.7| Human DNA sequence from clone RP11-487I9 on chro... 40 5.2
13emb|BX071372.1|CNS09R8G Single read from an extremity of a full-... 40 5.2
14emb|BX053795.1|CNS09DO7 Single read from an extremity of a full-... 40 5.2
15gb|AC175467.3| Pan troglodytes BAC clone CH251-302C22 from chrom... 40 5.2
16dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 40 5.2
17gb|AC080021.3| Genomic sequence for Mus musculus, clone RP23-422... 40 5.2
18dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
19gb|AC159375.1| Pan troglodytes BAC clone CH251-557H18 from chrom... 40 5.2
20dbj|AP003217.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
21dbj|AP003054.2| Oryza sativa (japonica cultivar-group) genomic D... 40 5.2
22gb|AC102549.6| Mus musculus chromosome 18, clone RP23-138E12, co... 40 5.2
23ref|XM_319508.2| Anopheles gambiae str. PEST ENSANGP00000017796 ... 40 5.2
24emb|Z55129.1|HS19D5R H.sapiens CpG island DNA genomic Mse1 fragm... 40 5.2
25emb|AL807747.10| Mouse DNA sequence from clone RP23-300N21 on ch... 40 5.2
26dbj|AP004963.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 5.2
27emb|AL683857.8| Mouse DNA sequence from clone RP23-46O18 on chro... 40 5.2
28emb|AL732449.5| Mouse DNA sequence from clone RP23-191F11 on chr... 40 5.2

>gb|BC002975.1| Homo sapiens CD79b molecule, immunoglobulin-associated beta,
           transcript variant 1, mRNA (cDNA clone MGC:2173
           IMAGE:3542354), complete cds
          Length = 1290

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 136 gcaagagctggacaccagggg 156
           |||||||||||||||||||||
Sbjct: 908 gcaagagctggacaccagggg 888



to top

>emb|AL669907.6| Mouse DNA sequence from clone RP23-245A5 on chromosome 11 Contains part
             of a crumbs-like protein precursor pseudogene, complete
             sequence
          Length = 156193

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 337   ttcttgcctctcttgcttctc 357
             |||||||||||||||||||||
Sbjct: 30697 ttcttgcctctcttgcttctc 30717



to top

>gb|AC161057.2| Mus musculus BAC clone RP23-248K11 from chromosome 12, complete
             sequence
          Length = 217206

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 63    tgacaaagatgcctaattatt 83
             |||||||||||||||||||||
Sbjct: 71107 tgacaaagatgcctaattatt 71087



to top

>gb|L27587.1|HUMCD79B Human CD79b/Ig beta/B29 gene, complete coding sequence
          Length = 3938

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 136  gcaagagctggacaccagggg 156
            |||||||||||||||||||||
Sbjct: 3536 gcaagagctggacaccagggg 3516



to top

>gb|M80461.1|HUMB29 Human B29 mRNA, complete cds
          Length = 1218

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 136 gcaagagctggacaccagggg 156
           |||||||||||||||||||||
Sbjct: 871 gcaagagctggacaccagggg 851



to top

>gb|AC148478.2| X. tropicalis BAC clone ISB1-157C4 containing the sox9 gene, complete
             sequence
          Length = 76760

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 160   aaaccgtaaaaataaatatg 179
             ||||||||||||||||||||
Sbjct: 39159 aaaccgtaaaaataaatatg 39178



to top

>gb|AC144809.2| Mus musculus BAC clone RP24-391L5 from chromosome 9, complete sequence
          Length = 185599

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   tcttgcctctcttgcttctc 357
             ||||||||||||||||||||
Sbjct: 94395 tcttgcctctcttgcttctc 94376



to top

>gb|AC125019.6| Mus musculus chromosome 19, clone RP24-158H8, complete sequence
          Length = 162617

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 338    tcttgcctctcttgcttctc 357
              ||||||||||||||||||||
Sbjct: 144900 tcttgcctctcttgcttctc 144919



to top

>gb|AC121597.2| Mus musculus BAC clone RP23-300D5 from 9, complete sequence
          Length = 168730

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 338   tcttgcctctcttgcttctc 357
             ||||||||||||||||||||
Sbjct: 18975 tcttgcctctcttgcttctc 18956



to top

>gb|AC111092.10| Mus musculus chromosome 12, clone RP23-168O9, complete sequence
          Length = 211926

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 138    aagagctggacaccagggga 157
              ||||||||||||||||||||
Sbjct: 109342 aagagctggacaccagggga 109361



to top

>emb|Z83846.1|HS415G2 Human DNA sequence from clone CTA-415G2 on chromosome 22 Contains the 5'
              end of the SYN3 gene for Synapsin III, a novel pseudogene
              and a CpG island, complete sequence
          Length = 129957

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    aatgactaatatcatatata 247
              ||||||||||||||||||||
Sbjct: 110689 aatgactaatatcatatata 110708



to top

>emb|AL161624.7| Human DNA sequence from clone RP11-487I9 on chromosome X Contains part
             of the DIAPH2 gene for Drosophila diaphanous homolog 2 and
             the 3' end of a novel gene (EPAG), complete sequence
          Length = 133021

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 167   aaaaataaatatgtgcaacaagat 190
             ||||||||||||||| ||||||||
Sbjct: 28176 aaaaataaatatgtgaaacaagat 28199



to top

>emb|BX071372.1|CNS09R8G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 432

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 275 cgtgtttgaaggcacacaccacag 298
           |||||||||||||| |||||||||
Sbjct: 345 cgtgtttgaaggcagacaccacag 322



to top

>emb|BX053795.1|CNS09DO7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31CG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 275 cgtgtttgaaggcacacaccacag 298
           |||||||||||||| |||||||||
Sbjct: 368 cgtgtttgaaggcagacaccacag 345



to top

>gb|AC175467.3| Pan troglodytes BAC clone CH251-302C22 from chromosome unknown, complete
              sequence
          Length = 186532

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 228    aatgactaatatcatatata 247
              ||||||||||||||||||||
Sbjct: 185333 aatgactaatatcatatata 185352



to top

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                           
Query: 244     tatagacttgcagagagagcacacttga 271
               |||||||||||||| ||||||| |||||
Sbjct: 2636045 tatagacttgcagatagagcacgcttga 2636018



to top

>gb|AC080021.3| Genomic sequence for Mus musculus, clone RP23-422L7, complete sequence
          Length = 200065

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 338   tcttgcctctcttgcttctc 357
             ||||||||||||||||||||
Sbjct: 91521 tcttgcctctcttgcttctc 91540



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 179      gtgcaacaagatgaggaaaa 198
                ||||||||||||||||||||
Sbjct: 17619101 gtgcaacaagatgaggaaaa 17619120



to top

>gb|AC159375.1| Pan troglodytes BAC clone CH251-557H18 from chromosome unknown,
            complete sequence
          Length = 184511

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 228  aatgactaatatcatatata 247
            ||||||||||||||||||||
Sbjct: 6725 aatgactaatatcatatata 6744



to top

>dbj|AP003217.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1,
           BAC clone:OSJNBa0094H06
          Length = 147245

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 179 gtgcaacaagatgaggaaaa 198
           ||||||||||||||||||||
Sbjct: 636 gtgcaacaagatgaggaaaa 655



to top

>dbj|AP003054.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0436D06
          Length = 148246

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 179    gtgcaacaagatgaggaaaa 198
              ||||||||||||||||||||
Sbjct: 136673 gtgcaacaagatgaggaaaa 136692



to top

>gb|AC102549.6| Mus musculus chromosome 18, clone RP23-138E12, complete sequence
          Length = 172181

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 338   tcttgcctctcttgcttctc 357
             ||||||||||||||||||||
Sbjct: 48953 tcttgcctctcttgcttctc 48972



to top

>ref|XM_319508.2| Anopheles gambiae str. PEST ENSANGP00000017796
           (ENSANGG00000015307), partial mRNA
          Length = 387

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 275 cgtgtttgaaggcacacaccacag 298
           |||||||||||||| |||||||||
Sbjct: 342 cgtgtttgaaggcagacaccacag 365



to top

>emb|Z55129.1|HS19D5R H.sapiens CpG island DNA genomic Mse1 fragment, clone 19d5, reverse
           read cpg19d5.rt1a
          Length = 301

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 187 agatgaggaaaactgcaatc 206
           ||||||||||||||||||||
Sbjct: 24  agatgaggaaaactgcaatc 43



to top

>emb|AL807747.10| Mouse DNA sequence from clone RP23-300N21 on chromosome 4, complete
              sequence
          Length = 228003

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 128    ggactggagcaagagctgga 147
              ||||||||||||||||||||
Sbjct: 182303 ggactggagcaagagctgga 182322



to top

>dbj|AP004963.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT48D11, TM0142,
             complete sequence
          Length = 78601

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 221   tattttcaatgactaatatcatat 244
             |||||||| |||||||||||||||
Sbjct: 59279 tattttcagtgactaatatcatat 59256



to top

>emb|AL683857.8| Mouse DNA sequence from clone RP23-46O18 on chromosome X, complete
              sequence
          Length = 238677

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 167    aaaaataaatatgtgcaacaagat 190
              ||||||||||||||| ||||||||
Sbjct: 120508 aaaaataaatatgtgaaacaagat 120531



to top

>emb|AL732449.5| Mouse DNA sequence from clone RP23-191F11 on chromosome X, complete
             sequence
          Length = 160779

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 338   tcttgcctctcttgcttctc 357
             ||||||||||||||||||||
Sbjct: 46617 tcttgcctctcttgcttctc 46636


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,216,024
Number of Sequences: 3902068
Number of extensions: 4216024
Number of successful extensions: 75099
Number of sequences better than 10.0: 28
Number of HSP's better than 10.0 without gapping: 28
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75022
Number of HSP's gapped (non-prelim): 77
length of query: 386
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 364
effective length of database: 17,147,199,772
effective search space: 6241580717008
effective search space used: 6241580717008
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top