Clone Name | rbah63g13 |
---|---|
Clone Library Name | barley_pub |
>ref|NM_185010.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1709 Score = 107 bits (54), Expect = 4e-20 Identities = 102/119 (85%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 394 ||| |||||||| ||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 1233 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 1174 Query: 395 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagncacgccgagt 453 ||||||||| || ||||| || |||||||||| || || |||||||| || ||||||| Sbjct: 1173 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagt 1115
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 107 bits (54), Expect = 4e-20 Identities = 102/119 (85%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 394 ||| |||||||| ||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 32144983 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 32144924 Query: 395 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagncacgccgagt 453 ||||||||| || ||||| || |||||||||| || || |||||||| || ||||||| Sbjct: 32144923 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagt 32144865
>gb|AC084320.10| Oryza sativa chromosome 3 BAC OSJNBa0091J19 genomic sequence, complete sequence Length = 178158 Score = 107 bits (54), Expect = 4e-20 Identities = 102/119 (85%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 394 ||| |||||||| ||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 146108 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 146049 Query: 395 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagncacgccgagt 453 ||||||||| || ||||| || |||||||||| || || |||||||| || ||||||| Sbjct: 146048 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagt 145990
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 107 bits (54), Expect = 4e-20 Identities = 102/119 (85%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 394 ||| |||||||| ||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 32235495 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 32235436 Query: 395 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagncacgccgagt 453 ||||||||| || ||||| || |||||||||| || || |||||||| || ||||||| Sbjct: 32235435 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagt 32235377
>dbj|AK069426.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020D04, full insert sequence Length = 1801 Score = 107 bits (54), Expect = 4e-20 Identities = 102/119 (85%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgac 394 ||| |||||||| ||||| |||||||| || || |||||||||||||| ||||||||||| Sbjct: 1316 tcagaagcacttcttgtgaacgatggatggaccagtctcgtcgtagtctcccttggtgac 1257 Query: 395 gtgctggttctgggggaagaccaccttggccaggatcgcgccgcccagncacgccgagt 453 ||||||||| || ||||| || |||||||||| || || |||||||| || ||||||| Sbjct: 1256 gtgctggttttgcgggaaaacgaccttggccaatattgcaccgcccagccaggccgagt 1198
>gb|AY110996.1| Zea mays CL51592_-1 mRNA sequence Length = 615 Score = 65.9 bits (33), Expect = 1e-07 Identities = 126/158 (79%) Strand = Plus / Plus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtgacgtgc 398 |||||||| ||||| || |||||||| || ||||| || || ||||||||||| || ||| Sbjct: 284 aagcacttcttgtgcacaatggacggccccgtctcatcatactcgcccttggtcacatgc 343 Query: 399 tggttctgggggaagaccaccttggccaggatcgcgccgcccagncacgccgagtgccgc 458 ||||| || ||||| || ||||| |||| ||||| || |||| || ||||||| || Sbjct: 344 tggttttgagggaaaacgaccttagccaatatcgcaccacccaaccaggccgagtacctt 403 Query: 459 gccaggtnctccggcatgtactccggcgccttcacaag 496 || |||| ||| |||||||| || || | ||||||||| Sbjct: 404 gctaggttctcgggcatgtattcaggaggcttcacaag 441
>gb|AY524976.1| Cydia pomonella actin gene, partial cds Length = 1205 Score = 52.0 bits (26), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1201 aagcacttgctgtggacgatggaggggccggactcgtcgta 1161
>emb|Y09623.1|LRACTINPA Lumbricus rubellus mRNA for actin, partial Length = 1119 Score = 52.0 bits (26), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1115 aagcacttcctgtggacgatggatgggccggactcgtcgta 1075
>emb|X96514.1|LTACT1567 L.terrestris mRNA for actin (1567 bp) Length = 1567 Score = 52.0 bits (26), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1193 aagcacttcctgtggacgatggatgggccggactcgtcgta 1153
>gb|AF303985.1|AF303985 Salmo trutta cardiac muscle actin mRNA, complete cds Length = 1134 Score = 52.0 bits (26), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1130 aagcacttcctgtggacgatggaagggccggcctcgtcgta 1090
>dbj|AB086242.1| Coryphaenoides yaquinae mRNA for skeletal alpha-actin type-2a, complete cds Length = 1582 Score = 52.0 bits (26), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1130 aagcacttcctgtggacgatggaggggccggcctcgtcgta 1090
>dbj|AB086240.1| Coryphaenoides armatus mRNA for skeletal alpha-actin type-2a, complete cds Length = 1587 Score = 52.0 bits (26), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1130 aagcacttcctgtggacgatggaggggccggcctcgtcgta 1090
>gb|M26111.1|GOOACTB Goose beta-actin mRNA, complete cds Length = 1994 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||||||||||| ||||||||| Sbjct: 1188 gtggacgatggacgggccggactcgtcgta 1159
>dbj|AB021652.1| Coryphaenoides cinereus mRNA for skeletal alpha-actin type-2, complete cds Length = 1568 Score = 52.0 bits (26), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1137 aagcacttcctgtggacgatggaggggccggcctcgtcgta 1097
>dbj|AB021650.1| Coryphaenoides acrolepis mRNA for skeletal alpha-actin type-2, complete cds Length = 1611 Score = 52.0 bits (26), Expect = 0.002 Identities = 37/41 (90%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||||||||| Sbjct: 1177 aagcacttcctgtggacgatggaggggccggcctcgtcgta 1137
>emb|X05195.1|TPACT Tetrahymena pyriformis actin gene Length = 1234 Score = 50.1 bits (25), Expect = 0.007 Identities = 50/59 (84%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 393 ||| |||||||| ||||||||||||| || |||| |||||||| ||| ||||||||| Sbjct: 1198 tcagaagcactttctgtggacgatggaaggaccggattcgtcgtattcggccttggtga 1140
>dbj|AB034210.1| Oikopleura longicauda OilMA2 gene for muscle actin, complete cds Length = 3580 Score = 48.1 bits (24), Expect = 0.029 Identities = 47/55 (85%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 393 |||||||| ||||||||||||| || |||| |||||||| ||| ||||||||| Sbjct: 2753 aagcactttctgtggacgatggatggaccggcttcgtcgtattcggccttggtga 2699
>gb|AF539593.1| Globodera rostochiensis actin mRNA, complete cds Length = 1131 Score = 46.1 bits (23), Expect = 0.11 Identities = 39/45 (86%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgta 379 ||| |||||||| |||||||||||||||||| | ||||||||| Sbjct: 1131 tcagaagcacttgcggtggacgatggacgggcccgactcgtcgta 1087
>gb|AY380801.1| Panagrellus redivivus actin gene, complete cds Length = 1248 Score = 46.1 bits (23), Expect = 0.11 Identities = 39/45 (86%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgta 379 ||| |||||||| |||||||||||||||||||| |||||||| Sbjct: 1248 tcagaagcacttgcggtggacgatggacgggccggattcgtcgta 1204
>gb|AY112716.1| Panagrellus redivivus actin mRNA, complete cds Length = 1131 Score = 46.1 bits (23), Expect = 0.11 Identities = 39/45 (86%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgta 379 ||| |||||||| |||||||||||||||||||| |||||||| Sbjct: 1131 tcagaagcacttgcggtggacgatggacgggccggattcgtcgta 1087
>gb|AY161281.1| Globodera rostochiensis actin 2 mRNA, complete cds Length = 1131 Score = 46.1 bits (23), Expect = 0.11 Identities = 39/45 (86%) Strand = Plus / Minus Query: 335 tcanaagcacttnttgtggacgatggacgggccggtctcgtcgta 379 ||| |||||||| |||||||||||||||||| | ||||||||| Sbjct: 1131 tcagaagcacttgcggtggacgatggacgggcccgactcgtcgta 1087
>gb|AF182035.1| Homo sapiens skeletal muscle alpha-actin gene (ACTA1), complete cds Length = 3783 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 3280 gtggacgatggaagggccggcctcgtcgta 3251
>gb|BC012597.1| Homo sapiens actin, alpha 1, skeletal muscle, mRNA (cDNA clone MGC:13546 IMAGE:4291656), complete cds Length = 1694 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1226 gtggacgatggaagggccggcctcgtcgta 1197
>gb|DQ468385.1| Rhinolophus ferrumequinum beta-actin mRNA, partial cds Length = 521 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 507 gtggacgatggaggggccggactcgtcgta 478
>gb|AY099151.1| Littorina littorea beta actin mRNA, partial cds Length = 983 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 951 gtggacgatggaagggccggactcgtcgta 922
>gb|AY550069.1| Sus scrofa cytoskeletal beta actin mRNA, partial cds Length = 1862 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1200 gtggacgatggaggggccggactcgtcgta 1171
>gb|DQ279785.1| Carollia perspicillata beta-actin-like mRNA, partial sequence Length = 598 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 593 gtggacgatggaggggccggactcgtcgta 564
>gb|J01168.1|SUSACT2S Strongylocentrotus purpuratus actin 2 protein gene, complete cds Length = 1891 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1878 aagcacttcctgtggacgatggatgggccggactcatcgta 1838
>ref|XM_534781.2| PREDICTED: Canis familiaris similar to Actin, aortic smooth muscle (Alpha-actin 2) (LOC477587), mRNA Length = 1293 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 354 acgatggacgggccggtctcgtcgta 379 |||||||||||||||| ||||||||| Sbjct: 1135 acgatggacgggccggcctcgtcgta 1110
>emb|AJ012665.1|PAC012665 Plectus acuminatus mRNA for actin Length = 1861 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||||||||| | ||||||||| Sbjct: 1176 gtggacgatggacgggcccgactcgtcgta 1147
>gb|AF270649.1| Misgurnus mizolepis beta-actin gene, complete cds Length = 7339 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 6165 aagcacttcctgtggacgatggatgggccggactcatcgta 6125
>emb|CR735070.2|CNS0GTYL Tetraodon nigroviridis full-length cDNA Length = 1850 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1208 gtggacgatggaggggccggactcgtcgta 1179
>emb|CR733489.2|CNS0GSQO Tetraodon nigroviridis full-length cDNA Length = 1810 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1172 gtggacgatggaggggccggactcgtcgta 1143
>emb|CR732341.1|CNS0GS0Q Tetraodon nigroviridis full-length cDNA Length = 1464 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 836 gtggacgatggaggggccggactcgtcgta 807
>emb|CR729549.2|CNS0GPV7 Tetraodon nigroviridis full-length cDNA Length = 1497 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 854 gtggacgatggaggggccggactcgtcgta 825
>emb|CR728636.2|CNS0GP5U Tetraodon nigroviridis full-length cDNA Length = 1842 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1207 gtggacgatggaggggccggactcgtcgta 1178
>emb|CR727369.2|CNS0GO6N Tetraodon nigroviridis full-length cDNA Length = 1856 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1210 gtggacgatggaggggccggactcgtcgta 1181
>emb|CR723781.2|CNS0GLEZ Tetraodon nigroviridis full-length cDNA Length = 1859 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1217 gtggacgatggaggggccggactcgtcgta 1188
>ref|XM_856706.1| PREDICTED: Canis familiaris beta-actin, transcript variant 7 (ACTB), mRNA Length = 1102 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 188 gtggacgatggaggggccggactcgtcgta 159
>ref|XM_536888.2| PREDICTED: Canis familiaris beta-actin, transcript variant 1 (ACTB), mRNA Length = 2131 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1217 gtggacgatggaggggccggactcgtcgta 1188
>ref|XM_856647.1| PREDICTED: Canis familiaris beta-actin, transcript variant 6 (ACTB), mRNA Length = 1681 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 767 gtggacgatggaggggccggactcgtcgta 738
>emb|CR718527.2|CNS0GHD1 Tetraodon nigroviridis full-length cDNA Length = 1658 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1019 gtggacgatggaggggccggactcgtcgta 990
>ref|XM_845524.1| PREDICTED: Canis familiaris beta-actin, transcript variant 2 (ACTB), mRNA Length = 2173 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1259 gtggacgatggaggggccggactcgtcgta 1230
>ref|XM_856763.1| PREDICTED: Canis familiaris beta-actin, transcript variant 9 (ACTB), mRNA Length = 2176 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1262 gtggacgatggaggggccggactcgtcgta 1233
>ref|XM_856620.1| PREDICTED: Canis familiaris beta-actin, transcript variant 5 (ACTB), mRNA Length = 2172 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1258 gtggacgatggaggggccggactcgtcgta 1229
>emb|CR704121.2|CNS0G691 Tetraodon nigroviridis full-length cDNA Length = 1778 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1199 gtggacgatggaggggccggactcgtcgta 1170
>emb|CR703997.1|CNS0G65L Tetraodon nigroviridis full-length cDNA Length = 1823 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1200 gtggacgatggaggggccggactcgtcgta 1171
>emb|CR703834.2|CNS0G612 Tetraodon nigroviridis full-length cDNA Length = 1819 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1195 gtggacgatggaggggccggactcgtcgta 1166
>emb|CR703547.2|CNS0G5T3 Tetraodon nigroviridis full-length cDNA Length = 1849 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1209 gtggacgatggaggggccggactcgtcgta 1180
>emb|CR702701.2|CNS0G55L Tetraodon nigroviridis full-length cDNA Length = 905 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 267 gtggacgatggaggggccggactcgtcgta 238
>emb|CR702033.2|CNS0G4N1 Tetraodon nigroviridis full-length cDNA Length = 1804 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1185 gtggacgatggaggggccggactcgtcgta 1156
>emb|CR699919.2|CNS0G30B Tetraodon nigroviridis full-length cDNA Length = 1832 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1183 gtggacgatggaggggccggactcgtcgta 1154
>emb|CR700349.1|CNS0G3C9 Tetraodon nigroviridis full-length cDNA Length = 1360 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 744 gtggacgatggaggggccggactcgtcgta 715
>emb|CR691261.2|CNS0FWBT Tetraodon nigroviridis full-length cDNA Length = 972 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 341 gtggacgatggaggggccggactcgtcgta 312
>emb|CR691235.2|CNS0FWB3 Tetraodon nigroviridis full-length cDNA Length = 1819 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1197 gtggacgatggaggggccggactcgtcgta 1168
>emb|CR699132.2|CNS0G2EG Tetraodon nigroviridis full-length cDNA Length = 1311 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 682 gtggacgatggaggggccggactcgtcgta 653
>emb|CR698491.1|CNS0G1WN Tetraodon nigroviridis full-length cDNA Length = 1803 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1187 gtggacgatggaggggccggactcgtcgta 1158
>emb|CR698235.2|CNS0G1PJ Tetraodon nigroviridis full-length cDNA Length = 1042 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 398 gtggacgatggaggggccggactcgtcgta 369
>emb|CR698281.1|CNS0G1QT Tetraodon nigroviridis full-length cDNA Length = 1783 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1173 gtggacgatggaggggccggactcgtcgta 1144
>emb|CR697503.2|CNS0G157 Tetraodon nigroviridis full-length cDNA Length = 1386 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 743 gtggacgatggaggggccggactcgtcgta 714
>emb|CR696054.2|CNS0G00Y Tetraodon nigroviridis full-length cDNA Length = 1380 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 743 gtggacgatggaggggccggactcgtcgta 714
>emb|CR695870.2|CNS0FZVU Tetraodon nigroviridis full-length cDNA Length = 1831 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1204 gtggacgatggaggggccggactcgtcgta 1175
>emb|CR692132.2|CNS0FX00 Tetraodon nigroviridis full-length cDNA Length = 908 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 272 gtggacgatggaggggccggactcgtcgta 243
>emb|CR692262.1|CNS0FX3M Tetraodon nigroviridis full-length cDNA Length = 1799 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1188 gtggacgatggaggggccggactcgtcgta 1159
>emb|CR695267.2|CNS0FZF3 Tetraodon nigroviridis full-length cDNA Length = 1774 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1152 gtggacgatggaggggccggactcgtcgta 1123
>emb|CR694694.2|CNS0FYZ6 Tetraodon nigroviridis full-length cDNA Length = 1642 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1037 gtggacgatggaggggccggactcgtcgta 1008
>ref|XM_843847.1| PREDICTED: Canis familiaris similar to Actin, alpha skeletal muscle (Alpha-actin 1), transcript variant 2 (LOC488984), mRNA Length = 1385 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1111 gtggacgatggaggggccggcctcgtcgta 1082
>ref|XM_852388.1| PREDICTED: Canis familiaris similar to Actin, alpha skeletal muscle (Alpha-actin 1), transcript variant 5 (LOC488984), mRNA Length = 799 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 525 gtggacgatggaggggccggcctcgtcgta 496
>ref|XM_546102.2| PREDICTED: Canis familiaris similar to Actin, alpha skeletal muscle (Alpha-actin 1), transcript variant 1 (LOC488984), mRNA Length = 603 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 329 gtggacgatggaggggccggcctcgtcgta 300
>ref|XM_852310.1| PREDICTED: Canis familiaris similar to Actin, alpha skeletal muscle (Alpha-actin 1), transcript variant 4 (LOC488984), mRNA Length = 1137 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 863 gtggacgatggaggggccggcctcgtcgta 834
>emb|CR689700.1|CNS0FV4G Tetraodon nigroviridis full-length cDNA Length = 1044 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 421 gtggacgatggaggggccggactcgtcgta 392
>emb|CR687019.2|CNS0FT1Z Tetraodon nigroviridis full-length cDNA Length = 770 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 132 gtggacgatggaggggccggactcgtcgta 103
>emb|CR686737.2|CNS0FSU5 Tetraodon nigroviridis full-length cDNA Length = 1848 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1210 gtggacgatggaggggccggactcgtcgta 1181
>emb|CR686734.2|CNS0FSU2 Tetraodon nigroviridis full-length cDNA Length = 921 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 277 gtggacgatggaggggccggactcgtcgta 248
>ref|XM_536230.2| PREDICTED: Canis familiaris similar to cytoplasmic beta-actin (LOC610787), mRNA Length = 1854 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1155 gtggacgatggaggggccggactcgtcgta 1126
>emb|CR684749.2|CNS0FRAX Tetraodon nigroviridis full-length cDNA Length = 1853 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1209 gtggacgatggaggggccggactcgtcgta 1180
>emb|CR684567.2|CNS0FR5V Tetraodon nigroviridis full-length cDNA Length = 1817 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1197 gtggacgatggaggggccggactcgtcgta 1168
>emb|CR684380.2|CNS0FR0O Tetraodon nigroviridis full-length cDNA Length = 1849 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1204 gtggacgatggaggggccggactcgtcgta 1175
>emb|CR684251.2|CNS0FQX3 Tetraodon nigroviridis full-length cDNA Length = 1827 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1201 gtggacgatggaggggccggactcgtcgta 1172
>emb|CR683413.2|CNS0FQ9T Tetraodon nigroviridis full-length cDNA Length = 1825 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1189 gtggacgatggaggggccggactcgtcgta 1160
>emb|CR684365.1|CNS0FR09 Tetraodon nigroviridis full-length cDNA Length = 1771 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1170 gtggacgatggaggggccggactcgtcgta 1141
>emb|CR683315.2|CNS0FQ73 Tetraodon nigroviridis full-length cDNA Length = 1829 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1208 gtggacgatggaggggccggactcgtcgta 1179
>emb|CR682991.1|CNS0FPY3 Tetraodon nigroviridis full-length cDNA Length = 1164 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 546 gtggacgatggaggggccggactcgtcgta 517
>emb|CR682803.2|CNS0FPSV Tetraodon nigroviridis full-length cDNA Length = 980 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 342 gtggacgatggaggggccggactcgtcgta 313
>emb|CR682787.2|CNS0FPSF Tetraodon nigroviridis full-length cDNA Length = 1844 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1203 gtggacgatggaggggccggactcgtcgta 1174
>emb|CR682722.2|CNS0FPQM Tetraodon nigroviridis full-length cDNA Length = 1763 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1167 gtggacgatggaggggccggactcgtcgta 1138
>emb|CR681460.2|CNS0FORK Tetraodon nigroviridis full-length cDNA Length = 1839 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1206 gtggacgatggaggggccggactcgtcgta 1177
>emb|CR679698.2|CNS0FNEM Tetraodon nigroviridis full-length cDNA Length = 758 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| |||||||| Sbjct: 626 aagcactttctgtggacgatggaggggccggcttcgtcgta 586
>emb|CR679285.2|CNS0FN35 Tetraodon nigroviridis full-length cDNA Length = 1677 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1042 gtggacgatggaggggccggactcgtcgta 1013
>emb|CR664478.2|CNS0FBOK Tetraodon nigroviridis full-length cDNA Length = 1347 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 724 gtggacgatggaggggccggactcgtcgta 695
>emb|CR661066.2|CNS0F91S Tetraodon nigroviridis full-length cDNA Length = 1822 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1192 gtggacgatggaggggccggactcgtcgta 1163
>emb|CR655557.1|CNS0F4SR Tetraodon nigroviridis full-length cDNA Length = 1789 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1159 gtggacgatggaggggccggactcgtcgta 1130
>emb|CR654962.2|CNS0F4C8 Tetraodon nigroviridis full-length cDNA Length = 1575 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 939 gtggacgatggaggggccggactcgtcgta 910
>ref|NM_174225.1| Bos taurus actin, alpha 1, skeletal muscle (ACTA1), mRNA Length = 1485 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1224 gtggacgatggaggggccggcctcgtcgta 1195
>emb|CR648880.2|CNS0EZNA Tetraodon nigroviridis full-length cDNA Length = 1762 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1132 gtggacgatggaggggccggactcgtcgta 1103
>emb|CR642170.2|CNS0EUGW Tetraodon nigroviridis full-length cDNA Length = 1776 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1145 gtggacgatggaggggccggactcgtcgta 1116
>emb|CR640811.2|CNS0ETF5 Tetraodon nigroviridis full-length cDNA Length = 1813 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1194 gtggacgatggaggggccggactcgtcgta 1165
>emb|CR635905.1|CNS0EPMV Tetraodon nigroviridis full-length cDNA Length = 1814 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1189 gtggacgatggaggggccggactcgtcgta 1160
>emb|CR634803.2|CNS0EOS9 Tetraodon nigroviridis full-length cDNA Length = 1831 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1195 gtggacgatggaggggccggactcgtcgta 1166
>gb|AF500273.3| Gadus morhua fast skeletal muscle alpha-actin mRNA, complete cds Length = 1592 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1172 aagcacttcctgtggacgatggaggggcctgcctcgtcgta 1132
>ref|NM_001100.3| Homo sapiens actin, alpha 1, skeletal muscle (ACTA1), mRNA Length = 1509 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1224 gtggacgatggaagggccggcctcgtcgta 1195
>emb|AL160004.18| Human DNA sequence from clone RP5-1068B5 on chromosome 1q42.11-43 Contains a pseudogene similar to part of ribosomal protein L21 (RPL21), the ACTA1 gene for actin, alpha 1, skeletal muscle, the 3' end of the NUP133 gene for nucleoporin 133kDa and two CpG islands, complete sequence Length = 86173 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Plus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 52771 gtggacgatggaagggccggcctcgtcgta 52800
>emb|Y13665.1|SKY13665 Saccoglossus kowalevskii mRNA for actin, 2049 bp Length = 2049 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1146 gtggacgatggatgggccggactcgtcgta 1117
>emb|X96515.1|LTACT1820 L.terrestris act gene (1820 bp) Length = 1820 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| | ||||||||||| ||||||| ||||||||| Sbjct: 1788 aagcacttcctatggacgatggatgggccggactcgtcgta 1748
>emb|X96512.1|LTACT1596 L.terrestris mRNA for actin (1596 bp) Length = 1596 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| | ||||||||||| ||||||| ||||||||| Sbjct: 1180 aagcacttcctatggacgatggatgggccggactcgtcgta 1140
>ref|XM_781492.1| PREDICTED: Strongylocentrotus purpuratus similar to actin (41.8 kD) (act-2) (LOC581500), mRNA Length = 1333 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1191 gtggacgatggatgggccggactcgtcgta 1162
>emb|X03076.1|SFACT15B Strongylocentrotus franciscanus actin gene Sfa 15B Length = 1876 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1722 aagcacttcctgtggacgatggatgggccagactcgtcgta 1682
>emb|X03075.1|SFACT15A Strongylocentrotus franciscanus actin gene Sfa 15A Length = 1956 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1802 aagcacttcctgtggacgatggatgggccagactcgtcgta 1762
>gb|AY280960.1| Homo sapiens actin alpha 1 skeletal muscle protein (ACTA1) mRNA, complete cds; alternatively spliced Length = 765 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 750 gtggacgatggaagggccggcctcgtcgta 721
>emb|CR859327.1| Pongo pygmaeus mRNA; cDNA DKFZp468G072 (from clone DKFZp468G072) Length = 1543 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1223 gtggacgatggaagggccggcctcgtcgta 1194
>dbj|AK096902.1| Homo sapiens cDNA FLJ39583 fis, clone SKMUS2004897, highly similar to ACTIN, ALPHA SKELETAL MUSCLE Length = 1381 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1117 gtggacgatggaagggccggcctcgtcgta 1088
>gb|AF056976.1|AF056976 Acremonium chrysogenum gamma-actin (act) gene, complete cds Length = 3240 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| |||||| |||||||||| Sbjct: 2465 gtggacgatggaggggccgctctcgtcgta 2436
>emb|CR541796.1| Homo sapiens full open reading frame cDNA clone RZPDo834B0631D for gene ACTA1, actin, alpha 1, skeletal muscle; complete cds, without stopcodon Length = 1131 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1119 gtggacgatggaagggccggcctcgtcgta 1090
>emb|CR536516.1| Homo sapiens full open reading frame cDNA clone RZPDo834D1020D for gene ACTA1, actin, alpha 1, skeletal muscle; complete cds, incl. stopcodon Length = 1134 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1119 gtggacgatggaagggccggcctcgtcgta 1090
>gb|S64188.1| type 1 actin {type 1} [Emiliania huxleyi=Prymnesiophyte algae, CCMP379, mRNA Partial, 1095 nt] Length = 1095 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||||||||| | ||||||||| Sbjct: 1083 gtggacgatggacgggcccgactcgtcgta 1054
>gb|S57815.1| alpha-actin {STS, sequence tagged site} [human, Genomic, 188 nt] Length = 188 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 45 gtggacgatggaagggccggcctcgtcgta 16
>gb|BC102376.1| Bos taurus actin, alpha 1, skeletal muscle, mRNA (cDNA clone MGC:127298 IMAGE:7951610), complete cds Length = 1528 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1253 gtggacgatggaggggccggcctcgtcgta 1224
>gb|DQ322244.2| Culex pipiens pipiens strain Buckeye actin mRNA, complete cds Length = 1564 Score = 44.1 bits (22), Expect = 0.45 Identities = 25/26 (96%) Strand = Plus / Minus Query: 354 acgatggacgggccggtctcgtcgta 379 |||||||||||||||| ||||||||| Sbjct: 1150 acgatggacgggccggactcgtcgta 1125
>gb|U63566.1|U63566 Oxytricha sp. Aspen macronuclear actin I gene, partial cds Length = 1242 Score = 44.1 bits (22), Expect = 0.45 Identities = 45/53 (84%) Strand = Plus / Minus Query: 341 gcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 393 |||||| ||||||||||||| | ||| ||||||||||||| ||||||||| Sbjct: 1092 gcactttctgtggacgatggaggctccgttctcgtcgtagtcttccttggtga 1040
>gb|U63579.1|U63579 Oxytricha sp. Aspen. micronuclear actin I gene, partial sequence Length = 631 Score = 44.1 bits (22), Expect = 0.45 Identities = 45/53 (84%) Strand = Plus / Minus Query: 341 gcacttnttgtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 393 |||||| ||||||||||||| | ||| ||||||||||||| ||||||||| Sbjct: 258 gcactttctgtggacgatggaggctccgttctcgtcgtagtcttccttggtga 206
>gb|AC084593.1|CBRG42E09 Caenorhabditis briggsae cosmid G42E09, complete sequence Length = 41984 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Plus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 36283 gtggacgatggatgggccggactcgtcgta 36312
>gb|AC084484.1|CBRG03N05 Caenorhabditis briggsae cosmid G03N05, complete sequence Length = 29563 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 5721 gtggacgatggatgggccggactcgtcgta 5692
>ref|NM_001009784.1| Ovis aries beta actin (LOC443352), mRNA Length = 2191 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1199 gtggacgatggaggggccggactcgtcgta 1170
>ref|NM_214469.1| Strongylocentrotus purpuratus actin (LOC373192), mRNA Length = 1131 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1127 aagcacttcctgtggacgatggatgggccggactcatcgta 1087
>ref|NM_214528.1| Strongylocentrotus purpuratus cytoskeletal actin CyIIb (CyIIb), mRNA Length = 1131 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1127 aagcacttcctgtggacgatggatgggccggactcatcgta 1087
>gb|AF035774.1|AF035774 Equus caballus beta actin mRNA, complete cds Length = 1128 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1113 gtggacgatggaggggccggactcgtcgta 1084
>emb|BX648545.1|HSM808693 Homo sapiens mRNA; cDNA DKFZp779F0855 (from clone DKFZp779F0855) Length = 1240 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 953 gtggacgatggaagggccggcctcgtcgta 924
>dbj|AB073380.1| Theragra chalcogramma mRNA for alpha skeletal actin-2, complete cds Length = 1601 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1198 aagcacttcctgtggacgatggaggggcctgcctcgtcgta 1158
>dbj|AB073379.1| Theragra chalcogramma mRNA for alpha skeletal actin-1, complete cds Length = 1485 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||| | ||||||||| Sbjct: 1202 aagcacttcctgtggacgatggaggggcctgcctcgtcgta 1162
>gb|AY893990.1| Synthetic construct Homo sapiens clone FLH130947.01L actin alpha 1 (ACTA1) mRNA, partial cds Length = 1134 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1119 gtggacgatggaagggccggcctcgtcgta 1090
>gb|U38960.1|FRU38960 Fugu rubripes alpha actin (alpha-cardiac actin2) gene, complete cds Length = 3990 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 3756 aagcacttcctgtggacgatggaggggccggcctcatcgta 3716
>gb|U37499.1|TRU37499 Takifugu rubripes beta actin1 gene, complete cds Length = 4780 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 4073 gtggacgatggaggggccggactcgtcgta 4044
>gb|J01170.1|SUSACBS Sea urchin (S.purpuratus) actin gene, clone SpG2-8, AA 313 to COOH terminus Length = 277 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 184 aagcacttcctgtggacgatggatgggccggactcatcgta 144
>gb|J01169.1|SUSACAS Sea urchin (S.purpuratus) actin mRNA, clone SpG2, AA 313 to term Length = 628 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 184 aagcacttcctgtggacgatggatgggccggactcatcgta 144
>gb|U82659.1|HTCYTACT2 Heliocidaris tuberculata cytoplasmic actin CyII (HtCyII) gene, exon 4 and partial cds Length = 744 Score = 44.1 bits (22), Expect = 0.45 Identities = 27/29 (93%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggcc 367 |||||||| ||||||||||||||||||| Sbjct: 683 aagcacttcctgtggacgatggacgggcc 655
>gb|U39357.1|OAU39357 Ovis aries beta actin mRNA, complete cds Length = 2191 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1199 gtggacgatggaggggccggactcgtcgta 1170
>gb|J00068.1|HUMACTASK Human adult skeletal muscle alpha-actin mRNA Length = 1374 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1222 gtggacgatggaagggccggcctcgtcgta 1193
>gb|U02285.1|BTU02285 Bos taurus alpha skeletal actin precursor gene, complete cds Length = 6396 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 5270 gtggacgatggaggggccggcctcgtcgta 5241
>gb|M20543.1|HUMSAACT Human skeletal alpha-actin gene, complete cds Length = 3778 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 3274 gtggacgatggaagggccggcctcgtcgta 3245
>gb|M35323.1|SUSCYIIBA S.purpuratus cytoskeletal actin CyIIb gene, complete cds Length = 1972 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1825 aagcacttcctgtggacgatggatgggccggactcatcgta 1785
>gb|J01202.1|SUSACTIN Sea urchin (S.purpuratus) actin gene, clone pSpG17 Length = 2748 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 2058 aagcacttcctgtggacgatggatgggccggactcatcgta 2018
>dbj|AB036756.1| Chrysophrys major mRNA for B-actin, complete cds Length = 1521 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1142 gtggacgatggaggggccggactcgtcgta 1113
>dbj|D50029.1|CRASAA2 Goldfish mRNA for skeletal alpha-actin, complete cds Length = 1268 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| || |||| ||||||||| Sbjct: 1173 aagcacttcctgtggacgatggaaggaccggcctcgtcgta 1133
>ref|NM_001037157.1| Strongylocentrotus purpuratus actin 2 (LOC373190), mRNA Length = 1131 Score = 44.1 bits (22), Expect = 0.45 Identities = 36/41 (87%) Strand = Plus / Minus Query: 339 aagcacttnttgtggacgatggacgggccggtctcgtcgta 379 |||||||| ||||||||||||| ||||||| ||| ||||| Sbjct: 1127 aagcacttcctgtggacgatggatgggccggactcatcgta 1087
>dbj|D87406.1| Branchiostoma floridae mRNA for cytoplasmic actin, complete cds Length = 1809 Score = 44.1 bits (22), Expect = 0.45 Identities = 28/30 (93%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgta 379 |||||||||||| ||||||| ||||||||| Sbjct: 1137 gtggacgatggatgggccggactcgtcgta 1108
>gb|AE017343.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 3, complete sequence Length = 2105742 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Plus Query: 395 gtgctggttctgggggaagaccaccttgg 423 |||||||| ||||||||||||||| |||| Sbjct: 335461 gtgctggtgctgggggaagaccactttgg 335489
>gb|BC019212.1| Mus musculus serum amyloid A 4, mRNA (cDNA clone MGC:29122 IMAGE:5053373), complete cds Length = 2103 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 240 acaccacaccacaccagtgcc 260 ||||||||||||||||||||| Sbjct: 1544 acaccacaccacaccagtgcc 1564
>ref|NM_011316.2| Mus musculus serum amyloid A 4 (Saa4), mRNA Length = 2103 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 240 acaccacaccacaccagtgcc 260 ||||||||||||||||||||| Sbjct: 1544 acaccacaccacaccagtgcc 1564
>emb|CR639774.2|CNS0ESMC Tetraodon nigroviridis full-length cDNA Length = 1812 Score = 42.1 bits (21), Expect = 1.8 Identities = 27/29 (93%) Strand = Plus / Minus Query: 351 tggacgatggacgggccggtctcgtcgta 379 ||||||||||| ||||||| ||||||||| Sbjct: 1184 tggacgatggaggggccggactcgtcgta 1156
>gb|AC090122.26| Mus musculus strain C57BL/6J clone rp23-28a7 map 7, complete sequence Length = 212485 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 240 acaccacaccacaccagtgcc 260 ||||||||||||||||||||| Sbjct: 70282 acaccacaccacaccagtgcc 70302
>gb|U40397.1|MMU40397 Mus musculus serum amyloid A-4 protein (Saa4) gene, complete cds Length = 5705 Score = 42.1 bits (21), Expect = 1.8 Identities = 21/21 (100%) Strand = Plus / Plus Query: 240 acaccacaccacaccagtgcc 260 ||||||||||||||||||||| Sbjct: 4782 acaccacaccacaccagtgcc 4802
>gb|AE017136.1| Yersinia pestis biovar Medievalis str. 91001 section 10 of 16 of the complete genome Length = 290294 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 agtaaaaaatagacgccaat 96 |||||||||||||||||||| Sbjct: 65348 agtaaaaaatagacgccaat 65367
>gb|AE009952.1| Yersinia pestis KIM, complete genome Length = 4600755 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 agtaaaaaatagacgccaat 96 |||||||||||||||||||| Sbjct: 1754562 agtaaaaaatagacgccaat 1754543
>emb|Z68317.1|CET01H3 Caenorhabditis elegans Cosmid T01H3, complete sequence Length = 21870 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 tagctaggtaagctaggtag 144 |||||||||||||||||||| Sbjct: 13460 tagctaggtaagctaggtag 13479 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 125 tagctaggtaagctaggtag 144 |||||||||||||||||||| Sbjct: 13043 tagctaggtaagctaggtag 13062
>gb|AC101788.5| Mus musculus chromosome 15, clone RP24-148C8, complete sequence Length = 190073 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 76 tagtaaaaaatagacgccaa 95 |||||||||||||||||||| Sbjct: 103754 tagtaaaaaatagacgccaa 103735
>gb|DQ066926.1| Fundulus heteroclitus ribosomal protein L8 mRNA, partial cds Length = 409 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 409 ggaagaccaccttggccagg 428 |||||||||||||||||||| Sbjct: 44 ggaagaccaccttggccagg 25
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence Length = 4744671 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 77 agtaaaaaatagacgccaat 96 |||||||||||||||||||| Sbjct: 3108233 agtaaaaaatagacgccaat 3108252
>emb|AJ414153.1| Yersinia pestis strain CO92 complete genome; segment 13/20 Length = 258050 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 77 agtaaaaaatagacgccaat 96 |||||||||||||||||||| Sbjct: 173022 agtaaaaaatagacgccaat 173003
>gb|AC097359.2| Homo sapiens chromosome 3 clone RP11-259K5, complete sequence Length = 187127 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 46 tgggctagctcctagctagc 65 |||||||||||||||||||| Sbjct: 32549 tgggctagctcctagctagc 32568
>dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, complete genome Length = 5727534 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 411 aagaccaccttggccaggat 430 |||||||||||||||||||| Sbjct: 3221275 aagaccaccttggccaggat 3221256
>gb|AE005979.1| Caulobacter crescentus CB15 section 305 of 359 of the complete genome Length = 11597 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 418 ccttggccaggatcgcgccg 437 |||||||||||||||||||| Sbjct: 7893 ccttggccaggatcgcgccg 7874
>gb|AE012268.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 176 of 460 of the complete genome Length = 11409 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 418 ccttggccaggatcgcgccg 437 |||||||||||||||||||| Sbjct: 10015 ccttggccaggatcgcgccg 9996
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 418 ccttggccaggatcgcgccg 437 |||||||||||||||||||| Sbjct: 3091837 ccttggccaggatcgcgccg 3091856
>gb|U63126.1|TVU63126 Trichomonas vaginalis clone Type3 actin mRNA, partial cds Length = 1103 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 393 |||||||||||| ||||| | ||||||||| || ||||||||| Sbjct: 1088 gtggacgatggatgggccagcctcgtcgtattcctccttggtga 1045
>gb|U63125.1|TVU63125 Trichomonas vaginalis clone Type4 actin mRNA, partial cds Length = 1102 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 393 |||||||||||| ||||| | ||||||||| || ||||||||| Sbjct: 1087 gtggacgatggatgggccagcctcgtcgtattcctccttggtga 1044
>gb|U63123.1|TVU63123 Trichomonas vaginalis clone Type5 actin mRNA, partial cds Length = 1102 Score = 40.1 bits (20), Expect = 7.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 350 gtggacgatggacgggccggtctcgtcgtagtcgcccttggtga 393 |||||||||||| ||||| | ||||||||| || ||||||||| Sbjct: 1087 gtggacgatggatgggccagcctcgtcgtattcctccttggtga 1044
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 252 accagtgccagtgccgccgg 271 |||||||||||||||||||| Sbjct: 2642230 accagtgccagtgccgccgg 2642249 Score = 40.1 bits (20), Expect = 7.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 380 gtcgcccttggtgacgtgctggtt 403 |||||||||| ||||||||||||| Sbjct: 2239410 gtcgcccttgctgacgtgctggtt 2239433
>dbj|AP006190.1| Homo sapiens genomic DNA, chromosome 3, clone:RP11-145L6, complete sequence Length = 176082 Score = 40.1 bits (20), Expect = 7.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 46 tgggctagctcctagctagc 65 |||||||||||||||||||| Sbjct: 1981 tgggctagctcctagctagc 2000 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,312,725 Number of Sequences: 3902068 Number of extensions: 2312725 Number of successful extensions: 50101 Number of sequences better than 10.0: 168 Number of HSP's better than 10.0 without gapping: 168 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 49733 Number of HSP's gapped (non-prelim): 368 length of query: 515 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 492 effective length of database: 17,143,297,704 effective search space: 8434502470368 effective search space used: 8434502470368 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)