>emb|X57952.1|TAPRK T.aestivum PRK gene for ribulose-5-phosphate kinase
          Length = 2501

 Score =  398 bits (201), Expect = e-108
 Identities = 269/292 (92%), Gaps = 2/292 (0%)
 Strand = Plus / Minus

                                                                        
Query: 1    tttgattctagcaagtcacatgtattttctgcatngaaacatgggngaagatgtccattg 60
            ||||||||||||||| |||||||||||||||||| |||||||||| |||||||| ||| |
Sbjct: 2374 tttgattctagcaag-cacatgtattttctgcattgaaacatgggagaagatgtacatcg 2316

                                                                        
Query: 61   naatgtgttaagaggagacataagagactctcatcatggagaggattttcgagaagttna 120
             ||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||| |
Sbjct: 2315 aaatttgttaagaagagacataagagaccctcatcatggagaggattttcgagaagttca 2256

                                                                        
Query: 121  aaatgcaggttntcatgagttgctgcagcgaactttctaccgtcttctagctgtcatata 180
            ||||||||||| ||||||||| |||||| ||||||||||||||||||||||||| |||||
Sbjct: 2255 aaatgcaggttttcatgagtt-ctgcagtgaactttctaccgtcttctagctgtaatata 2197

                                                                        
Query: 181  ttcaaactagtcacaanaaacgtgaggatgctcattctcattgagttggngatgaaatga 240
            ||||||||||  |||| ||| | |||||||||||||||||||||||||| ||||||||||
Sbjct: 2196 ttcaaactaggtacaagaaatgcgaggatgctcattctcattgagttggtgatgaaatga 2137

                                                                
Query: 241  ttcatgaacttgaatttngggctcatcanacttttgctgcttcagcaggaac 292
            ||| ||||||||||||| |||||||||| |||||||||||||||||||||||
Sbjct: 2136 ttcgtgaacttgaatttggggctcatcaaacttttgctgcttcagcaggaac 2085

>emb|X51608.1|TAPRKGEN Triticum aestivum RNA for phosphoribulokinase
          Length = 1533

 Score =  383 bits (193), Expect = e-103
 Identities = 254/276 (92%), Gaps = 1/276 (0%)
 Strand = Plus / Minus

                                                                        
Query: 17   cacatgtattttctgcatngaaacatgggngaagatgtccattgnaatgtgttaagagga 76
            |||||||||||||||||| |||||||||| |||||||| ||| | ||| |||||||| ||
Sbjct: 1527 cacatgtattttctgcattgaaacatgggagaagatgtacatcgaaatttgttaagaaga 1468

                                                                        
Query: 77   gacataagagactctcatcatggagaggattttcgagaagttnaaaatgcaggttntcat 136
            |||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||
Sbjct: 1467 gacataagagaccctcatcatggagaggattttcgagaagttcaaaatgcaggttttcat 1408

                                                                        
Query: 137  gagttgctgcagcgaactttctaccgtcttctagctgtcatatattcaaactagtcacaa 196
            ||||| |||||| ||||||||||||||||||||||||| |||||||||||||||  ||||
Sbjct: 1407 gagtt-ctgcagtgaactttctaccgtcttctagctgtaatatattcaaactaggtacaa 1349

                                                                        
Query: 197  naaacgtgaggatgctcattctcattgagttggngatgaaatgattcatgaacttgaatt 256
             ||| | |||||||||||||||||||||||||| ||||||||||||| ||||||||||||
Sbjct: 1348 gaaatgcgaggatgctcattctcattgagttggtgatgaaatgattcgtgaacttgaatt 1289

                                                
Query: 257  tngggctcatcanacttttgctgcttcagcaggaac 292
            | |||||||||| |||||||||||||||||||||||
Sbjct: 1288 tggggctcatcaaacttttgctgcttcagcaggaac 1253

>emb|X61749.1|SMTBPA S.mytilis telomere-binding protein gene (alpha subunit) for Sty56V
          Length = 2141

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 235  aaatgattcatgaacttgaattt 257
            |||||||||||||||||||||||
Sbjct: 1862 aaatgattcatgaacttgaattt 1884

>gb|AC105008.5| Homo sapiens chromosome 8, clone CTD-2589E21, complete sequence
          Length = 172661

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 232    atgaaatgattcatgaacttgaa 254
              |||||||||||||||||||||||
Sbjct: 160686 atgaaatgattcatgaacttgaa 160708

>gb|AC104952.8| Homo sapiens chromosome 8, clone RP11-141J23, complete sequence
          Length = 190902

 Score = 46.1 bits (23), Expect = 0.062
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 232   atgaaatgattcatgaacttgaa 254
             |||||||||||||||||||||||
Sbjct: 21533 atgaaatgattcatgaacttgaa 21555

>gb|AC107447.5| Rattus norvegicus 4 BAC CH230-46D21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 133054

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 232   atgaaatgattcatgaactt 251
             ||||||||||||||||||||
Sbjct: 41427 atgaaatgattcatgaactt 41446

>gb|AC100378.10| Mus musculus chromosome 10, clone RP23-130O4, complete sequence
          Length = 218363

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 233  tgaaatgattcatgaacttg 252
            ||||||||||||||||||||
Sbjct: 5943 tgaaatgattcatgaacttg 5924

>gb|AC129012.4| Mus musculus BAC clone RP24-545L10 from chromosome 10, complete
             sequence
          Length = 143029

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 233   tgaaatgattcatgaacttg 252
             ||||||||||||||||||||
Sbjct: 60352 tgaaatgattcatgaacttg 60371

>emb|AJ245511.1|MTR245511 Medicago truncatula partial mRNA for ubiquitin
          Length = 229

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 155 ttctaccgtcttctagctgt 174
           ||||||||||||||||||||
Sbjct: 163 ttctaccgtcttctagctgt 144

>gb|AF067832.1|AF067832 Stylonychia mytilus micronuclear alpha telomere binding protein gene,
            complete sequence
          Length = 2686

 Score = 40.1 bits (20), Expect = 3.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 235  aaatgattcatgaacttgaa 254
            ||||||||||||||||||||
Sbjct: 2443 aaatgattcatgaacttgaa 2462


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,920,739
Number of Sequences: 3902068
Number of extensions: 1920739
Number of successful extensions: 31670
Number of sequences better than 10.0: 10
Number of HSP's better than 10.0 without gapping: 10
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 31656
Number of HSP's gapped (non-prelim): 11
length of query: 292
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 270
effective length of database: 17,147,199,772
effective search space: 4629743938440
effective search space used: 4629743938440
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)