ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbah63d18 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z81063.1|CEF15D3 Caenorhabditis elegans Cosmid F15D3, complete sequence Length = 42660 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| |||||||| Sbjct: 239 tttggctttggctttggctttggctttggctttggctgtggctt 196 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Minus Query: 513 ttggctggggctttggctttggctttggttgtggctt 549 |||||| ||||||||||||||||||||| | |||||| Sbjct: 292 ttggcttgggctttggctttggctttggctttggctt 256 Score = 50.1 bits (25), Expect = 0.009 Identities = 43/49 (87%) Strand = Plus / Minus Query: 501 tggggtttgggtttggctggggctttggctttggctttggttgtggctt 549 |||| ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 286 tgggctttggctttggctttggctttggctttggctttggctttggctt 238 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||||| |||||| Sbjct: 110 ggctttggctttggctttggttttggctt 82 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 275 tttggctttggctttggctttggctttggctttggctttggctt 232 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 269 tttggctttggctttggctttggctttggctttggctttggctt 226 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 263 tttggctttggctttggctttggctttggctttggctttggctt 220 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 257 tttggctttggctttggctttggctttggctttggctttggctt 214 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 251 tttggctttggctttggctttggctttggctttggctttggctt 208 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||| ||||||||||||| Sbjct: 113 tttggctttggctttggctttggttttggctttggtt 77 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 2248 ggctttggctttggctttgg 2229 Score = 40.1 bits (20), Expect = 8.9 Identities = 38/44 (86%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||| ||| | |||||| Sbjct: 233 tttggctttggctttggctttggctttggctgtggctttggctt 190 Score = 40.1 bits (20), Expect = 8.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctt 537 ||||| |||||||| ||||||||||| ||||| Sbjct: 215 tttggctttggctgtggctttggcttaggctt 184
>gb|AC124181.3| Mus musculus BAC clone RP23-204B12 from chromosome 18, complete sequence Length = 220244 Score = 54.0 bits (27), Expect = 6e-04 Identities = 42/47 (89%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggcttgac 552 ||||| ||||||| |||||||||||||||||||| | ||||||||| Sbjct: 58514 tttggctttggctttggctttggctttggctttggctttggcttgac 58560 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 58508 tttggctttggctttggctttggctttggctttggctttggctt 58551 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 58502 tttggctttggctttggctttggctttggctttggctttggctt 58545 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 58496 tttggctttggctttggctttggctttggctttggctttggctt 58539 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 58490 tttggctttggctttggctttggctttggctttggctttggctt 58533 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 58484 tttggctttggctttggctttggctttggctttggctttggctt 58527 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 58478 tttggctttggctttggctttggctttggctttggctttggctt 58521 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 58472 tttggctttggctttggctttggctttggctttggctttggctt 58515 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 58466 tttggctttggctttggctttggctttggctttggctttggctt 58509 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Plus Query: 520 gggctttggctttggctttggttgtggctt 549 ||||||||||||||||||||| | |||||| Sbjct: 58462 gggctttggctttggctttggctttggctt 58491 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 132235 ggctttggctttggctttggctttggctt 132207
>gb|AC114608.5| Mus musculus chromosome 8, clone RP23-418L5, complete sequence Length = 190200 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 501 tggggtttgggtttggctggggctttggctttggctttggttgtggcttg 550 |||| ||||| ||||||| |||||||||||||||||||| | ||||||| Sbjct: 144202 tgggctttggctttggctttggctttggctttggctttggctttggcttg 144153
>gb|AC124475.3| Mus musculus BAC clone RP24-92F8 from chromosome 8, complete sequence Length = 212858 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 501 tggggtttgggtttggctggggctttggctttggctttggttgtggcttg 550 |||| ||||| ||||||| |||||||||||||||||||| | ||||||| Sbjct: 145950 tgggctttggctttggctttggctttggctttggctttggctttggcttg 145999
>emb|AL713956.13| Mouse DNA sequence from clone RP23-412C18 on chromosome 11 Contains part of the Odz2 gene for odd Oz/ten-m homolog 2 (Drosophila), complete sequence Length = 138860 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 504 ggtttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||||| |||||||||||||||||||| | |||||| Sbjct: 54678 ggttttggtttggctttggctttggctttggctttggctttggctt 54633 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 504 ggtttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54672 ggtttggctttggctttggctttggctttggctttggctttggctt 54627 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||||||||||| Sbjct: 54610 tttggctttggctttggctttggctttggctttggtt 54574 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54664 tttggctttggctttggctttggctttggctttggctttggctt 54621 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54658 tttggctttggctttggctttggctttggctttggctttggctt 54615 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54652 tttggctttggctttggctttggctttggctttggctttggctt 54609 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54646 tttggctttggctttggctttggctttggctttggctttggctt 54603 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54640 tttggctttggctttggctttggctttggctttggctttggctt 54597 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54634 tttggctttggctttggctttggctttggctttggctttggctt 54591 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54628 tttggctttggctttggctttggctttggctttggctttggctt 54585 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 54622 tttggctttggctttggctttggctttggctttggctttggctt 54579 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 524 tttggctttggctttggttgtggctt 549 ||||||||||||||||||| |||||| Sbjct: 54575 tttggctttggctttggttttggctt 54550 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 504 ggtttgggtttggctggggctttggctttggctttgg 540 ||||||| ||||||| || ||||||||||||||||| Sbjct: 54577 ggtttggctttggctttggttttggctttggctttgg 54541 Score = 40.1 bits (20), Expect = 8.9 Identities = 35/40 (87%) Strand = Plus / Minus Query: 510 ggtttggctggggctttggctttggctttggttgtggctt 549 ||||||||| |||||||| ||||||||||| | |||||| Sbjct: 54577 ggtttggctttggctttggttttggctttggctttggctt 54538
>gb|AF036695.2| Caenorhabditis elegans cosmid F16B3, complete sequence Length = 36818 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttggttgtggctt 549 ||||||| |||||||||||||||||||||| |||||| Sbjct: 29018 tttggctttggctttggctttggctttggttttggctt 28981 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 29020 gctttggctttggctttggctttggctt 28993
>gb|AC120339.18| Mus musculus chromosome 14, clone RP23-126A8, complete sequence Length = 228458 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||||||||||| Sbjct: 181011 tttggctttggctttggctttggctttggctttggtt 180975 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181083 tttggttttggctttggctttggctttggctttggctttggctt 181040 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181077 tttggctttggctttggctttggctttggctttggctttggctt 181034 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181071 tttggctttggctttggctttggctttggctttggctttggctt 181028 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181065 tttggctttggctttggctttggctttggctttggctttggctt 181022 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181059 tttggctttggctttggctttggctttggctttggctttggctt 181016 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181053 tttggctttggctttggctttggctttggctttggctttggctt 181010 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181047 tttggctttggctttggctttggctttggctttggctttggctt 181004 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181041 tttggctttggctttggctttggctttggctttggctttggctt 180998 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181035 tttggctttggctttggctttggctttggctttggctttggctt 180992 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181029 tttggctttggctttggctttggctttggctttggctttggctt 180986 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 181023 tttggctttggctttggctttggctttggctttggctttggctt 180980 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttgg 540 ||||| ||||||| |||||||||||||||||||| Sbjct: 181149 tttggttttggctttggctttggctttggctttgg 181115 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttgg 540 ||||| ||||||| |||||||||||||||||||| Sbjct: 181143 tttggctttggctttggctttggctttggctttgg 181109 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 181140 ggctttggctttggctttggctttggctt 181112 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 181137 tttggctttggctttggctttggctttggatttggtt 181101 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 181005 tttggctttggctttggctttggctttggttttggtt 180969
>gb|AC116119.12| Mus musculus chromosome 12, clone RP23-76D19, complete sequence Length = 264410 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||||||||||| Sbjct: 22144 tttggctttggctttggctttggctttggctttggtt 22180 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22132 tttggctttggctttggctttggctttggctttggctttggctt 22175 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22126 tttggctttggctttggctttggctttggctttggctttggctt 22169 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22120 tttggctttggctttggctttggctttggctttggctttggctt 22163 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22114 tttggctttggctttggctttggctttggctttggctttggctt 22157 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22108 tttggctttggctttggctttggctttggctttggctttggctt 22151 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22102 tttggctttggctttggctttggctttggctttggctttggctt 22145 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22096 tttggctttggctttggctttggctttggctttggctttggctt 22139 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22090 tttggctttggctttggctttggctttggctttggctttggctt 22133 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22084 tttggctttggctttggctttggctttggctttggctttggctt 22127 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 22078 tttggttttggctttggctttggctttggctttggctttggctt 22121 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 22150 tttggctttggctttggctttggctttggttttggtt 22186
>gb|AC104863.12| Mus musculus chromosome 6, clone RP23-109C11, complete sequence Length = 198321 Score = 50.1 bits (25), Expect = 0.009 Identities = 37/41 (90%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtgg 546 ||||| ||||||| |||||||||||||| ||||||||||| Sbjct: 74531 tttggctttggctttggctttggctttggttttggttgtgg 74571 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||||||||||| Sbjct: 74525 tttggctttggctttggctttggctttggctttggtt 74561 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 74513 tttggctttggctttggctttggctttggctttggctttggctt 74556 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 74507 tttggctttggctttggctttggctttggctttggctttggctt 74550 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 74501 tttggctttggctttggctttggctttggctttggctttggctt 74544 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 74495 tttggctttggctttggctttggctttggctttggctttggctt 74538
>emb|Z26880.1|CR14KDPP C.roseus mRNA for 14 kDa polypeptide Length = 562 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||||| |||||| Sbjct: 148 ggctttggctttggctttggttttggctt 120 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 154 ggctttggctttggctttgg 135
>emb|X85206.1|CRRNAHPRP C.roseus mRNA for hybrid proline-rich protein Length = 642 Score = 50.1 bits (25), Expect = 0.009 Identities = 28/29 (96%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||||| |||||| Sbjct: 147 ggctttggctttggctttggttttggctt 119 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 153 ggctttggctttggctttgg 134
>gb|AC096975.5| Rattus norvegicus 2 BAC CH230-203P11 (Children's Hospital Oakland Research Institute) complete sequence Length = 213875 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggcttg 550 ||||| ||||||| |||||||||||||||||||| | ||||||| Sbjct: 39350 tttggctttggctttggctttggctttggctttggctttggcttg 39306 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39428 tttggttttggctttggctttggctttggctttggctttggctt 39385 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39422 tttggctttggctttggctttggctttggctttggctttggctt 39379 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39416 tttggctttggctttggctttggctttggctttggctttggctt 39373 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39410 tttggctttggctttggctttggctttggctttggctttggctt 39367 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39404 tttggctttggctttggctttggctttggctttggctttggctt 39361 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39398 tttggctttggctttggctttggctttggctttggctttggctt 39355 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39392 tttggctttggctttggctttggctttggctttggctttggctt 39349 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39386 tttggctttggctttggctttggctttggctttggctttggctt 39343 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39380 tttggctttggctttggctttggctttggctttggctttggctt 39337 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39374 tttggctttggctttggctttggctttggctttggctttggctt 39331 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39368 tttggctttggctttggctttggctttggctttggctttggctt 39325 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39362 tttggctttggctttggctttggctttggctttggctttggctt 39319 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 39356 tttggctttggctttggctttggctttggctttggctttggctt 39313
>dbj|AK049492.1| Mus musculus 7 days embryo whole body cDNA, RIKEN full-length enriched library, clone:C430017E22 product:unclassifiable, full insert sequence Length = 3206 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Plus Query: 510 ggtttggctggggctttggctttggctttggtt 542 ||||||||| |||||||||||||||||||||| Sbjct: 904 ggtttggctttggctttggctttggctttggtt 936 Score = 46.1 bits (23), Expect = 0.14 Identities = 35/39 (89%) Strand = Plus / Plus Query: 504 ggtttgggtttggctggggctttggctttggctttggtt 542 ||||||| ||||||| |||||||||||||| ||||||| Sbjct: 904 ggtttggctttggctttggctttggctttggttttggtt 942
>gb|AC156792.2| Mus musculus BAC clone RP24-160P13 from chromosome 12, complete sequence Length = 187170 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||||||||||| Sbjct: 167243 tttggctttggctttggctttggctttggctttggtt 167279 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167231 tttggctttggctttggctttggctttggctttggctttggctt 167274 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167225 tttggctttggctttggctttggctttggctttggctttggctt 167268 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167219 tttggctttggctttggctttggctttggctttggctttggctt 167262 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167213 tttggctttggctttggctttggctttggctttggctttggctt 167256 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167207 tttggctttggctttggctttggctttggctttggctttggctt 167250 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167201 tttggctttggctttggctttggctttggctttggctttggctt 167244 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167195 tttggctttggctttggctttggctttggctttggctttggctt 167238 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167189 tttggctttggctttggctttggctttggctttggctttggctt 167232 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167183 tttggctttggctttggctttggctttggctttggctttggctt 167226 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167177 tttggttttggctttggctttggctttggctttggctttggctt 167220 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 167249 tttggctttggctttggctttggctttggttttggtt 167285
>gb|AC154798.2| Mus musculus BAC clone RP24-495N16 from chromosome 17, complete sequence Length = 138195 Score = 50.1 bits (25), Expect = 0.009 Identities = 34/37 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||||||||||| Sbjct: 74998 tttggctttggctttggctttggctttggctttggtt 74962 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 75022 tttggttttggctttggctttggctttggctttggctttggctt 74979 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 75016 tttggctttggctttggctttggctttggctttggctttggctt 74973 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 75010 tttggctttggctttggctttggctttggctttggctttggctt 74967 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 74992 tttggctttggctttggctttggctttggttttggtt 74956
>emb|AL589661.21| Mouse DNA sequence from clone RP23-58B7 on chromosome 15, complete sequence Length = 241432 Score = 50.1 bits (25), Expect = 0.009 Identities = 31/33 (93%) Strand = Plus / Minus Query: 510 ggtttggctggggctttggctttggctttggtt 542 ||||||||| |||||||||||||||||||||| Sbjct: 180395 ggtttggctttggctttggctttggctttggtt 180363 Score = 46.1 bits (23), Expect = 0.14 Identities = 35/39 (89%) Strand = Plus / Minus Query: 504 ggtttgggtttggctggggctttggctttggctttggtt 542 ||||||| ||||||| |||||||||||||| ||||||| Sbjct: 180395 ggtttggctttggctttggctttggctttggttttggtt 180357
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1272006 tttggctttggctttggctttggctttggctttggctttggctt 1271963 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1272000 tttggctttggctttggctttggctttggctttggctttggctt 1271957 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1271994 tttggctttggctttggctttggctttggctttggctttggctt 1271951 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1271988 tttggctttggctttggctttggctttggctttggctttggctt 1271945 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1271982 tttggctttggctttggctttggctttggctttggctttggctt 1271939 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 1272009 ggctttggctttggctttggctttggctt 1271981
>gb|AC166939.2| Mus musculus BAC clone RP23-72K19 from chromosome 8, complete sequence Length = 236510 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167143 tttggctttggctttggctttggctttggctttggctttggctt 167186 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167137 tttggctttggctttggctttggctttggctttggctttggctt 167180 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167131 tttggctttggctttggctttggctttggctttggctttggctt 167174 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167125 tttggctttggctttggctttggctttggctttggctttggctt 167168 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167119 tttggctttggctttggctttggctttggctttggctttggctt 167162 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167113 tttggctttggctttggctttggctttggctttggctttggctt 167156 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167107 tttggctttggctttggctttggctttggctttggctttggctt 167150 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167101 tttggctttggctttggctttggctttggctttggctttggctt 167144 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167095 tttggctttggctttggctttggctttggctttggctttggctt 167138 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167089 tttggctttggctttggctttggctttggctttggctttggctt 167132 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167083 tttggctttggctttggctttggctttggctttggctttggctt 167126 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 167077 tttggctttggctttggctttggctttggctttggctttggctt 167120 Score = 44.1 bits (22), Expect = 0.57 Identities = 34/38 (89%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttggttgtggctt 549 |||||||| ||||||||||||||||||| | |||||| Sbjct: 167065 tttggctgttgctttggctttggctttggctttggctt 167102
>emb|AL110482.1|CEY39G8B Caenorhabditis elegans YAC Y39G8B, complete sequence Length = 25623 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 4813 tttggctttggctttggctttggctttggctttggatttggctt 4856 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 4801 tttggctttggctttggctttggctttggctttggctttggctt 4844 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 4795 tttggctttggctttggctttggctttggctttggctttggctt 4838 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 4789 tttggctttggctttggctttggctttggctttggctttggctt 4832 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 4786 ggctttggctttggctttggctttggctt 4814
>emb|AL031635.1|CEY47D3B Caenorhabditis elegans YAC Y47D3B, complete sequence Length = 95968 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 43979 tttggctttggctttggctttggctttggctttggctttggctt 44022 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 43973 tttggctttggctttggctttggctttggctttggctttggctt 44016 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 43967 tttggctttggctttggctttggctttggctttggctttggctt 44010 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 43961 tttggctttggctttggctttggctttggctttggctttggctt 44004
>gb|AC122890.4| Mus musculus BAC clone RP23-63O14 from 8, complete sequence Length = 209359 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29536 tttggctttggctttggctttggctttggctttggctttggctt 29579 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29530 tttggctttggctttggctttggctttggctttggctttggctt 29573 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29524 tttggctttggctttggctttggctttggctttggctttggctt 29567 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29518 tttggctttggctttggctttggctttggctttggctttggctt 29561 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29512 tttggctttggctttggctttggctttggctttggctttggctt 29555 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29506 tttggctttggctttggctttggctttggctttggctttggctt 29549 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29500 tttggctttggctttggctttggctttggctttggctttggctt 29543 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29494 tttggctttggctttggctttggctttggctttggctttggctt 29537 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29488 tttggctttggctttggctttggctttggctttggctttggctt 29531 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29482 tttggctttggctttggctttggctttggctttggctttggctt 29525 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29476 tttggctttggctttggctttggctttggctttggctttggctt 29519 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 29470 tttggctttggctttggctttggctttggctttggctttggctt 29513 Score = 44.1 bits (22), Expect = 0.57 Identities = 34/38 (89%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttggttgtggctt 549 |||||||| ||||||||||||||||||| | |||||| Sbjct: 29458 tttggctgttgctttggctttggctttggctttggctt 29495
>gb|AC159823.2| Mus musculus BAC clone RP23-113F14 from chromosome 12, complete sequence Length = 212532 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 141873 tttggctttggctttggctttggctttggctttggctttggctt 141916 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 141867 tttggctttggctttggctttggctttggctttggctttggctt 141910 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttgg 540 ||||| ||||||| |||||||||||||||||||| Sbjct: 141885 tttggctttggctttggctttggctttggctttgg 141919
>gb|AC159274.2| Mus musculus BAC clone RP23-405C6 from chromosome 12, complete sequence Length = 200974 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1950 tttggctttggctttggctttggctttggctttggctttggctt 1993 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1944 tttggctttggctttggctttggctttggctttggctttggctt 1987 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttgg 540 ||||| ||||||| |||||||||||||||||||| Sbjct: 1962 tttggctttggctttggctttggctttggctttgg 1996
>dbj|AB100489.1| Uncultured Clostridiaceae bacterium gene for 16S rRNA, partial sequence, clone: Rs-L27 Length = 1664 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 295 tttggctttggctttggctttggctttggctttggctttggctt 252 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 297 gctttggctttggctttggctttggctt 270
>dbj|D83227.1|POPELPG Populus nigra gene for extensin like protein, complete cds Length = 2791 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttggtt 542 |||| ||||||| |||||||||||||||||||||| Sbjct: 1184 ttggctttggctttggctttggctttggctttggtt 1149 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 1182 ggctttggctttggctttggctttggctt 1154
>dbj|D83226.1|POPELP Populus nigra mRNA for extensin like protein, complete cds Length = 661 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttggtt 542 |||| ||||||| |||||||||||||||||||||| Sbjct: 171 ttggctttggctttggctttggctttggctttggtt 136 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 169 ggctttggctttggctttggctttggctt 141
>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence Length = 5888780 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggt 541 ||||| ||||||| ||||||||||||||||||||| Sbjct: 3936382 tttggctttggctttggctttggctttggctttggt 3936417 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 3936370 tttggctttggctttggctttggctttggctttggctttggctt 3936413 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 3936364 tttggctttggctttggctttggctttggctttggctttggctt 3936407 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 3936358 tttggctttggctttggctttggctttggctttggctttggctt 3936401 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315535 tttggctttggctttggctttggctttggctttggctttggctt 1315492 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315529 tttggctttggctttggctttggctttggctttggctttggctt 1315486 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315523 tttggctttggctttggctttggctttggctttggctttggctt 1315480 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315517 tttggctttggctttggctttggctttggctttggctttggctt 1315474 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315511 tttggctttggctttggctttggctttggctttggctttggctt 1315468 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315505 tttggctttggctttggctttggctttggctttggctttggctt 1315462 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315499 tttggctttggctttggctttggctttggctttggctttggctt 1315456 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315493 tttggctttggctttggctttggctttggctttggctttggctt 1315450 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315487 tttggctttggctttggctttggctttggctttggctttggctt 1315444 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315481 tttggctttggctttggctttggctttggctttggctttggctt 1315438 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 1315475 tttggctttggctttggctttggctttggctttggctttggctt 1315432 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttgg 540 ||||| ||||||| |||||||||||||||||||| Sbjct: 1315463 tttggctttggctttggctttggctttggctttgg 1315429 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 3936355 ggctttggctttggctttggctttggctt 3936383 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 1315537 gctttggctttggctttggctttggctt 1315510
>emb|CT025599.16| Mouse DNA sequence from clone RP24-254G12 on chromosome 14, complete sequence Length = 170436 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 94908 tttggctttggctttggctttggctttggctttggctttggctt 94865 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 94902 tttggctttggctttggctttggctttggctttggctttggctt 94859 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 94896 tttggctttggctttggctttggctttggctttggctttggctt 94853 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttggttgtggctt 549 |||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 94913 ttggctttggctttggctttggctttggctttggctttggctt 94871 Score = 44.1 bits (22), Expect = 0.57 Identities = 31/34 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttg 539 ||||| ||||||| ||||||||||||||||||| Sbjct: 94884 tttggctttggctttggctttggctttggctttg 94851 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 94977 ggctttggctttggctttgg 94958 Score = 40.1 bits (20), Expect = 8.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 505 gtttgggtttggctggggctttggctttggctttgg 540 ||||| |||||||| ||||||||||||||| |||| Sbjct: 94987 gtttgtgtttggctttggctttggctttggccttgg 94952
>emb|AL672055.8| Mouse DNA sequence from clone RP23-339K2 on chromosome X, complete sequence Length = 232188 Score = 48.1 bits (24), Expect = 0.036 Identities = 33/36 (91%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggt 541 ||||| ||||||| ||||||||||||||||||||| Sbjct: 132243 tttggctttggctttggctttggctttggctttggt 132278 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 132231 tttggctttggctttggctttggctttggctttggctttggctt 132274 Score = 48.1 bits (24), Expect = 0.036 Identities = 39/44 (88%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 132225 tttggttttggctttggctttggctttggctttggctttggctt 132268
>ref|XM_458454.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0C18821g) partial mRNA Length = 2316 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 523 ctttggctttggctttggttgtggctt 549 |||||||||||||||||||| |||||| Sbjct: 186 ctttggctttggctttggttttggctt 160
>gb|CP000124.1| Burkholderia pseudomallei 1710b chromosome I, complete sequence Length = 4126292 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttgg 540 ||||| ||||||| |||||||||||||||||||| Sbjct: 3270998 tttggctttggctttggctttggctttggctttgg 3270964 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttggttgtggctt 549 |||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 3271003 ttggctttggctttggctttggctttggctttggctttggctt 3270961 Score = 40.1 bits (20), Expect = 8.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctt 537 ||||| ||||||| ||||||||||||||||| Sbjct: 3270992 tttggctttggctttggctttggctttggctt 3270961
>gb|AC163023.4| Mus musculus chromosome 3, clone RP24-247E19, complete sequence Length = 166206 Score = 46.1 bits (23), Expect = 0.14 Identities = 32/35 (91%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttgg 540 ||||| ||||||| |||||||||||||||||||| Sbjct: 24197 tttggttttggctttggctttggctttggctttgg 24163 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 524 tttggctttggctttggttgtggctt 549 ||||||||||||||||||| |||||| Sbjct: 24209 tttggctttggctttggttttggctt 24184 Score = 40.1 bits (20), Expect = 8.9 Identities = 38/44 (86%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| |||||||| ||||||||||| | |||||| Sbjct: 24215 tttggttttggctttggctttggttttggctttggctttggctt 24172 Score = 40.1 bits (20), Expect = 8.9 Identities = 38/44 (86%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| || ||||||||||||||||| | |||||| Sbjct: 24209 tttggctttggctttggttttggctttggctttggctttggctt 24166
>gb|AC132624.3| Mus musculus BAC clone RP23-77B21 from chromosome 18, complete sequence Length = 161099 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttg 543 ||||||||||||||||||||||| Sbjct: 31028 ggctttggctttggctttggttg 31050
>emb|CR382135.1| Debaryomyces hansenii chromosome C of strain CBS767 of Debaryomyces hansenii Length = 1592360 Score = 46.1 bits (23), Expect = 0.14 Identities = 26/27 (96%) Strand = Plus / Minus Query: 523 ctttggctttggctttggttgtggctt 549 |||||||||||||||||||| |||||| Sbjct: 1553798 ctttggctttggctttggttttggctt 1553772
>dbj|AK019744.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930546C10 product:hypothetical protein, full insert sequence Length = 2324 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttg 543 ||||||||||||||||||||||| Sbjct: 294 ggctttggctttggctttggttg 316
>gb|AC010842.5|AC010842 Drosophila melanogaster, chromosome 2R, region 59F5-59F8, BAC clone BACR02E09, complete sequence Length = 175118 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 524 tttggctttggctttggttgtgg 546 ||||||||||||||||||||||| Sbjct: 120772 tttggctttggctttggttgtgg 120794
>gb|AC009182.4|AC009182 Drosophila melanogaster, chromosome 2R, region 60A2-60A3, BAC clone BACR05F24, complete sequence Length = 147086 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 524 tttggctttggctttggttgtgg 546 ||||||||||||||||||||||| Sbjct: 1885 tttggctttggctttggttgtgg 1907
>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete sequence Length = 598988 Score = 46.1 bits (23), Expect = 0.14 Identities = 23/23 (100%) Strand = Plus / Plus Query: 524 tttggctttggctttggttgtgg 546 ||||||||||||||||||||||| Sbjct: 298370 tttggctttggctttggttgtgg 298392
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica Length = 3272609 Score = 46.1 bits (23), Expect = 0.14 Identities = 38/43 (88%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttggttgtggctt 549 |||| ||||||| |||||||||||||||||||| | |||||| Sbjct: 203125 ttggctttggctctggctttggctttggctttggctttggctt 203083 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 203108 tttggctttggctttggctttggctttgg 203080 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 203105 ggctttggctttggctttggctttggctt 203077 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| ||||||||||||||||| |||| Sbjct: 203108 tttggctttggctttggctttggctttggcttaggtt 203072
>ref|XM_606207.2| PREDICTED: Bos taurus hypothetical LOC527805 (LOC527805), partial mRNA Length = 1871 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 515 ggctggggctttggctttggctttgg 540 ||||| |||||||||||||||||||| Sbjct: 493 ggctgtggctttggctttggctttgg 468
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtggcttg 550 |||||||| |||||||||||||| |||||| Sbjct: 3517270 ggctttgggtttggctttggttgcggcttg 3517299 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 487134 tttggcttcggctttggctttggctttgg 487106
>emb|Z81522.1|CEF32B4 Caenorhabditis elegans Cosmid F32B4, complete sequence Length = 41212 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 524 tttggctttggctttggttgtggctt 549 ||||||||||||||||||| |||||| Sbjct: 41212 tttggctttggctttggttttggctt 41187
>gb|AC117227.3| Mus musculus BAC clone RP23-380C5 from 13, complete sequence Length = 190816 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Plus Query: 509 gggtttggctggggctttggctttggcttt 538 |||||||||| |||||||||||||||||| Sbjct: 146565 gggtttggctttggctttggctttggcttt 146594 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 146571 ggctttggctttggctttgg 146590
>emb|BX649606.1| Aspergillus fumigatus BAC pilot project supercontig; segment 2/3 Length = 348551 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Minus Query: 515 ggctggggctttggctttggctttgg 540 |||| ||||||||||||||||||||| Sbjct: 239952 ggcttgggctttggctttggctttgg 239927
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 44.1 bits (22), Expect = 0.57 Identities = 31/34 (91%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttgg 540 |||| ||||||| |||||||||||||||||||| Sbjct: 796344 ttggctttggctttggctttggctttggctttgg 796311 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 2945842 ggctttggctttggctttggctttggctt 2945870 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 796342 ggctttggctttggctttggctttggctt 796314
>emb|BX248356.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment 3/8 Length = 347625 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 142 actcacaccactaatagcgaca 163 |||||||||||||||||||||| Sbjct: 17076 actcacaccactaatagcgaca 17097
>emb|AL022018.1|DMC8D8 Drosophila melanogaster cosmid clone 8D8 Length = 38397 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 524 tttggctttggctttggttgtggctt 549 ||||| |||||||||||||||||||| Sbjct: 17376 tttggttttggctttggttgtggctt 17401
>emb|AJ879120.1| Capsicum chinense mRNA for arachidonic acid-induced DEA1 (dea1 gene) Length = 767 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggtt 542 |||||||||||||||||||||| Sbjct: 175 ggctttggctttggctttggtt 154 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 181 ggctttggctttggctttgg 162
>gb|AC104141.8| Drosophila melanogaster X BAC RP98-9H15 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 181360 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 524 tttggctttggctttggttgtggctt 549 ||||| |||||||||||||||||||| Sbjct: 13767 tttggttttggctttggttgtggctt 13792
>gb|AF312225.1|AF312225 Homo sapiens chromosome 2 map 2q37.1, complete sequence Length = 345102 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Minus Query: 522 gctttggctttggctttggttgtggcttga 551 ||||||||||||||||||| | |||||||| Sbjct: 324946 gctttggctttggctttggctttggcttga 324917 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 324941 ggctttggctttggctttgg 324922
>gb|AC104288.4| Drosophila melanogaster X BAC RP98-30G24 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164252 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 524 tttggctttggctttggttgtggctt 549 ||||| |||||||||||||||||||| Sbjct: 73282 tttggttttggctttggttgtggctt 73307
>gb|AC109506.21| Mus musculus chromosome 7, clone RP23-344G21, complete sequence Length = 227676 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggtt 542 |||||||||||||||||||||| Sbjct: 104215 ggctttggctttggctttggtt 104236 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 104206 tttggttttggctttggctttggctttggttttggtt 104242
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 519 ggggctttggctttggctttgg 540 |||||||||||||||||||||| Sbjct: 30551324 ggggctttggctttggctttgg 30551303 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 62 catactcagatccctacgtacataggtac 90 |||||||| |||||||||||||| ||||| Sbjct: 15979758 catactcatatccctacgtacatcggtac 15979786
>gb|AC068134.5| Homo sapiens BAC clone RP11-762N20 from 2, complete sequence Length = 181068 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Minus Query: 522 gctttggctttggctttggttgtggcttga 551 ||||||||||||||||||| | |||||||| Sbjct: 17845 gctttggctttggctttggctttggcttga 17816 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 17840 ggctttggctttggctttgg 17821
>dbj|AP005750.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0069C14 Length = 150579 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 519 ggggctttggctttggctttgg 540 |||||||||||||||||||||| Sbjct: 49887 ggggctttggctttggctttgg 49866
>gb|AE003420.2| Drosophila melanogaster chromosome X, section 4 of 74 of the complete sequence Length = 308311 Score = 44.1 bits (22), Expect = 0.57 Identities = 25/26 (96%) Strand = Plus / Plus Query: 524 tttggctttggctttggttgtggctt 549 ||||| |||||||||||||||||||| Sbjct: 184602 tttggttttggctttggttgtggctt 184627
>gb|AC096628.14| Mus musculus strain C57BL/6J chromosome 13 clone rp23-81n4, complete sequence Length = 194818 Score = 44.1 bits (22), Expect = 0.57 Identities = 28/30 (93%) Strand = Plus / Minus Query: 509 gggtttggctggggctttggctttggcttt 538 |||||||||| |||||||||||||||||| Sbjct: 93253 gggtttggctttggctttggctttggcttt 93224 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 93247 ggctttggctttggctttgg 93228
>emb|AL606824.13| Mouse DNA sequence from clone RP23-9G13 on chromosome 11, complete sequence Length = 247743 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggtt 542 |||||||||||||||||||||| Sbjct: 100782 ggctttggctttggctttggtt 100761
>gb|AY039003.1| Hordeum vulgare subsp. vulgare Mg-chelatase subunit XANTHA-F (Xantha-f) gene, complete cds Length = 6252 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 520 gggctttggctttggctttgg 540 ||||||||||||||||||||| Sbjct: 176 gggctttggctttggctttgg 156
>gb|AC119863.9| Mus musculus chromosome 3, clone RP23-293A4, complete sequence Length = 179849 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 90186 tttggctttggctttggctttggctttgg 90158
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 4730917 ggctttggctttggctttggctttggctt 4730945 Score = 42.1 bits (21), Expect = 2.2 Identities = 30/33 (90%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggcttt 538 ||||| ||||||| |||||||||||||||||| Sbjct: 4730914 tttggctttggctttggctttggctttggcttt 4730946 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 4730914 tttggctttggctttggctttggctttgg 4730942 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 4730912 gctttggctttggctttggctttggctt 4730939
>ref|XM_367470.1| Magnaporthe grisea 70-15 chromosome III predicted protein (MG07381.4) partial mRNA Length = 852 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 511 gtttggctggggctttggctttggctttg 539 |||||||| ||||||||||||||||||| Sbjct: 318 gtttggcttaggctttggctttggctttg 290 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 522 gctttggctttggctttggttgtggctt 549 |||||||||||||||||| || |||||| Sbjct: 283 gctttggctttggctttgcttttggctt 256
>gb|AC104275.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1212_C10, complete sequence Length = 138209 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 83473 tttggctttggctctggctttggctttggttttggtt 83509 Score = 40.1 bits (20), Expect = 8.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 463 tggtcctggctgtggtttaggctccggctttg 494 |||| |||| |||||||| ||||||||||||| Sbjct: 58467 tggttctgggtgtggtttgggctccggctttg 58498
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 1610524 ggctttggctttggctttggctttggctt 1610552
>ref|XM_705136.1| Candida albicans SC5314 putative exocyst component Sec5p (CaO19.7726), mRNA Length = 1410 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 963 tttggctttggctttggctttggctttgg 935
>ref|XM_705131.1| Candida albicans SC5314 putative exocyst component Sec5p (CaO19.75), mRNA Length = 1410 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 963 tttggctttggctttggctttggctttgg 935
>gb|AF025466.1| Caenorhabditis elegans cosmid T23F4, complete sequence Length = 25851 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 25122 ggctttggctttggctttggatttggctt 25150
>ref|XM_756442.1| Ustilago maydis 521 hypothetical protein (UM05388.1) partial mRNA Length = 2568 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 249 tttggctttggctttggctttggctttgg 221
>emb|AL117207.1|CEY60A3A Caenorhabditis elegans YAC Y60A3A, complete sequence Length = 122592 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 114492 ggctttggctttggctttggctttggctt 114464 Score = 40.1 bits (20), Expect = 8.9 Identities = 38/44 (86%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| ||||||||||| ||| | ||||||||||| Sbjct: 114489 tttggctttggctttggctttggcttaggcgtaggttgtggctt 114446
>gb|AY450356.1| Cucumis sativus ACC oxidase gene, promoter region and complete cds Length = 2229 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 490 ggctttggctttggctttggctttggctt 462
>emb|AL022158.1|HS326I13 Human DNA sequence from clone RP3-326I13 on chromosome Xp11.23-11.3 Contains a novel gene, complete sequence Length = 108248 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 90441 tttggctttggctttggctttggctttgg 90469
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence Length = 4744671 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggt 541 ||||||||||||||||||||| Sbjct: 2681321 ggctttggctttggctttggt 2681301
>emb|AL589766.17| Mouse DNA sequence from clone RP23-19G4 on chromosome 13 contains the Vmp gene for vesicular membrane protein P24, complete sequence Length = 176183 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 524 tttggctttggctttggttgtggcttgac 552 ||||| |||| |||||||||||||||||| Sbjct: 16741 tttgggtttgcctttggttgtggcttgac 16769
>emb|BX942837.5| Zebrafish DNA sequence from clone CH211-224B23 in linkage group 5, complete sequence Length = 183605 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 523 ctttggctttggctttggttg 543 ||||||||||||||||||||| Sbjct: 91636 ctttggctttggctttggttg 91656
>gb|AC104610.13| Drosophila melanogaster 3L BAC RP98-35J16 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 138534 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 518 tggggctttggctttggcttt 538 ||||||||||||||||||||| Sbjct: 1805 tggggctttggctttggcttt 1825
>gb|AC023728.5| Drosophila melanogaster X BAC RP98-6J12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 175674 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 518 tggggctttggctttggcttt 538 ||||||||||||||||||||| Sbjct: 167824 tggggctttggctttggcttt 167844
>gb|AE012404.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 312 of 460 of the complete genome Length = 14793 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 1631 tttggctttggctttggctttggctttgg 1659 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 1628 ggctttggctttggctttggctttggctt 1656
>ref|NM_142062.1| Drosophila melanogaster CG14363-RA (CG14363), mRNA Length = 2978 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 522 gctttggctttggctttggtt 542 ||||||||||||||||||||| Sbjct: 505 gctttggctttggctttggtt 485
>gb|U33548.2|XCU33548 Xanthomonas campestris pv. vesicatoria hrp gene cluster, partial sequence Length = 16929 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 9546 tttggcttcggctttggctttggctttgg 9518
>gb|AY224438.1| Oryza sativa (japonica cultivar-group) isolate 23221 proline-rich protein mRNA, complete cds Length = 1251 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Minus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 698 tttggctttggctctggctttggctttggttttggtt 662
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggctt 549 |||||||||||||||||||| | |||||| Sbjct: 1472959 ggctttggctttggctttggctttggctt 1472931 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 1472956 tttggctttggctttggctttggctttgg 1472928 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 4342266 ggctttggctttggctttgg 4342285 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 4342260 ggctttggctttggctttgg 4342279
>gb|AC092233.1|AC092233 Drosophila melanogaster, chromosome 2L, region 30F-31B, BAC clone BACR29P12, complete sequence Length = 161446 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 522 gctttggctttggctttggtt 542 ||||||||||||||||||||| Sbjct: 86048 gctttggctttggctttggtt 86068
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 2.2 Identities = 33/37 (89%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggtt 542 ||||| ||||||| |||||||||||||| ||||||| Sbjct: 7647078 tttggctttggctctggctttggctttggttttggtt 7647114 Score = 40.1 bits (20), Expect = 8.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 463 tggtcctggctgtggtttaggctccggctttg 494 |||| |||| |||||||| ||||||||||||| Sbjct: 7622072 tggttctgggtgtggtttgggctccggctttg 7622103
>gb|AC007760.6|AC007760 Drosophila melanogaster, chromosome 3R, region 89B-89B, BAC clone BACR37I18, complete sequence Length = 195037 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 520 gggctttggctttggctttgg 540 ||||||||||||||||||||| Sbjct: 137968 gggctttggctttggctttgg 137948
>gb|AC007647.6|AC007647 Drosophila melanogaster, chromosome 3R, region 89B-89C, BAC clone BACR05P04, complete sequence Length = 194335 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 520 gggctttggctttggctttgg 540 ||||||||||||||||||||| Sbjct: 47931 gggctttggctttggctttgg 47911
>gb|AC007650.7|AC007650 Drosophila melanogaster, chromosome 3R, region 87F-87F, BAC clone BACR30G22, complete sequence Length = 167912 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 522 gctttggctttggctttggtt 542 ||||||||||||||||||||| Sbjct: 115788 gctttggctttggctttggtt 115808
>gb|AC007854.4|AC007854 Drosophila melanogaster, chromosome 3R, region 98F-98F, BAC clone BACR13H19, complete sequence Length = 155666 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 143589 tttggctctggctttggctttggctttgg 143617
>gb|AC007947.5|AC007947 Drosophila melanogaster, chromosome 3R, region 98F-98F, BAC clone BACR11O03, complete sequence Length = 168505 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 28654 tttggctctggctttggctttggctttgg 28682
>gb|AC009975.9| Homo sapiens BAC clone RP11-460M2 from 2, complete sequence Length = 211305 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 133 cactttacaactcacaccact 153 ||||||||||||||||||||| Sbjct: 162887 cactttacaactcacaccact 162867
>dbj|BA000031.2| Vibrio parahaemolyticus RIMD 2210633 DNA, chromosome 1, complete sequence Length = 3288558 Score = 42.1 bits (21), Expect = 2.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 521 ggctttggctttggctttggttgtg 545 |||||||||||||||||||| |||| Sbjct: 1057814 ggctttggctttggctttggctgtg 1057838 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 1057808 ggctttggctttggctttgg 1057827
>dbj|AP003512.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0618D11 Length = 150103 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 62 catactcagatccctacgtacataggtac 90 |||||||| |||||||||||||| ||||| Sbjct: 8487 catactcatatccctacgtacatcggtac 8515
>dbj|AP004735.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0031P18 Length = 156535 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 62 catactcagatccctacgtacataggtac 90 |||||||| |||||||||||||| ||||| Sbjct: 113207 catactcatatccctacgtacatcggtac 113235
>gb|AF227213.1|AF227213 Drosophila melanogaster isoform (tara) gene, complete cds, alternatively spliced Length = 36887 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 520 gggctttggctttggctttgg 540 ||||||||||||||||||||| Sbjct: 29073 gggctttggctttggctttgg 29053
>emb|AL442163.5|CNS07ECT Human chromosome 14 DNA sequence BAC R-90P16 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 167642 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 499 agtggggtttgggtttggctg 519 ||||||||||||||||||||| Sbjct: 147128 agtggggtttgggtttggctg 147148
>gb|AE003712.1| Drosophila melanogaster chromosome 3R, section 50 of 118 of the complete sequence Length = 226200 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 520 gggctttggctttggctttgg 540 ||||||||||||||||||||| Sbjct: 137380 gggctttggctttggctttgg 137360
>gb|AE003701.2| Drosophila melanogaster chromosome 3R, section 39 of 118 of the complete sequence Length = 208368 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 522 gctttggctttggctttggtt 542 ||||||||||||||||||||| Sbjct: 189931 gctttggctttggctttggtt 189951
>gb|AE003627.4| Drosophila melanogaster chromosome 2L, section 36 of 83 of the complete sequence Length = 264225 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 522 gctttggctttggctttggtt 542 ||||||||||||||||||||| Sbjct: 162320 gctttggctttggctttggtt 162300
>gb|AE003767.2| Drosophila melanogaster chromosome 3R, section 105 of 118 of the complete sequence Length = 231562 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 190859 tttggctctggctttggctttggctttgg 190887
>gb|AE003440.3| Drosophila melanogaster chromosome X, section 24 of 74 of the complete sequence Length = 342195 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 518 tggggctttggctttggcttt 538 ||||||||||||||||||||| Sbjct: 33192 tggggctttggctttggcttt 33212
>gb|AC005734.1|AC005734 Drosophila melanogaster DNA sequence (P1s DS00058 (D296), DS02068 (D297), and DS07249 (D318)), complete sequence Length = 155335 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 522 gctttggctttggctttggtt 542 ||||||||||||||||||||| Sbjct: 100613 gctttggctttggctttggtt 100593
>emb|AL772376.6| Mouse DNA sequence from clone RP23-30F6 on chromosome 4, complete sequence Length = 237323 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggt 541 ||||||||||||||||||||| Sbjct: 199346 ggctttggctttggctttggt 199326
>gb|AE009442.1| Xylella fastidiosa Temecula1, complete genome Length = 2519802 Score = 42.1 bits (21), Expect = 2.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 512 tttggctggggctttggctttggctttgg 540 ||||||| |||||||||||||||||||| Sbjct: 2078458 tttggctttggctttggctttggctttgg 2078486 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 2078456 gctttggctttggctttggctttggctt 2078483
>gb|U26916.1|HVU26916 Hordeum vulgare protoporphyrin IX Mg-chelatase subunit precursor (Xantha-f) gene, complete cds Length = 6364 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 520 gggctttggctttggctttgg 540 ||||||||||||||||||||| Sbjct: 197 gggctttggctttggctttgg 177 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 190 ggctttggctttggctttgg 171
>emb|AL389914.3|CNS06C7J Human chromosome 14 DNA sequence BAC C-2307P3 of library CalTech-D from chromosome 14 of Homo sapiens (Human), complete sequence Length = 97160 Score = 42.1 bits (21), Expect = 2.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 499 agtggggtttgggtttggctg 519 ||||||||||||||||||||| Sbjct: 95922 agtggggtttgggtttggctg 95902
>gb|AC022346.4| Drosophila melanogaster clone BACR22I24, complete sequence Length = 181052 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 522 gctttggctttggctttggt 541 |||||||||||||||||||| Sbjct: 72241 gctttggctttggctttggt 72260
>ref|XM_527493.1| PREDICTED: Pan troglodytes similar to hypothetical protein FLJ30899 (LOC472114), mRNA Length = 4326 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 679 ggctttggctttggctttgg 698
>gb|AC161375.4| Mus musculus BAC clone RP23-297A22 from chromosome 14, complete sequence Length = 211662 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 111572 ggctttggctttggctttgg 111553
>gb|AF003385.2| Caenorhabditis elegans cosmid R08F11, complete sequence Length = 32838 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 28084 ggctttggctttggctttgg 28103
>gb|AC007589.8| Drosophila melanogaster clone BACR20D10, complete sequence Length = 164712 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 38677 ggctttggctttggctttgg 38658
>gb|AC011761.15| Drosophila melanogaster clone BACH50G05, complete sequence Length = 108727 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 80706 ggctttggctttggctttgg 80687
>gb|AC012376.12| Drosophila melanogaster clone BACR48C12, complete sequence Length = 183048 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 173129 ggctttggctttggctttgg 173110
>ref|XM_323925.1| Neurospora crassa OR74A predicted protein (NCU04570.1) partial mRNA Length = 3291 Score = 40.1 bits (20), Expect = 8.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttggtt 542 |||| ||||||| ||||||||| |||||||||||| Sbjct: 2811 ttggttttggctttggctttggccttggctttggtt 2776
>ref|XM_416511.1| PREDICTED: Gallus gallus similar to protein A isoform 2; protein A (LOC418288), mRNA Length = 1962 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 457 cttggatggtcctggctgtg 476 |||||||||||||||||||| Sbjct: 878 cttggatggtcctggctgtg 897
>ref|XM_953576.1| Neurospora crassa OR74A hypothetical protein (NCU04570.1) partial mRNA Length = 3291 Score = 40.1 bits (20), Expect = 8.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttggtt 542 |||| ||||||| ||||||||| |||||||||||| Sbjct: 2811 ttggttttggctttggctttggccttggctttggtt 2776
>gb|CP000058.1| Pseudomonas syringae pv. phaseolicola 1448A, complete genome Length = 5928787 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 2286158 ggctttggctttggctttgg 2286177
>emb|Z83237.1|CER06B9 Caenorhabditis elegans Cosmid R06B9, complete sequence Length = 33014 Score = 40.1 bits (20), Expect = 8.9 Identities = 29/32 (90%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctt 537 ||||| ||||||| ||||||||||||||||| Sbjct: 6071 tttggctttggctatggctttggctttggctt 6102
>ref|XM_810900.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053506821.200) partial mRNA Length = 2046 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 598 ggctttggctttggctttgg 617 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 502 ggctttggctttggctttgg 521
>emb|Z93782.1|CER12G8 Caenorhabditis elegans Cosmid R12G8, complete sequence Length = 16769 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 4616 ggctttggctttggctttgg 4635
>gb|AC122847.4| Mus musculus BAC clone RP23-163F2 from 6, complete sequence Length = 193343 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 81206 ggctttggctttggctttgg 81187
>ref|XM_536660.2| PREDICTED: Canis familiaris similar to myosin XV (LOC479522), mRNA Length = 10128 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 6860 ggctttggctttggctttgg 6841
>ref|XM_660219.1| Cryptosporidium hominis TU502 erythrocyte membrane protein PFEMP3 (Chro.80552) partial mRNA Length = 1365 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 175 ggctttggctttggctttgg 156 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 512 tttggctggggctttggctttggctttg 539 ||||||| ||||||||||||||||||| Sbjct: 178 tttggctttggctttggctttggctttg 151
>gb|AC006651.2| Caenorhabditis elegans fosmid H06I04, complete sequence Length = 47880 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 3659 ggctttggctttggctttgg 3640
>gb|AC164642.3| Mus musculus BAC clone RP23-248L4 from chromosome 6, complete sequence Length = 212166 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 179047 ggctttggctttggctttgg 179066
>emb|CR936845.11| Mouse DNA sequence from clone DN-279H6 on chromosome 11, complete sequence Length = 101662 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 56438 ggctttggctttggctttgg 56457 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 26025 ggctttggctttggctttgg 26006
>emb|AL583843.5| Human DNA sequence from clone RP11-492I2 on chromosome 1 Contains the 5' end of the ELAVL4 gene for ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 ((Hu antigen D) and a novel pseudogene, complete sequence Length = 62263 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 26009 ggctttggctttggctttgg 26028
>gb|CP000271.1| Burkholderia xenovorans LB400 chromosome 2, complete sequence Length = 3363523 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 2283565 ggctttggctttggctttgg 2283546
>emb|AL139098.15| Human DNA sequence from clone RP1-276J11 on chromosome 6 Contains the 5' end of the gene for a novel protein, a ribosomal protein S15 (RPS15) pseudogene, a putative novel gene and the GJA1 gene for gap junction protein, alpha 1, 43 kD (connexin 43) (CX43). Contains a CpG island, complete sequence Length = 131501 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 74821 ggctttggctttggctttgg 74802
>gb|AC164636.4| Mus musculus BAC clone RP23-70P16 from chromosome 6, complete sequence Length = 212096 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 183607 ggctttggctttggctttgg 183588
>emb|AL049563.4|HS68D15 Human DNA sequence from clone RP1-68D15 on chromosome X Contains the 3' end of a novel gene (FLJ23018) and the 3' end of the TRPC5 gene for transient receptor potential cation channel subfamily C member 5, complete sequence Length = 113028 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 38601 ggctttggctttggctttgg 38620
>emb|X95551.1|CMACO1 C.melo ACC oxidase gene (clone CM-ACO1) Length = 2366 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 527 ggctttggctttggctttgg 508
>gb|AE008843.1| Salmonella typhimurium LT2, section 147 of 220 of the complete genome Length = 20335 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 24 cacacatgattaggaagcataaat 47 |||||||||||||| ||||||||| Sbjct: 15815 cacacatgattaggtagcataaat 15792
>emb|BX294012.1|NC80A10 Neurospora crassa DNA linkage group V Cosmid contig 80A10 Length = 161126 Score = 40.1 bits (20), Expect = 8.9 Identities = 32/36 (88%) Strand = Plus / Plus Query: 507 ttgggtttggctggggctttggctttggctttggtt 542 |||| ||||||| ||||||||| |||||||||||| Sbjct: 33686 ttggttttggctttggctttggccttggctttggtt 33721
>emb|AL596136.5| Mouse DNA sequence from clone RP23-83I13 on chromosome 11 Contains the Rabep1 gene for rabaptin, RAB GTPase binding effector protein 1, a ribosomal protein 23a (Rpl23a) pseudogene, a ribosomal protein 23A (Rpl23a) pseudogene, the Nup88 gene for nucleoporin 88, four novel genes, the C1qbp gene for complement component 1 q subcomponent binding protein, the Dhx33 gene for DEAH (Asp-Glu-Ala-His) box polypeptide 33, a novel pseudogene, a CARD domain pseudogene and six CpG islands, complete sequence Length = 254116 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 68893 ggctttggctttggctttgg 68912 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 38701 ggctttggctttggctttgg 38682
>emb|AL627277.1| Salmonella enterica serovar Typhi (Salmonella typhi) strain CT18, complete chromosome; segment 13/20 Length = 230050 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 24 cacacatgattaggaagcataaat 47 |||||||||||||| ||||||||| Sbjct: 164250 cacacatgattaggtagcataaat 164227
>gb|AC154763.2| Mus musculus BAC clone RP24-422J16 from chromosome 16, complete sequence Length = 156818 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 130427 ggctttggctttggctttgg 130408
>gb|AF367444.1| Prunus persica clone Cs1 citrate synthase (cs1) mRNA, complete cds; nuclear gene for mitochondrial product Length = 1873 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 9 ggctttggctttggctttgg 28
>gb|AC010052.7| Drosophila melanogaster 3L BAC RP98-5G1 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 164941 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 19047 ggctttggctttggctttgg 19028
>gb|AC091206.3| Drosophila melanogaster 3L BAC RP98-19M9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 178019 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 148084 ggctttggctttggctttgg 148065
>gb|AC023716.4| Drosophila melanogaster X BAC RP98-45E21 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 169124 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 106600 ggctttggctttggctttgg 106619
>gb|AC023694.4| Drosophila melanogaster X BAC RP98-18B11 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170301 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 148775 ggctttggctttggctttgg 148794
>tpg|BK002939.1| TPA: TPA_inf: Drosophila melanogaster HDC16608 (HDC16608) gene, complete cds Length = 5076 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 311 ggctttggctttggctttgg 330 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 306 gctttggctttggctttggctttggctt 333
>tpg|BK001808.1| TPA: TPA_inf: Drosophila melanogaster HDC07442 (HDC07442) gene, complete cds Length = 189 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 27 ggctttggctttggctttgg 46 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 21 ggctttggctttggctttgg 40
>tpg|BK003220.1| TPA: TPA_inf: Drosophila melanogaster HDC19720 (HDC19720) gene, complete cds Length = 3420 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 2411 ggctttggctttggctttgg 2392
>gb|AE012155.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 63 of 460 of the complete genome Length = 11425 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 7965 ggctttggctttggctttgg 7946 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 7959 ggctttggctttggctttgg 7940
>gb|AC104515.1| Drosophila melanogaster, chromosome X, region 20B-20C, BAC clone BACR27K09, complete sequence Length = 179386 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 524 tttggctttggctttggttg 543 |||||||||||||||||||| Sbjct: 7348 tttggctttggctttggttg 7367
>gb|AE003849.1| Xylella fastidiosa 9a5c, complete genome Length = 2679306 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 1544709 ggctttggctttggctttgg 1544728
>gb|AC099023.1| Drosophila melanogaster, chromosome 2R, region 56X-57A, BAC clone BACR48L22, complete sequence Length = 180814 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 145791 ggctttggctttggctttgg 145772 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 145785 ggctttggctttggctttgg 145766
>gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56F-57X, BAC clone BACR23F24, complete sequence Length = 183592 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 120306 ggctttggctttggctttgg 120325 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 120300 ggctttggctttggctttgg 120319
>gb|AC009202.7| Drosophila melanogaster, chromosome 2L, region 36D-36D, BAC clone BACR06C11, complete sequence Length = 174500 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 162362 ggctttggctttggctttgg 162343
>gb|AC157924.6| Mus musculus chromosome 1, clone RP23-18J18, complete sequence Length = 206156 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 156709 ggctttggctttggctttgg 156690
>gb|AC009212.5| Drosophila melanogaster, chromosome 3R, region 82E-82F, BAC clone BACR01A18, complete sequence Length = 190801 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 5461 ggctttggctttggctttgg 5442
>emb|CR387762.1| Gallus gallus finished cDNA, clone ChEST533l5 Length = 993 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 457 cttggatggtcctggctgtg 476 |||||||||||||||||||| Sbjct: 510 cttggatggtcctggctgtg 529
>gb|AC161588.2| Mus musculus BAC clone RP24-447G12 from chromosome 13, complete sequence Length = 211917 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 204052 ggctttggctttggctttgg 204071
>gb|AC093048.1| Drosophila melanogaster, chromosome 2L, region 36D-36E, BAC clone BACR39D12, complete sequence Length = 184021 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 25733 ggctttggctttggctttgg 25752
>gb|AC011071.12|AC011071 Drosophila melanogaster, chromosome X, region 18C-18D, BAC clone BACR27L16, complete sequence Length = 182623 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 34083 ggctttggctttggctttgg 34064
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 35620219 ggctttggctttggctttgg 35620200
>gb|AC008310.5|AC008310 Drosophila melanogaster, chromosome 3R, region 100C-100D, BAC clone BACR16C04, complete sequence Length = 159528 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 121442 ggctttggctttggctttgg 121461 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 121437 gctttggctttggctttggctttggctt 121464
>gb|AC011069.7|AC011069 Drosophila melanogaster, chromosome X, region 12B-12C, BAC clone BACR11H20, complete sequence Length = 168384 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 149771 ggctttggctttggctttgg 149790
>gb|AC009850.10|AC009850 Drosophila melanogaster, chromosome 2R, region 55E-55F, BAC clone BACR27L09, complete sequence Length = 173059 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggct 548 |||||||||||||||||| | ||||||| Sbjct: 101027 ggctttggctttggctttagctgtggct 101000
>gb|AC007469.7|AC007469 Drosophila melanogaster, chromosome 3R, region 100D1-100F2, BAC clone BACR48C22, complete sequence Length = 181446 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 71077 ggctttggctttggctttgg 71096 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 71072 gctttggctttggctttggctttggctt 71099
>gb|AC007723.5|AC007723 Drosophila melanogaster, chromosome 3R, region 87F-87F, BAC clone BACR01E10, complete sequence Length = 160972 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 104065 ggctttggctttggctttgg 104046
>gb|AC007770.5|AC007770 Drosophila melanogaster, chromosome 3R, region 86C-86C, BAC clone BACR03J13, complete sequence Length = 179260 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 516 gctggggctttggctttggctttg 539 |||| ||||||||||||||||||| Sbjct: 58114 gctgtggctttggctttggctttg 58091
>gb|AC092170.3| Homo sapiens BAC clone RP11-814G20 from 2, complete sequence Length = 25215 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 167 ctgattattccatggatggatacc 190 ||||||| |||||||||||||||| Sbjct: 11910 ctgattagtccatggatggatacc 11887
>gb|AC155263.2| Mus musculus BAC clone RP23-415I11 from chromosome 13, complete sequence Length = 202801 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 168055 ggctttggctttggctttgg 168036
>gb|AC023271.11| Homo sapiens BAC clone RP11-96E8 from 2, complete sequence Length = 106499 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 61681 ggctttggctttggctttgg 61700
>ref|XM_224270.3| PREDICTED: Rattus norvegicus similar to putative E1-E2 ATPase (LOC290295), mRNA Length = 10695 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 8217 ggctttggctttggctttgg 8198
>gb|AY190945.1| Drosophila pseudoobscura clone DPSF01_10_G08 (D1416) genomic sequence Length = 38050 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 26394 ggctttggctttggctttgg 26375
>gb|AC126684.4| Mus musculus BAC clone RP23-68L2 from chromosome 14, complete sequence Length = 233755 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 230820 ggctttggctttggctttgg 230801
>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 Length = 4585229 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 24 cacacatgattaggaagcataaat 47 |||||||||||||| ||||||||| Sbjct: 3093225 cacacatgattaggtagcataaat 3093202
>dbj|AP004366.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0460C04 Length = 189043 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 23556 ggctttggctttggctttgg 23537
>dbj|BA000019.2| Nostoc sp. PCC 7120 DNA, complete genome Length = 6413771 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 359 tttggtgttggcttgggggtcggtttgg 386 ||||||||||| ||||| |||||||||| Sbjct: 1353470 tttggtgttggtttgggtgtcggtttgg 1353443
>emb|BX294175.5| Zebrafish DNA sequence from clone DKEY-281I8 in linkage group 1, complete sequence Length = 165355 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 12524 ggctttggctttggctttgg 12543
>dbj|BS000214.2| Pan troglodytes chromosome 22 clone:RP43-036K01, map 22, complete sequences Length = 115787 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 525 ttggctttggctttggttgt 544 |||||||||||||||||||| Sbjct: 13457 ttggctttggctttggttgt 13476
>dbj|BS000213.2| Pan troglodytes chromosome 22 clone:PTB-042D04, map 22, complete sequences Length = 172879 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 525 ttggctttggctttggttgt 544 |||||||||||||||||||| Sbjct: 171957 ttggctttggctttggttgt 171976
>emb|AL929140.16| Mouse DNA sequence from clone RP23-188A4 on chromosome 2, complete sequence Length = 120665 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 catccatgctccacgagcca 254 |||||||||||||||||||| Sbjct: 21272 catccatgctccacgagcca 21253
>emb|AL845336.9| Mouse DNA sequence from clone RP23-391P24 on chromosome 2, complete sequence Length = 176778 Score = 40.1 bits (20), Expect = 8.9 Identities = 38/44 (86%) Strand = Plus / Plus Query: 506 tttgggtttggctggggctttggctttggctttggttgtggctt 549 ||||| ||||||| || ||||||||||| ||||||| |||||| Sbjct: 139881 tttggttttggctttggttttggctttggttttggttttggctt 139924
>emb|Y17332.1|ZMPROPR Zea mays mRNA for proline-rich protein Length = 1471 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggct 548 ||||| |||| ||||||||||||||||| Sbjct: 1073 ggcttaggctctggctttggttgtggct 1046 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggct 548 ||||| |||| ||||||||||||||||| Sbjct: 905 ggcttaggctctggctttggttgtggct 878
>emb|AJ130830.1|ZMA130830 Zea mays gene encoding putative cell wall protein Length = 1792 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggct 548 ||||| |||| ||||||||||||||||| Sbjct: 1053 ggcttaggctctggctttggttgtggct 1026 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggct 548 ||||| |||| ||||||||||||||||| Sbjct: 885 ggcttaggctctggctttggttgtggct 858
>dbj|AK100217.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023045I16, full insert sequence Length = 1510 Score = 40.1 bits (20), Expect = 8.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 463 tggtcctggctgtggtttaggctccggctttg 494 |||| |||| |||||||| ||||||||||||| Sbjct: 712 tggttctgggtgtggtttgggctccggctttg 681
>gb|AC011662.1|AC011662 Drosophila melanogaster, chromosome 2L, region 36D-, BAC clones BACR01G10 and BACR05I08, complete sequence Length = 294942 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 287463 ggctttggctttggctttgg 287482 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 30347 ggctttggctttggctttgg 30328
>gb|AF337054.1| Oryza sativa repetitive proline rich protein mRNA, complete cds Length = 1493 Score = 40.1 bits (20), Expect = 8.9 Identities = 29/32 (90%) Strand = Plus / Minus Query: 463 tggtcctggctgtggtttaggctccggctttg 494 |||| |||| |||||||| ||||||||||||| Sbjct: 681 tggttctgggtgtggtttgggctccggctttg 650
>gb|AC107869.15| Mus musculus chromosome 1, clone RP23-418L6, complete sequence Length = 182061 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 176062 ggctttggctttggctttgg 176043
>gb|AY109530.1| Zea mays CL1228_1 mRNA sequence Length = 1471 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggct 548 ||||| |||| ||||||||||||||||| Sbjct: 1073 ggcttaggctctggctttggttgtggct 1046
>gb|AE014299.1| Shewanella oneidensis MR-1, complete genome Length = 4969803 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 3572831 ggctttggctttggctttgg 3572850 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 3572825 ggctttggctttggctttgg 3572844
>gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi Ty2, complete genome Length = 4791961 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 24 cacacatgattaggaagcataaat 47 |||||||||||||| ||||||||| Sbjct: 3125745 cacacatgattaggtagcataaat 3125722
>gb|AE003700.3| Drosophila melanogaster chromosome 3R, section 38 of 118 of the complete sequence Length = 228324 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 191139 ggctttggctttggctttgg 191120
>gb|AE003687.3| Drosophila melanogaster chromosome 3R, section 25 of 118 of the complete sequence Length = 260168 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 516 gctggggctttggctttggctttg 539 |||| ||||||||||||||||||| Sbjct: 111290 gctgtggctttggctttggctttg 111267
>gb|AE003657.3| Drosophila melanogaster chromosome 2L, section 66 of 83 of the complete sequence Length = 265254 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 198845 ggctttggctttggctttgg 198864
>gb|AE003656.2| Drosophila melanogaster chromosome 2L, section 65 of 83 of the complete sequence Length = 251192 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 192859 ggctttggctttggctttgg 192840
>gb|AE003799.4| Drosophila melanogaster chromosome 2R, section 51 of 73 of the complete sequence Length = 316981 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Minus Query: 521 ggctttggctttggctttggttgtggct 548 |||||||||||||||||| | ||||||| Sbjct: 253381 ggctttggctttggctttagctgtggct 253354
>gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57 of 73 of the complete sequence Length = 271902 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 214567 ggctttggctttggctttgg 214586 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 214561 ggctttggctttggctttgg 214580
>gb|AE003779.2| Drosophila melanogaster chromosome 3R, section 117 of 118 of the complete sequence Length = 232050 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 110349 ggctttggctttggctttgg 110368 Score = 40.1 bits (20), Expect = 8.9 Identities = 26/28 (92%) Strand = Plus / Plus Query: 522 gctttggctttggctttggttgtggctt 549 ||||||||||||||||||| | |||||| Sbjct: 110344 gctttggctttggctttggctttggctt 110371
>gb|AE003574.6| Drosophila melanogaster chromosome X, section 73 of 74 of the complete sequence Length = 273468 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 524 tttggctttggctttggttg 543 |||||||||||||||||||| Sbjct: 171784 tttggctttggctttggttg 171765
>gb|AE003570.4| Drosophila melanogaster chromosome X, section 69 of 74 of the complete sequence Length = 300051 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 24272 ggctttggctttggctttgg 24291
>gb|AE003549.4| Drosophila melanogaster chromosome 3L, section 36 of 83 of the complete sequence Length = 295143 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 251124 ggctttggctttggctttgg 251105
>gb|AE003512.3| Drosophila melanogaster chromosome X, section 64 of 74 of the complete sequence Length = 346474 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 78329 ggctttggctttggctttgg 78310
>gb|AE003496.4| Drosophila melanogaster chromosome X, section 48 of 74 of the complete sequence Length = 299868 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 522 gctttggctttggctttggt 541 |||||||||||||||||||| Sbjct: 135668 gctttggctttggctttggt 135649
>gb|AE003493.3| Drosophila melanogaster chromosome X, section 45 of 74 of the complete sequence Length = 307761 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 264291 ggctttggctttggctttgg 264310
>gb|AE003477.3| Drosophila melanogaster chromosome 3L, section 11 of 83 of the complete sequence Length = 297894 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 187190 ggctttggctttggctttgg 187209
>gb|AE003450.4| Drosophila melanogaster chromosome X, section 34 of 74 of the complete sequence Length = 232514 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 31461 ggctttggctttggctttgg 31480
>gb|AE003604.4| Drosophila melanogaster chromosome 3R, section 4 of 118 of the complete sequence Length = 303434 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 133658 ggctttggctttggctttgg 133639
>gb|AE017220.1| Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67, complete genome Length = 4755700 Score = 40.1 bits (20), Expect = 8.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 24 cacacatgattaggaagcataaat 47 |||||||||||||| ||||||||| Sbjct: 3243887 cacacatgattaggtagcataaat 3243864
>dbj|AP001698.1| Homo sapiens genomic DNA, chromosome 21q, section 42/105 Length = 340000 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 525 ttggctttggctttggttgt 544 |||||||||||||||||||| Sbjct: 159629 ttggctttggctttggttgt 159648
>gb|AY509122.1| Lycopersicon esculentum arachidonic acid-induced DEA1 (Dea1) mRNA, complete cds Length = 729 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 174 ggctttggctttggctttgg 155 Score = 40.1 bits (20), Expect = 8.9 Identities = 32/36 (88%) Strand = Plus / Minus Query: 507 ttgggtttggctggggctttggctttggctttggtt 542 |||| ||||||| ||||||||||| |||||||||| Sbjct: 176 ttggctttggctttggctttggcttcggctttggtt 141
>gb|AC076974.33| Mus musculus strain C57BL/6J chromosome 8 clone rp23-267j18, complete sequence Length = 211075 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 47052 ggctttggctttggctttgg 47033
>gb|AC005444.1|AC005444 Drosophila melanogaster, chromosome 2R, region 36D3-36D3, P1 clone DS06379, complete sequence Length = 77685 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 26142 ggctttggctttggctttgg 26161
>gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s DS01995 (D179), DS03499 (D217), and DS08132 (D174)), complete sequence Length = 173970 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 126680 ggctttggctttggctttgg 126699 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 126674 ggctttggctttggctttgg 126693
>emb|AL806510.12| Mouse DNA sequence from clone RP23-155P8 on chromosome 4, complete sequence Length = 95087 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 18590 ggctttggctttggctttgg 18609
>gb|AC171735.1| Lycopersicon esculentum chromosome 11 clone C11HBa0119D16, complete sequence Length = 125830 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 84267 ggctttggctttggctttgg 84286 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 521 ggctttggctttggctttgg 540 |||||||||||||||||||| Sbjct: 84261 ggctttggctttggctttgg 84280
>emb|AL805923.6| Mouse DNA sequence from clone RP23-65B16 on chromosome 4, complete sequence Length = 182774 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 508 tgggtttggctggggctttg 527 |||||||||||||||||||| Sbjct: 168272 tgggtttggctggggctttg 168253
>emb|AL929066.7| Mouse DNA sequence from clone RP23-68E1 on chromosome 2, complete sequence Length = 210907 Score = 40.1 bits (20), Expect = 8.9 Identities = 35/40 (87%) Strand = Plus / Plus Query: 503 gggtttgggtttggctggggctttggctttggctttggtt 542 |||||||||||||||| || ||||| ||||| ||||||| Sbjct: 13968 gggtttgggtttggctttggttttggttttggttttggtt 14007
>emb|X04877.1|PPTEL04 Paramecium primaurelia macronuclear DNA telomeric region (EBGK2) Length = 276 Score = 40.1 bits (20), Expect = 8.9 Identities = 35/40 (87%) Strand = Plus / Minus Query: 501 tggggtttgggtttggctggggctttggctttggctttgg 540 |||||||||||||||| | ||| ||||| ||||| ||||| Sbjct: 224 tggggtttgggtttgggttggggtttgggtttgggtttgg 185
>emb|X04873.1|PPTEL03 Paramecium primaurelia macronuclear DNA telomeric region (EBGJ3) Length = 502 Score = 40.1 bits (20), Expect = 8.9 Identities = 35/40 (87%) Strand = Plus / Minus Query: 501 tggggtttgggtttggctggggctttggctttggctttgg 540 |||||||||||||||| | ||| ||||| ||||| ||||| Sbjct: 369 tggggtttgggtttgggttggggtttgggtttgggtttgg 330
>dbj|AP001602.1| Homo sapiens genomic DNA, chromosome 21, clone:KB1672F4, APP-D21S292 region, complete sequence Length = 21319 Score = 40.1 bits (20), Expect = 8.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 525 ttggctttggctttggttgt 544 |||||||||||||||||||| Sbjct: 5342 ttggctttggctttggttgt 5361 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,023,174 Number of Sequences: 3902068 Number of extensions: 4023174 Number of successful extensions: 77265 Number of sequences better than 10.0: 214 Number of HSP's better than 10.0 without gapping: 215 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 75335 Number of HSP's gapped (non-prelim): 1717 length of query: 649 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 626 effective length of database: 17,143,297,704 effective search space: 10731704362704 effective search space used: 10731704362704 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
