ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah63d17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, com... 42 1.6
2gb|AC012352.7| Homo sapiens BAC clone RP11-12M21 from 2, complet... 42 1.6
3gb|AC009227.3|AC009227 Homo sapiens BAC clone RP11-187G20 from 2... 42 1.6
4gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, com... 42 1.6
5gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, co... 42 1.6
6dbj|AB011667.1| Ipomoea purpurea genes for dihydroflavonol 4-red... 42 1.6
7emb|AL671871.4| Mouse DNA sequence from clone RP23-157M14 on chr... 42 1.6
8ref|NM_106003.2| Arabidopsis thaliana calcium ion binding AT1G73... 40 6.5
9ref|XM_630965.1| Dictyostelium discoideum hypothetical protein (... 40 6.5
10gb|AC153530.9| Mus musculus 10 BAC RP23-202A18 (Roswell Park Can... 40 6.5
11gb|AC135800.24| Medicago truncatula clone mth2-14g8, complete se... 40 6.5
12emb|AL137009.8| Human DNA sequence from clone RP3-370O5 on chrom... 40 6.5
13emb|AL121978.5|HSJ520B18 Human DNA sequence from clone RP3-520B1... 40 6.5
14gb|AC157757.24| Medicago truncatula clone mth2-16j22, complete s... 40 6.5
15gb|AC012396.7|AC012396 Arabidopsis thaliana chromosome 1 BAC T9L... 40 6.5

>gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, complete sequence
          Length = 184893

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 361   ggatcaattaaatccaaatca 381
             |||||||||||||||||||||
Sbjct: 30869 ggatcaattaaatccaaatca 30889



to top

>gb|AC012352.7| Homo sapiens BAC clone RP11-12M21 from 2, complete sequence
          Length = 168142

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 162    tgataaactacaacagatcat 182
              |||||||||||||||||||||
Sbjct: 134418 tgataaactacaacagatcat 134438



to top

>gb|AC009227.3|AC009227 Homo sapiens BAC clone RP11-187G20 from 2, complete sequence
          Length = 174149

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 59   attcatattcactgccatataatgttcta 87
            |||||| ||||||| ||||||||||||||
Sbjct: 5310 attcattttcactggcatataatgttcta 5338



to top

>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence
          Length = 260404

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 361   ggatcaattaaatccaaatca 381
             |||||||||||||||||||||
Sbjct: 57941 ggatcaattaaatccaaatca 57921



to top

>gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, complete sequence
          Length = 188713

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 361   ggatcaattaaatccaaatca 381
             |||||||||||||||||||||
Sbjct: 72460 ggatcaattaaatccaaatca 72440



to top

>dbj|AB011667.1| Ipomoea purpurea genes for dihydroflavonol 4-reductase, complete cds
          Length = 16845

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 92   tcccatgcatgcatgcaaata 112
            |||||||||||||||||||||
Sbjct: 2140 tcccatgcatgcatgcaaata 2160



to top

>emb|AL671871.4| Mouse DNA sequence from clone RP23-157M14 on chromosome 4, complete
             sequence
          Length = 199593

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 324   aatggaccaaagctggcttca 344
             |||||||||||||||||||||
Sbjct: 19356 aatggaccaaagctggcttca 19376



to top

>ref|NM_106003.2| Arabidopsis thaliana calcium ion binding AT1G73440 mRNA, complete
           cds
          Length = 988

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 235 tacataagtcatcttcttag 254
           ||||||||||||||||||||
Sbjct: 912 tacataagtcatcttcttag 931



to top

>ref|XM_630965.1| Dictyostelium discoideum hypothetical protein (DDB0188520), partial
            mRNA
          Length = 2694

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 362  gatcaattaaatccaaatca 381
            ||||||||||||||||||||
Sbjct: 2302 gatcaattaaatccaaatca 2283



to top

>gb|AC153530.9| Mus musculus 10 BAC RP23-202A18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 192392

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 89     atttcccatgcatgcatgca 108
              ||||||||||||||||||||
Sbjct: 110727 atttcccatgcatgcatgca 110746



to top

>gb|AC135800.24| Medicago truncatula clone mth2-14g8, complete sequence
          Length = 125467

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 91    ttcccatgcatgcatgcaaa 110
             ||||||||||||||||||||
Sbjct: 60973 ttcccatgcatgcatgcaaa 60992



to top

>emb|AL137009.8| Human DNA sequence from clone RP3-370O5 on chromosome 6 Contains the 5'
             end of a novel gene containing FLJ13942 and a CpG island,
             complete sequence
          Length = 113254

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 166   aaactacaacagatcatatt 185
             ||||||||||||||||||||
Sbjct: 81366 aaactacaacagatcatatt 81347



to top

>emb|AL121978.5|HSJ520B18 Human DNA sequence from clone RP3-520B18 on chromosome 6p24.1-25.3
             Contains the 5' end of the gene for phenylalanine-tRNA
             synthetase (FARS1), a microtubule-associated protein 1A/1B
             light chain 3 pseudogene and a CpG island, complete
             sequence
          Length = 148385

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 153   aaatgaccatgataaactac 172
             ||||||||||||||||||||
Sbjct: 90328 aaatgaccatgataaactac 90347



to top

>gb|AC157757.24| Medicago truncatula clone mth2-16j22, complete sequence
          Length = 139728

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    ttcccatgcatgcatgcaaa 110
             ||||||||||||||||||||
Sbjct: 78684 ttcccatgcatgcatgcaaa 78665



to top

>gb|AC012396.7|AC012396 Arabidopsis thaliana chromosome 1 BAC T9L24 genomic sequence, complete
             sequence
          Length = 90459

 Score = 40.1 bits (20), Expect = 6.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 235   tacataagtcatcttcttag 254
             ||||||||||||||||||||
Sbjct: 40677 tacataagtcatcttcttag 40658


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,384,658
Number of Sequences: 3902068
Number of extensions: 3384658
Number of successful extensions: 79283
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 79249
Number of HSP's gapped (non-prelim): 34
length of query: 479
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 457
effective length of database: 17,147,199,772
effective search space: 7836270295804
effective search space used: 7836270295804
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top