Clone Name | rbah63d17 |
---|---|
Clone Library Name | barley_pub |
>gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, complete sequence Length = 184893 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 361 ggatcaattaaatccaaatca 381 ||||||||||||||||||||| Sbjct: 30869 ggatcaattaaatccaaatca 30889
>gb|AC012352.7| Homo sapiens BAC clone RP11-12M21 from 2, complete sequence Length = 168142 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 162 tgataaactacaacagatcat 182 ||||||||||||||||||||| Sbjct: 134418 tgataaactacaacagatcat 134438
>gb|AC009227.3|AC009227 Homo sapiens BAC clone RP11-187G20 from 2, complete sequence Length = 174149 Score = 42.1 bits (21), Expect = 1.6 Identities = 27/29 (93%) Strand = Plus / Plus Query: 59 attcatattcactgccatataatgttcta 87 |||||| ||||||| |||||||||||||| Sbjct: 5310 attcattttcactggcatataatgttcta 5338
>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence Length = 260404 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 361 ggatcaattaaatccaaatca 381 ||||||||||||||||||||| Sbjct: 57941 ggatcaattaaatccaaatca 57921
>gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, complete sequence Length = 188713 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Minus Query: 361 ggatcaattaaatccaaatca 381 ||||||||||||||||||||| Sbjct: 72460 ggatcaattaaatccaaatca 72440
>dbj|AB011667.1| Ipomoea purpurea genes for dihydroflavonol 4-reductase, complete cds Length = 16845 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 92 tcccatgcatgcatgcaaata 112 ||||||||||||||||||||| Sbjct: 2140 tcccatgcatgcatgcaaata 2160
>emb|AL671871.4| Mouse DNA sequence from clone RP23-157M14 on chromosome 4, complete sequence Length = 199593 Score = 42.1 bits (21), Expect = 1.6 Identities = 21/21 (100%) Strand = Plus / Plus Query: 324 aatggaccaaagctggcttca 344 ||||||||||||||||||||| Sbjct: 19356 aatggaccaaagctggcttca 19376
>ref|NM_106003.2| Arabidopsis thaliana calcium ion binding AT1G73440 mRNA, complete cds Length = 988 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 235 tacataagtcatcttcttag 254 |||||||||||||||||||| Sbjct: 912 tacataagtcatcttcttag 931
>ref|XM_630965.1| Dictyostelium discoideum hypothetical protein (DDB0188520), partial mRNA Length = 2694 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 362 gatcaattaaatccaaatca 381 |||||||||||||||||||| Sbjct: 2302 gatcaattaaatccaaatca 2283
>gb|AC153530.9| Mus musculus 10 BAC RP23-202A18 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 192392 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 89 atttcccatgcatgcatgca 108 |||||||||||||||||||| Sbjct: 110727 atttcccatgcatgcatgca 110746
>gb|AC135800.24| Medicago truncatula clone mth2-14g8, complete sequence Length = 125467 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 91 ttcccatgcatgcatgcaaa 110 |||||||||||||||||||| Sbjct: 60973 ttcccatgcatgcatgcaaa 60992
>emb|AL137009.8| Human DNA sequence from clone RP3-370O5 on chromosome 6 Contains the 5' end of a novel gene containing FLJ13942 and a CpG island, complete sequence Length = 113254 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 166 aaactacaacagatcatatt 185 |||||||||||||||||||| Sbjct: 81366 aaactacaacagatcatatt 81347
>emb|AL121978.5|HSJ520B18 Human DNA sequence from clone RP3-520B18 on chromosome 6p24.1-25.3 Contains the 5' end of the gene for phenylalanine-tRNA synthetase (FARS1), a microtubule-associated protein 1A/1B light chain 3 pseudogene and a CpG island, complete sequence Length = 148385 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Plus Query: 153 aaatgaccatgataaactac 172 |||||||||||||||||||| Sbjct: 90328 aaatgaccatgataaactac 90347
>gb|AC157757.24| Medicago truncatula clone mth2-16j22, complete sequence Length = 139728 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 91 ttcccatgcatgcatgcaaa 110 |||||||||||||||||||| Sbjct: 78684 ttcccatgcatgcatgcaaa 78665
>gb|AC012396.7|AC012396 Arabidopsis thaliana chromosome 1 BAC T9L24 genomic sequence, complete sequence Length = 90459 Score = 40.1 bits (20), Expect = 6.5 Identities = 20/20 (100%) Strand = Plus / Minus Query: 235 tacataagtcatcttcttag 254 |||||||||||||||||||| Sbjct: 40677 tacataagtcatcttcttag 40658 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,384,658 Number of Sequences: 3902068 Number of extensions: 3384658 Number of successful extensions: 79283 Number of sequences better than 10.0: 15 Number of HSP's better than 10.0 without gapping: 15 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 79249 Number of HSP's gapped (non-prelim): 34 length of query: 479 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 457 effective length of database: 17,147,199,772 effective search space: 7836270295804 effective search space used: 7836270295804 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)