| Clone Name | rbah63d14 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY106099.1| Zea mays PCO066535 mRNA sequence Length = 1500 Score = 50.1 bits (25), Expect = 0.008 Identities = 42/47 (89%), Gaps = 3/47 (6%) Strand = Plus / Minus Query: 515 ttcctcttctttgaagccacctc---cttctttggtgtttcttcagt 558 ||||||||||||||||||| || ||||||||||||||||||||| Sbjct: 937 ttcctcttctttgaagccaattctgacttctttggtgtttcttcagt 891
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 48.1 bits (24), Expect = 0.032 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Plus Query: 504 cctcttggtgcttcctcttctttgaagccacctc---cttctttggtgtttcttcagt 558 ||||||| || ||||||||||||||||| | || ||||||||||||||||||||| Sbjct: 13101208 cctcttgatgtttcctcttctttgaagcaccttcaggcttctttggtgtttcttcagt 13101265
>gb|AC135257.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1113A07, from chromosome 3, complete sequence Length = 151173 Score = 48.1 bits (24), Expect = 0.032 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 504 cctcttggtgcttcctcttctttgaagccacctc---cttctttggtgtttcttcagt 558 ||||||| || ||||||||||||||||| | || ||||||||||||||||||||| Sbjct: 125430 cctcttgatgtttcctcttctttgaagcaccttcaggcttctttggtgtttcttcagt 125373
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 48.1 bits (24), Expect = 0.032 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Plus Query: 504 cctcttggtgcttcctcttctttgaagccacctc---cttctttggtgtttcttcagt 558 ||||||| || ||||||||||||||||| | || ||||||||||||||||||||| Sbjct: 13097983 cctcttgatgtttcctcttctttgaagcaccttcaggcttctttggtgtttcttcagt 13098040
>dbj|AK099754.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013092O17, full insert sequence Length = 2340 Score = 48.1 bits (24), Expect = 0.032 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 504 cctcttggtgcttcctcttctttgaagccacctc---cttctttggtgtttcttcagt 558 ||||||| || ||||||||||||||||| | || ||||||||||||||||||||| Sbjct: 1727 cctcttgatgtttcctcttctttgaagcaccttcaggcttctttggtgtttcttcagt 1670
>dbj|AK101143.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033026N20, full insert sequence Length = 1882 Score = 48.1 bits (24), Expect = 0.032 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 504 cctcttggtgcttcctcttctttgaagccacctc---cttctttggtgtttcttcagt 558 ||||||| || ||||||||||||||||| | || ||||||||||||||||||||| Sbjct: 1612 cctcttgatgtttcctcttctttgaagcaccttcaggcttctttggtgtttcttcagt 1555
>dbj|AB015431.1| Oryza sativa mRNA for SAR DNA binding protein, partial cds Length = 1638 Score = 48.1 bits (24), Expect = 0.032 Identities = 50/58 (86%), Gaps = 3/58 (5%) Strand = Plus / Minus Query: 504 cctcttggtgcttcctcttctttgaagccacctc---cttctttggtgtttcttcagt 558 ||||||| || ||||||||||||||||| | || ||||||||||||||||||||| Sbjct: 1581 cctcttgatgtttcctcttctttgaagcaccttcaggcttctttggtgtttcttcagt 1524
>ref|XM_361116.1| Magnaporthe grisea 70-15 hypothetical protein (MG03659.4) partial mRNA Length = 1251 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 427 cttggatttcttcttcttcttggactt 453 |||||||||||||||||| |||||||| Sbjct: 723 cttggatttcttcttctttttggactt 697
>ref|XM_611879.2| PREDICTED: Bos taurus similar to Ubiquitin carboxyl-terminal hydrolase 42 (Ubiquitin thiolesterase 42) (Ubiquitin-specific processing protease 42) (Deubiquitinating enzyme 42) (LOC532721), mRNA Length = 4296 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 423 tgtccttggatttcttcttcttcttggactt 453 |||| |||||||||||||||||||| ||||| Sbjct: 3835 tgtctttggatttcttcttcttcttcgactt 3805
>gb|AC128643.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0007B15 map S10318, complete sequence Length = 125243 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttcttgg 449 |||||||||||||||||||||| Sbjct: 81362 ttggatttcttcttcttcttgg 81341
>gb|AC123897.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0055G24 map S20116S, complete sequence Length = 174210 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttcttgg 449 |||||||||||||||||||||| Sbjct: 4544 ttggatttcttcttcttcttgg 4523
>gb|AY518220.1| Oryza sativa (indica cultivar-group) NBS-LRR-like protein A (NL-A), NBS-LRR-like protein B (NL-B), NBS-LRR-like protein C (NL-C), and NBS-LRR-like protein D (NL-D) genes, complete cds Length = 73617 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 426 ccttggatttcttcttcttctt 447 |||||||||||||||||||||| Sbjct: 69298 ccttggatttcttcttcttctt 69319 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 69510 ttggatttcttcttcttctt 69529
>ref|XM_784913.1| PREDICTED: Strongylocentrotus purpuratus similar to prominin-like 2 (LOC585072), partial mRNA Length = 1447 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 434 ttcttcttcttcttggacttct 455 |||||||||||||||||||||| Sbjct: 1388 ttcttcttcttcttggacttct 1367
>gb|AC135643.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone OSJNBa0023F01, complete sequence Length = 145009 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 426 ccttggatttcttcttcttctt 447 |||||||||||||||||||||| Sbjct: 96905 ccttggatttcttcttcttctt 96884 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 96693 ttggatttcttcttcttctt 96674
>emb|CR925780.8| Zebrafish DNA sequence from clone CH211-112B19 in linkage group 5, complete sequence Length = 166407 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 434 ttcttcttcttcttggacttct 455 |||||||||||||||||||||| Sbjct: 90467 ttcttcttcttcttggacttct 90488
>gb|BC055674.1| Danio rerio zgc:66480, mRNA (cDNA clone MGC:66480 IMAGE:2601340), complete cds Length = 1873 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 443 ttcttggacttctctttctcctgctc 468 ||||||| |||||||||||||||||| Sbjct: 1067 ttcttggtcttctctttctcctgctc 1042
>gb|AC044781.12| Homo sapiens chromosome 10 clone RP11-142M10, complete sequence Length = 177448 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 453 tctctttctcctgctcaccatccttt 478 ||||||||||| |||||||||||||| Sbjct: 120678 tctctttctccagctcaccatccttt 120653
>dbj|AP007150.1| Aspergillus oryzae RIB40 genomic DNA, SC009 Length = 1913118 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 436 cttcttcttcttggacttctctttct 461 ||||| |||||||||||||||||||| Sbjct: 646451 cttctgcttcttggacttctctttct 646426
>ref|XM_697034.1| PREDICTED: Danio rerio hypothetical protein LOC554444 (LOC554444), mRNA Length = 1847 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 443 ttcttggacttctctttctcctgctc 468 ||||||| |||||||||||||||||| Sbjct: 1067 ttcttggtcttctctttctcctgctc 1042
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 426 ccttggatttcttcttcttctt 447 |||||||||||||||||||||| Sbjct: 26492815 ccttggatttcttcttcttctt 26492836 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttcttgg 449 |||||||||||||||||||||| Sbjct: 3487407 ttggatttcttcttcttcttgg 3487386 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 26493027 ttggatttcttcttcttctt 26493046
>ref|NM_199823.1| Danio rerio zgc:66480 (zgc:66480), mRNA Length = 1873 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 443 ttcttggacttctctttctcctgctc 468 ||||||| |||||||||||||||||| Sbjct: 1067 ttcttggtcttctctttctcctgctc 1042
>dbj|AK099115.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023038C07, full insert sequence Length = 3784 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttcttgg 449 |||||||||||||||||||||| Sbjct: 3618 ttggatttcttcttcttcttgg 3639
>dbj|AK069580.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023020A19, full insert sequence Length = 1504 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 426 ccttggatttcttcttcttctt 447 |||||||||||||||||||||| Sbjct: 676 ccttggatttcttcttcttctt 655 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 464 ttggatttcttcttcttctt 445
>dbj|AK064084.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-100-B10, full insert sequence Length = 1705 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttcttgg 449 |||||||||||||||||||||| Sbjct: 1575 ttggatttcttcttcttcttgg 1596
>emb|CR855387.11| Zebrafish DNA sequence from clone DKEY-282H22 in linkage group 3, complete sequence Length = 106466 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 443 ttcttggacttctctttctcctgctc 468 ||||||| |||||||||||||||||| Sbjct: 31329 ttcttggtcttctctttctcctgctc 31304
>gb|AF093117.1|AF093117 Homo sapiens chromosome 7qtelo BAC E3, complete sequence Length = 147216 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 422 gtgtccttggatttcttcttct 443 |||||||||||||||||||||| Sbjct: 125022 gtgtccttggatttcttcttct 125043
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 426 ccttggatttcttcttcttctt 447 |||||||||||||||||||||| Sbjct: 26818079 ccttggatttcttcttcttctt 26818100 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttcttgg 449 |||||||||||||||||||||| Sbjct: 3496111 ttggatttcttcttcttcttgg 3496090 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 26818291 ttggatttcttcttcttctt 26818310
>emb|AL929124.13| Zebrafish DNA sequence from clone CH211-128D23, complete sequence Length = 165243 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Plus Query: 443 ttcttggacttctctttctcctgctc 468 ||||||| |||||||||||||||||| Sbjct: 82798 ttcttggtcttctctttctcctgctc 82823
>gb|AF484084.1| Lymnaea stagnalis voltage-dependent T-type calcium channel alpha-1 subunit mRNA, partial cds, alternatively spliced Length = 5991 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 444 tcttggacttctctttctcctgctc 468 |||||||||||||||| |||||||| Sbjct: 3141 tcttggacttctctttttcctgctc 3165
>gb|AC112945.9| Mus musculus chromosome 15, clone RP23-382O21, complete sequence Length = 189335 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 441 tcttcttggacttctctttct 461 ||||||||||||||||||||| Sbjct: 12403 tcttcttggacttctctttct 12383
>gb|AY814548.1| Schistosoma japonicum SJCHGC02840 protein mRNA, complete cds Length = 1081 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 109 gtcgctgctagtcctaatgtg 129 ||||||||||||||||||||| Sbjct: 620 gtcgctgctagtcctaatgtg 640
>ref|XM_756145.1| Ustilago maydis 521 hypothetical protein (UM05091.1) partial mRNA Length = 1155 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 427 cttggatttcttcttcttctt 447 ||||||||||||||||||||| Sbjct: 255 cttggatttcttcttcttctt 235
>gb|AF036699.2| Caenorhabditis elegans cosmid F58F6, complete sequence Length = 43764 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 434 ttcttcttcttcttggacttctctt 458 |||||||||||||||||||| |||| Sbjct: 39177 ttcttcttcttcttggacttttctt 39201
>ref|XM_500653.1| Yarrowia lipolytica CLIB122, YALI0B08756g predicted mRNA Length = 2145 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 427 cttggatttcttcttcttctt 447 ||||||||||||||||||||| Sbjct: 979 cttggatttcttcttcttctt 959
>ref|XM_968036.1| PREDICTED: Tribolium castaneum similar to CG7971-PC, isoform C (LOC661905), mRNA Length = 2094 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggactt 453 ||||||||||||||||||||| Sbjct: 708 tttcttcttcttcttggactt 688
>emb|BX601648.7| Zebrafish DNA sequence from clone DKEY-14F19 in linkage group 11, complete sequence Length = 230487 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 438 tcttcttcttggacttctctttctc 462 |||||||||| |||||||||||||| Sbjct: 164322 tcttcttctttgacttctctttctc 164346 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 438 tcttcttcttggacttctctttctc 462 |||||||||| |||||||||||||| Sbjct: 158939 tcttcttctttgacttctctttctc 158963 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 438 tcttcttcttggacttctctttctc 462 |||||||||| |||||||||||||| Sbjct: 154073 tcttcttctttgacttctctttctc 154097 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 438 tcttcttcttggacttctctttctc 462 |||||||||| |||||||||||||| Sbjct: 143513 tcttcttctttgacttctctttctc 143537
>ref|XM_700906.1| PREDICTED: Danio rerio hypothetical protein LOC561616 (LOC561616), mRNA Length = 1131 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 438 tcttcttcttggacttctctttctc 462 |||||||||| |||||||||||||| Sbjct: 916 tcttcttctttgacttctctttctc 892
>gb|U84139.1|BTU84139 Bos taurus structure-specific recognition protein 1 (SSRP1) mRNA, partial cds Length = 1834 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggactt 453 ||||||||||||||||||||| Sbjct: 1149 tttcttcttcttcttggactt 1129
>ref|NM_067671.1| Caenorhabditis elegans F58F6.3 (F58F6.3) mRNA, complete cds Length = 513 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 434 ttcttcttcttcttggacttctctt 458 |||||||||||||||||||| |||| Sbjct: 254 ttcttcttcttcttggacttttctt 230
>dbj|AK047381.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length enriched library, clone:B930054E24 product:unclassifiable, full insert sequence Length = 2279 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 441 tcttcttggacttctctttct 461 ||||||||||||||||||||| Sbjct: 1478 tcttcttggacttctctttct 1498
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 388 gctagcatcagcatcagctgcggga 412 ||||||||||||||||||| ||||| Sbjct: 40434417 gctagcatcagcatcagctacggga 40434393
>dbj|AP004672.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0592G05 Length = 146220 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 388 gctagcatcagcatcagctgcggga 412 ||||||||||||||||||| ||||| Sbjct: 85658 gctagcatcagcatcagctacggga 85634
>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome Length = 3544776 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 498 gttcttcctcttggtgcttcc 518 ||||||||||||||||||||| Sbjct: 1435713 gttcttcctcttggtgcttcc 1435693
>dbj|BA000041.2| Pan troglodytes DNA, major histocompatibility complex class I region Length = 1750601 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 432 atttcttcttcttcttggacttctctttctcct 464 |||||||||||||||| ||||||| ||||||| Sbjct: 692912 atttcttcttcttctttcacttctccttctcct 692880 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 771418 cttctctttctgctgctcaccatc 771441
>dbj|AK105740.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-202-A06, full insert sequence Length = 2854 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 388 gctagcatcagcatcagctgcggga 412 ||||||||||||||||||| ||||| Sbjct: 2468 gctagcatcagcatcagctacggga 2444
>emb|BX469908.10| Zebrafish DNA sequence from clone DKEY-249P7 in linkage group 20, complete sequence Length = 108923 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 438 tcttcttcttggacttctctttctc 462 |||||||||| |||||||||||||| Sbjct: 42213 tcttcttctttgacttctctttctc 42237
>gb|AC153561.5| Mus musculus 10 BAC RP23-426E11 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 228734 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 427 cttggatttcttcttcttctt 447 ||||||||||||||||||||| Sbjct: 54880 cttggatttcttcttcttctt 54900
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica Length = 3066374 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 427 cttggatttcttcttcttctt 447 ||||||||||||||||||||| Sbjct: 1203131 cttggatttcttcttcttctt 1203111
>ref|NM_121609.2| Arabidopsis thaliana Ran GTPase binding / chromatin binding AT5G16040 mRNA, complete cds Length = 1745 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 435 tcttcttcttcttggacttctctt 458 ||||||||||||||| |||||||| Sbjct: 1596 tcttcttcttcttggtcttctctt 1619
>ref|NM_127974.1| Arabidopsis thaliana ATP binding / protein kinase/ protein serine/threonine kinase/ protein-tyrosine kinase AT2G24130 mRNA, complete cds Length = 2943 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 114 ttggatttcttcttcttctt 133
>ref|NM_104500.2| Arabidopsis thaliana metal ion binding AT1G56210 mRNA, complete cds Length = 1384 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggacttctctttc 460 |||||||||||||||| |||||||||| Sbjct: 484 tttcttcttcttcttgttcttctctttc 457
>ref|NM_121608.1| Arabidopsis thaliana unknown protein AT5G16030 transcript variant AT5G16030.1 mRNA, complete cds Length = 1248 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttctctt 458 ||||||||||||||| |||||||| Sbjct: 975 tcttcttcttcttggtcttctctt 952
>ref|NM_001036812.1| Arabidopsis thaliana unknown protein AT5G16030 transcript variant AT5G16030.2 mRNA, complete cds Length = 1254 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttctctt 458 ||||||||||||||| |||||||| Sbjct: 981 tcttcttcttcttggtcttctctt 958
>gb|BT020412.1| Arabidopsis thaliana At1g56210 mRNA, complete cds Length = 1095 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggacttctctttc 460 |||||||||||||||| |||||||||| Sbjct: 387 tttcttcttcttcttgttcttctctttc 360
>ref|XM_518337.1| PREDICTED: Pan troglodytes similar to IEX-1 (LOC462547), mRNA Length = 867 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 559 cttctctttctgctgctcaccatc 582
>gb|AF030694.2| Plasmodium falciparum strain Dd2 heat shock protein 86 (HSP86), O1 (o1), O3 (o3), O2 (o2), CG8 (cg8), CG4 (cg4), CG3 (cg3), putative chloroquine resistance transporter (crt), CG9 (cg9), CG1 (cg1), CG6 (cg6), CG2 (cg2), and CG7 (cg7) genes, complete cds Length = 47573 Score = 40.1 bits (20), Expect = 7.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggacttctctttctcct 464 ||||||||||||||| |||||||||||||| Sbjct: 2563 tttcttcttcttcttctccttctctttctcct 2532
>gb|AC148089.8| Mus musculus chromosome 8, clone RP24-366L10, complete sequence Length = 178426 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttc 454 |||||||||||||||||||| Sbjct: 36390 tcttcttcttcttggacttc 36371
>ref|XM_368407.1| Magnaporthe grisea 70-15 chromosome VI hypothetical protein (MG00837.4) partial mRNA Length = 1878 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ttcttcttcttcttggactt 453 |||||||||||||||||||| Sbjct: 1190 ttcttcttcttcttggactt 1171
>gb|BC005080.1| Homo sapiens immediate early response 3, transcript variant short, mRNA (cDNA clone MGC:13037 IMAGE:3617088), complete cds Length = 1240 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 274 cttctctttctgctgctcaccatc 297
>gb|BC000844.2| Homo sapiens immediate early response 3, transcript variant short, mRNA (cDNA clone MGC:5118 IMAGE:3457670), complete cds Length = 1238 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 272 cttctctttctgctgctcaccatc 295
>gb|BC070926.1| Rattus norvegicus steroid sensitive gene 1, mRNA (cDNA clone IMAGE:7096530), partial cds Length = 2750 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 440 ttcttcttggacttctctttctcctgct 467 |||||||| | ||||||||||||||||| Sbjct: 1480 ttcttcttagtcttctctttctcctgct 1453
>gb|AY601448.1| Apis mellifera AFLP marker a12.086 genomic sequence Length = 50 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 432 atttcttcttcttcttggac 451 |||||||||||||||||||| Sbjct: 17 atttcttcttcttcttggac 36
>gb|AY522594.1| Oreochromis mossambicus cadherin-related neuronal receptor 5-like mRNA, partial sequence Length = 807 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 434 ttcttcttcttcttggacttctctttct 461 |||||||||||||||| || |||||||| Sbjct: 254 ttcttcttcttcttggcctcctctttct 227
>gb|AC158487.2| Capitella capitata clone JGIAUTO-1A15, complete sequence Length = 35955 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 433 tttcttcttcttcttggacttctctttc 460 ||||||||||||||| | |||||||||| Sbjct: 3017 tttcttcttcttcttcgtcttctctttc 3044
>gb|AC167229.4| Mus musculus BAC RP24-337D17 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 197711 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 53192 ttggatttcttcttcttctt 53211
>gb|AC162901.4| Mus musculus BAC clone RP23-417K5 from chromosome 8, complete sequence Length = 205244 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttc 454 |||||||||||||||||||| Sbjct: 147864 tcttcttcttcttggacttc 147845
>gb|AC140265.2| Mus musculus BAC clone RP23-318B18 from chromosome 6, complete sequence Length = 178580 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 434 ttcttcttcttcttggacttctctttct 461 |||||||||||||| | ||||||||||| Sbjct: 7642 ttcttcttcttcttcgtcttctctttct 7669
>ref|XM_757091.1| Ustilago maydis 521 hypothetical protein (UM06037.1) partial mRNA Length = 1962 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 387 cgctagcatcagcatcagct 406 |||||||||||||||||||| Sbjct: 1103 cgctagcatcagcatcagct 1122
>ref|XM_747040.1| Aspergillus fumigatus Af293 methionine aminopeptidase, type II (Afu4g06930) partial mRNA Length = 1485 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 434 ttcttcttcttcttggactt 453 |||||||||||||||||||| Sbjct: 296 ttcttcttcttcttggactt 277
>ref|XM_747177.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g09030) partial mRNA Length = 435 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 cttcttcttcttggacttct 455 |||||||||||||||||||| Sbjct: 423 cttcttcttcttggacttct 404
>emb|CT009501.6| Human DNA sequence from clone DAMA-63A3 on chromosome 6, complete sequence Length = 73136 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 3901 cttctctttctgctgctcaccatc 3878
>gb|AC133100.5| Mus musculus BAC clone RP23-98O11 from chromosome 19, complete sequence Length = 204855 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 539 ttctttggtgtttcttcagt 558 |||||||||||||||||||| Sbjct: 5409 ttctttggtgtttcttcagt 5390
>gb|AC123034.5| Mus musculus BAC clone RP24-484E17 from chromosome 13, complete sequence Length = 177675 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 434 ttcttcttcttcttggacttctct 457 |||||||||||| ||||||||||| Sbjct: 152890 ttcttcttcttcatggacttctct 152913
>ref|XM_812270.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053511303.120) partial mRNA Length = 4152 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 81 ttggatttcttcttcttctt 62
>ref|XM_805563.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053511761.89) partial mRNA Length = 1131 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 84 ttggatttcttcttcttctt 65
>emb|CR683999.2|CNS0FQQ3 Tetraodon nigroviridis full-length cDNA Length = 1356 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 1043 ttggatttcttcttcttctt 1024
>emb|CR662706.2|CNS0FABC Tetraodon nigroviridis full-length cDNA Length = 1145 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 855 ttggatttcttcttcttctt 836
>emb|CR659399.2|CNS0F7RH Tetraodon nigroviridis full-length cDNA Length = 1147 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 853 ttggatttcttcttcttctt 834
>emb|CR658831.2|CNS0F7BP Tetraodon nigroviridis full-length cDNA Length = 1365 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 1053 ttggatttcttcttcttctt 1034
>emb|CR657148.2|CNS0F60Y Tetraodon nigroviridis full-length cDNA Length = 1324 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 1024 ttggatttcttcttcttctt 1005
>ref|NM_003897.2| Homo sapiens immediate early response 3 (IER3), transcript variant short, mRNA Length = 1236 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 285 cttctctttctgctgctcaccatc 308
>ref|NM_052815.1| Homo sapiens immediate early response 3 (IER3), transcript variant long, mRNA Length = 1345 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 396 cttctctttctgctgctcaccatc 419
>gb|AC133000.5| Rattus Norvegicus Strain CH230-62B6 BAC, BN/SsNHsd/MCW, complete sequence Length = 245581 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 455 tctttctcctgctcaccatccttt 478 |||||||||||||||||| ||||| Sbjct: 166115 tctttctcctgctcaccagccttt 166092
>emb|BX248307.7| Human DNA sequence from clone DASS-191K16 on chromosome 6, complete sequence Length = 54911 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 46421 cttctctttctgctgctcaccatc 46398
>emb|AL845353.7| Human DNA sequence from clone DAQB-47P19 on chromosome 6 Contains the 3' end of the MRPS18B gene for mitochondrial ribosomal protein S18B, the C6orf134 gene for chromosome 6 open reading frame 134, the C6orf136 gene for chromosome 6 open reading frame 136, the DHX16 gene for DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 16, the KIAA1949 gene, the NRM gene for nurim (nuclear envelope membrane protein), the RPL7P4 pseudogene for ribosomal protein L7 pseudogene 4, the MDC1 gene for mediator of DNA damage checkpoint 1, the TUBB gene for tubulin, beta polypeptide, the FLOT1 gene for flotillin 1, the IER3 gene for immediate early response 3 and 8 CpG islands, complete sequence Length = 130755 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 127381 cttctctttctgctgctcaccatc 127358
>gb|BC107543.1| Bos taurus zinc finger protein 746, mRNA (cDNA clone MGC:128817 IMAGE:7989855), complete cds Length = 3722 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 cttcttcttcttggacttct 455 |||||||||||||||||||| Sbjct: 1094 cttcttcttcttggacttct 1075
>emb|AL662797.7| Human DNA sequence from clone XXbac-252P9 on chromosome 6 contains the 3' end of a putative novel transcript, the NRM gene for nurim (nuclear envelope membrane protein), a ribosomal protein L7 (RPL7) pseudogene, the gene for KIAA0170 protein, the TUBB gene for tubulin, beta polypeptide, the FLOT1 gene for flotillin 1, the IER3 gene for immediate early response 3, a putative novel transcript and five CpG islands, complete sequence Length = 171627 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 67236 cttctctttctgctgctcaccatc 67213
>emb|AL662848.6| Human DNA sequence from clone XXbac-111D4 on chromosome 6 contains a ribosomal protein L7 (RPL7) pseudogene, the gene for KIAA0170 protein, the TUBB gene for tubulin, beta polypeptide, the FLOT1 gene for flotillin 1, the IER3 gene for immediate early response 3 , two putative novel transcripts and three CpG islands, complete sequence Length = 185617 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 52332 cttctctttctgctgctcaccatc 52309
>ref|XM_503888.1| Yarrowia lipolytica CLIB122, YALI0E13123g predicted mRNA Length = 1644 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 425 tccttggatttcttcttcttcttg 448 |||||||| ||||||||||||||| Sbjct: 1079 tccttggacttcttcttcttcttg 1056
>emb|AL050342.42|HSDJ655K7 Human DNA sequence from clone RP4-655K7 on chromosome 1p35.3-36.13 Contains part of a gene encoding a novel protein,, complete sequence Length = 116857 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 544 tggtgtttcttcagttgtttgccc 567 ||||| |||||||||||||||||| Sbjct: 9923 tggtgattcttcagttgtttgccc 9946
>emb|AL031431.8|HS462O23 Human DNA sequence from clone RP3-462O23 on chromosome 1p35.1-36.12 Contains the 3' end of the gene for sister-of-mammalian grainyhead (SOM), a novel gene (LOC90529) and a novel gene (DJ462O23.2), complete sequence Length = 154154 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 146 gaatggcaagtcccaaaact 165 |||||||||||||||||||| Sbjct: 131116 gaatggcaagtcccaaaact 131097
>emb|Z29667.1|PFHESHPR P.falciparum (7) mRNA for heat-shock protein Length = 2924 Score = 40.1 bits (20), Expect = 7.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggacttctctttctcct 464 ||||||||||||||| |||||||||||||| Sbjct: 1145 tttcttcttcttcttctccttctctttctcct 1114
>ref|XM_777194.1| PREDICTED: Strongylocentrotus purpuratus similar to delangin isoform A (LOC576931), partial mRNA Length = 1887 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggact 452 |||||||||||||||||||| Sbjct: 1563 tttcttcttcttcttggact 1544
>ref|NM_001035341.1| Bos taurus zinc finger protein 746 (ZNF746), mRNA Length = 3722 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 cttcttcttcttggacttct 455 |||||||||||||||||||| Sbjct: 1094 cttcttcttcttggacttct 1075
>emb|AL627222.10| Mouse DNA sequence from clone RP23-265A5 on chromosome 11 Contains a novel gene, the Tac4 gene for tachykinin, the Myst2 gene for MYST histone acetyltransferase 2, two novel genes, the 5' end of the gene for the likely ortholog of H. sapiens C/EBP-induced protein (5730593F17Rik) and a CpG island, complete sequence Length = 185645 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 57860 ttggatttcttcttcttctt 57879
>emb|AL391145.1|ATF1N13 Arabidopsis thaliana DNA chromosome 5, BAC clone F1N13 (ESSA project) Length = 74687 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttctctt 458 ||||||||||||||| |||||||| Sbjct: 59184 tcttcttcttcttggtcttctctt 59161
>emb|BX511272.9| Zebrafish DNA sequence from clone DKEY-276L13 in linkage group 6, complete sequence Length = 208912 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 335 tcagctgcaggggtctcctc 354 |||||||||||||||||||| Sbjct: 32060 tcagctgcaggggtctcctc 32041
>gb|BT007998.1| Synthetic construct Homo sapiens immediate early response 3 mRNA, partial cds Length = 471 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 256 cttctctttctgctgctcaccatc 279
>gb|BT006703.1| Homo sapiens immediate early response 3 mRNA, complete cds Length = 471 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 256 cttctctttctgctgctcaccatc 279
>emb|CR388215.10| Human DNA sequence from clone DADB-91G1 on chromosome 6, complete sequence Length = 112744 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 1036 cttctctttctgctgctcaccatc 1013
>dbj|AB210164.1| Pan troglodytes IER3, FLOT1 genes for immediate early response 3 isoform short, flotillin 1, complete cds, cell_line: Ericka Length = 19405 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 2200 cttctctttctgctgctcaccatc 2223
>dbj|AB210163.1| Pan troglodytes IER3, FLOT1 genes for immediate early response 3 isoform short, flotillin 1, complete cds, cell_line: Borie Length = 19405 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 2200 cttctctttctgctgctcaccatc 2223
>emb|Y14551.1|HSDIF2 Homo sapiens mRNA for DIF-2 protein Length = 1230 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 267 cttctctttctgctgctcaccatc 290
>dbj|AB202099.1| Homo sapiens IER3, FLOT1 genes for immediate early response 3, flotillin 1, complete cds Length = 19451 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 2193 cttctctttctgctgctcaccatc 2216
>emb|CR625889.1| full-length cDNA clone CS0DK007YD23 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1208 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 272 cttctctttctgctgctcaccatc 295
>emb|CR613281.1| full-length cDNA clone CS0DK004YG01 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 1189 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 272 cttctctttctgctgctcaccatc 295
>emb|CR605389.1| full-length cDNA clone CS0DI037YD10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1167 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 272 cttctctttctgctgctcaccatc 295
>emb|CR599601.1| full-length cDNA clone CS0DI058YF03 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1195 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 247 cttctctttctgctgctcaccatc 270
>emb|CR599121.1| full-length cDNA clone CS0DE012YO16 of Placenta of Homo sapiens (human) Length = 1321 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 384 cttctctttctgctgctcaccatc 407
>emb|CR594999.1| full-length cDNA clone CS0DN001YE17 of Adult brain of Homo sapiens (human) Length = 1273 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 365 cttctctttctgctgctcaccatc 388
>emb|CR594838.1| full-length cDNA clone CS0DI070YB05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1301 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 359 cttctctttctgctgctcaccatc 382
>gb|CP000282.1| Saccharophagus degradans 2-40, complete genome Length = 5057531 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 546 gtgtttcttcagttgtttgc 565 |||||||||||||||||||| Sbjct: 2811041 gtgtttcttcagttgtttgc 2811060
>dbj|AB226300.1| Aspergillus oryzae cDNA, contig sequence: AoEST3162 Length = 1022 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 436 cttcttcttcttggacttct 455 |||||||||||||||||||| Sbjct: 663 cttcttcttcttggacttct 644
>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005 Length = 4429080 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 436 cttcttcttcttggacttct 455 |||||||||||||||||||| Sbjct: 4342965 cttcttcttcttggacttct 4342984
>gb|AY093150.1| Arabidopsis thaliana unknown protein (At5g16030) mRNA, complete cds Length = 1246 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttctctt 458 ||||||||||||||| |||||||| Sbjct: 972 tcttcttcttcttggtcttctctt 949
>gb|AC159910.6| Mus musculus 10 BAC RP23-353C6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 219861 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 35642 ttggatttcttcttcttctt 35623
>gb|AC005967.3| Arabidopsis thaliana chromosome 2 clone F27D4 map CIC06C07, complete sequence Length = 96046 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 17271 ttggatttcttcttcttctt 17290
>gb|AC157373.3| Medicago truncatula chromosome 7 BAC clone mth2-108g9, complete sequence Length = 95326 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 501 cttcctcttggtgcttcctcttct 524 ||||||||||||| |||||||||| Sbjct: 17596 cttcctcttggtgtttcctcttct 17573
>gb|AF083421.1|AF083421 Homo sapiens radiation-inducible immediate early response gene IEX1 (IEX1) mRNA, complete cds Length = 477 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 262 cttctctttctgctgctcaccatc 285
>gb|S81914.1| IEX-1=radiation-inducible immediate-early gene [human, placenta, mRNA Partial, 1223 nt] Length = 1223 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 274 cttctctttctgctgctcaccatc 297
>gb|AF223677.1|AF223677 Rattus norvegicus steroid sensitive gene-1 protein (SSG-1) mRNA, complete cds Length = 3719 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 440 ttcttcttggacttctctttctcctgct 467 |||||||| | ||||||||||||||||| Sbjct: 2249 ttcttcttagtcttctctttctcctgct 2222
>gb|AC148710.1| Macaca mulatta Major Histocompatibility Complex BAC MMU399F22, complete sequence Length = 158818 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 40732 cttctctttctgctgctcaccatc 40709
>gb|AC148705.1| Macaca mulatta Major Histocompatibility Complex MMU348N13, complete sequence Length = 186491 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 36857 cttctctttctgctgctcaccatc 36834
>gb|AC157773.6| Mus musculus chromosome 8, clone RP24-161L20, complete sequence Length = 179186 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttc 454 |||||||||||||||||||| Sbjct: 162233 tcttcttcttcttggacttc 162214
>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds Length = 3284914 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 1686974 cttctctttctgctgctcaccatc 1686997
>gb|AC097462.2| Homo sapiens BAC clone RP11-18O11 from 4, complete sequence Length = 180973 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 442 cttcttggacttctctttctcctg 465 |||||||||||||||| ||||||| Sbjct: 173130 cttcttggacttctctctctcctg 173107
>dbj|AK222588.1| Homo sapiens mRNA for immediate early response 3 isoform short variant, clone: CAS03656 Length = 1192 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 285 cttctctttctgctgctcaccatc 308
>gb|AC069159.8|AC069159 Arabidopsis thaliana chromosome 1 BAC F14G9 genomic sequence, complete sequence Length = 111481 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 433 tttcttcttcttcttggacttctctttc 460 |||||||||||||||| |||||||||| Sbjct: 71907 tttcttcttcttcttgttcttctctttc 71934
>gb|AC092630.3| Homo sapiens BAC clone RP11-321C18 from 2, complete sequence Length = 185947 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 424 gtccttggatttcttcttct 443 |||||||||||||||||||| Sbjct: 143322 gtccttggatttcttcttct 143303
>gb|AF516327.1| Mus musculus strain WB stem cell factor (Kitl) gene, intron 6, partial sequence Length = 408 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 49 ttggatttcttcttcttctt 68
>gb|AF516326.1| Mus musculus strain C57BL/6 stem cell factor (Kitl) gene, intron 6, partial sequence Length = 450 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttggatttcttcttcttctt 447 |||||||||||||||||||| Sbjct: 49 ttggatttcttcttcttctt 68
>gb|BT003392.1| Arabidopsis thaliana unknown protein (At5g16030) mRNA, complete cds Length = 1050 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttctctt 458 ||||||||||||||| |||||||| Sbjct: 916 tcttcttcttcttggtcttctctt 893
>gb|AY086936.1| Arabidopsis thaliana clone 29745 mRNA, complete sequence Length = 1248 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 435 tcttcttcttcttggacttctctt 458 ||||||||||||||| |||||||| Sbjct: 975 tcttcttcttcttggtcttctctt 952
>ref|XM_573284.1| PREDICTED: Rattus norvegicus steroid sensitive gene 1 (Ssg1), mRNA Length = 3779 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 440 ttcttcttggacttctctttctcctgct 467 |||||||| | ||||||||||||||||| Sbjct: 2507 ttcttcttagtcttctctttctcctgct 2480
>gb|AY084417.1| Arabidopsis thaliana clone 107869 mRNA, complete sequence Length = 1381 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggacttctctttc 460 |||||||||||||||| |||||||||| Sbjct: 484 tttcttcttcttcttgttcttctctttc 457
>gb|BT002883.1| Arabidopsis thaliana clone RAFL15-04-C12 (R20378) putative copper chaperone (CCH) protein (At1g56210) mRNA, complete cds Length = 1394 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggacttctctttc 460 |||||||||||||||| |||||||||| Sbjct: 476 tttcttcttcttcttgttcttctctttc 449
>dbj|BA000025.2| Homo sapiens genomic DNA, chromosome 6p21.3, HLA Class I region Length = 2229817 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 1198029 cttctctttctgctgctcaccatc 1198052
>emb|BX119954.10| Zebrafish DNA sequence from clone CH211-286O14, complete sequence Length = 155287 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 546 gtgtttcttcagttgtttgc 565 |||||||||||||||||||| Sbjct: 86760 gtgtttcttcagttgtttgc 86741
>gb|AY892411.1| Synthetic construct Homo sapiens clone FLH014579.01L immediate early response 3 (IER3) mRNA, partial cds Length = 471 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 256 cttctctttctgctgctcaccatc 279
>gb|AY889930.1| Synthetic construct Homo sapiens clone FLH014583.01X immediate early response 3 (IER3) mRNA, complete cds Length = 471 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 256 cttctctttctgctgctcaccatc 279
>dbj|AB007646.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MGI19 Length = 37225 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 424 gtccttggatttcttcttcttctt 447 ||||||| |||||||||||||||| Sbjct: 5947 gtccttgaatttcttcttcttctt 5970
>emb|CT967325.1| Zebrafish DNA sequence from clone DKEY-25K11, complete sequence Length = 267826 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 545 ggtgtttcttcagttgtttg 564 |||||||||||||||||||| Sbjct: 62288 ggtgtttcttcagttgtttg 62307
>emb|BX001033.6| Zebrafish DNA sequence from clone CH211-286F4 in linkage group 7, complete sequence Length = 144689 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 544 tggtgtttcttcagttgttt 563 |||||||||||||||||||| Sbjct: 91379 tggtgtttcttcagttgttt 91398
>gb|AE001439.1| Helicobacter pylori J99, complete genome Length = 1643831 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 432 atttcttcttcttcttggacttctcttt 459 ||||||||||||| || ||||||||||| Sbjct: 418030 atttcttcttcttgtttgacttctcttt 418003
>gb|AY548105.1| Rattus norvegicus DRO1 (Dro1) mRNA, complete cds Length = 3604 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Minus Query: 440 ttcttcttggacttctctttctcctgct 467 |||||||| | ||||||||||||||||| Sbjct: 2142 ttcttcttagtcttctctttctcctgct 2115
>gb|AC006165.1|AC006165 Homo sapiens clone UWGC:y54c125 from 6p21, complete sequence Length = 44118 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 14968 cttctctttctgctgctcaccatc 14991
>gb|AF071596.1|AF071596 Homo sapiens apoptosis inhibitor (IEX-1L) gene, complete cds Length = 1693 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 751 cttctctttctgctgctcaccatc 774
>dbj|AB088101.1| Homo sapiens PRG1, FLOT1 genes for immediate early response 3, flotillin 1, complete cds Length = 19459 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 2193 cttctctttctgctgctcaccatc 2216
>gb|AF039067.1|AF039067 Homo sapiens anti-death protein (IEX-1L) mRNA, complete cds Length = 1309 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 367 cttctctttctgctgctcaccatc 390
>gb|AC161760.4| Mus musculus BAC clone RP23-428J22 from chromosome 14, complete sequence Length = 187639 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 422 gtgtccttggatttcttcttcttc 445 ||||||||||||||| |||||||| Sbjct: 182782 gtgtccttggatttcatcttcttc 182805
>gb|AC140947.1| Gallus gallus BAC clone TAM33-40B24 from chromosome ul, complete sequence Length = 229639 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 446 ttggacttctctttctcctg 465 |||||||||||||||||||| Sbjct: 136236 ttggacttctctttctcctg 136217
>gb|AC133188.4| Mus musculus BAC clone RP23-330F6 from 13, complete sequence Length = 201730 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 434 ttcttcttcttcttggacttctct 457 |||||||||||| ||||||||||| Sbjct: 31014 ttcttcttcttcatggacttctct 31037
>emb|CR936878.10| Human DNA sequence from clone DADB-118P11 on chromosome 6, complete sequence Length = 66216 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 65252 cttctctttctgctgctcaccatc 65229
>emb|CR382131.1| Yarrowia lipolytica chromosome E of strain CLIB 122 of Yarrowia lipolytica Length = 4224103 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 425 tccttggatttcttcttcttcttg 448 |||||||| ||||||||||||||| Sbjct: 1581375 tccttggacttcttcttcttcttg 1581398
>gb|AC161878.3| Mus musculus BAC clone RP23-303B4 from chromosome 1, complete sequence Length = 169556 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Minus Query: 153 aagtcccaaaactttcagac 172 |||||||||||||||||||| Sbjct: 28231 aagtcccaaaactttcagac 28212
>gb|AC166106.3| Mus musculus BAC clone RP23-204F4 from chromosome 14, complete sequence Length = 191630 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Minus Query: 422 gtgtccttggatttcttcttcttc 445 ||||||||||||||| |||||||| Sbjct: 165807 gtgtccttggatttcatcttcttc 165784
>gb|L34027.1|PFAHSP86A Plasmodium falciparum (clone Dd2) heat shock protein 86 gene, complete cds Length = 5762 Score = 40.1 bits (20), Expect = 7.7 Identities = 29/32 (90%) Strand = Plus / Minus Query: 433 tttcttcttcttcttggacttctctttctcct 464 ||||||||||||||| |||||||||||||| Sbjct: 2564 tttcttcttcttcttctccttctctttctcct 2533
>emb|AL928925.6| Mouse DNA sequence from clone RP23-405K7 on chromosome 2, complete sequence Length = 145382 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 539 ttctttggtgtttcttcagt 558 |||||||||||||||||||| Sbjct: 118999 ttctttggtgtttcttcagt 119018
>emb|AL670227.7| Mouse DNA sequence from clone RP23-317N1 on chromosome 4, complete sequence Length = 219973 Score = 40.1 bits (20), Expect = 7.7 Identities = 20/20 (100%) Strand = Plus / Plus Query: 433 tttcttcttcttcttggact 452 |||||||||||||||||||| Sbjct: 147118 tttcttcttcttcttggact 147137
>emb|X96438.1|HSPRG1 H.sapiens PRG1 gene Length = 1864 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 959 cttctctttctgctgctcaccatc 982
>gb|AC159189.2| Mus musculus BAC clone RP24-159L17 from chromosome 6, complete sequence Length = 160884 Score = 40.1 bits (20), Expect = 7.7 Identities = 26/28 (92%) Strand = Plus / Plus Query: 434 ttcttcttcttcttggacttctctttct 461 |||||||||||||| | ||||||||||| Sbjct: 148077 ttcttcttcttcttcgtcttctctttct 148104
>dbj|AB023051.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA class I region, clone:876L4, complete sequence Length = 90244 Score = 40.1 bits (20), Expect = 7.7 Identities = 23/24 (95%) Strand = Plus / Plus Query: 451 cttctctttctcctgctcaccatc 474 ||||||||||| |||||||||||| Sbjct: 61045 cttctctttctgctgctcaccatc 61068 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,960,588 Number of Sequences: 3902068 Number of extensions: 5960588 Number of successful extensions: 697034 Number of sequences better than 10.0: 162 Number of HSP's better than 10.0 without gapping: 164 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 694899 Number of HSP's gapped (non-prelim): 2129 length of query: 568 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 545 effective length of database: 17,143,297,704 effective search space: 9343097248680 effective search space used: 9343097248680 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)