ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah63d06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|AL158193.13| Human DNA sequence from clone RP11-400N12 on ch... 46 0.16
2gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, com... 42 2.4
3gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 42 2.4
4emb|AL805961.22| Human DNA sequence from clone RP11-718D19 on ch... 42 2.4
5gb|AC012352.7| Homo sapiens BAC clone RP11-12M21 from 2, complet... 42 2.4
6gb|AC009227.3|AC009227 Homo sapiens BAC clone RP11-187G20 from 2... 42 2.4
7gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, com... 42 2.4
8gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, co... 42 2.4
9dbj|AB011667.1| Ipomoea purpurea genes for dihydroflavonol 4-red... 42 2.4
10emb|AL671871.4| Mouse DNA sequence from clone RP23-157M14 on chr... 42 2.4
11ref|NM_106003.2| Arabidopsis thaliana calcium ion binding AT1G73... 40 9.6
12gb|AC151766.1| Ornithorhynchus anatinus chromosome UNK clone OAB... 40 9.6
13ref|XM_630965.1| Dictyostelium discoideum hypothetical protein (... 40 9.6
14gb|AC101948.10| Mus musculus chromosome 15, clone RP24-139K14, c... 40 9.6
15gb|AC115719.10| Mus musculus chromosome 18, clone RP24-356J16, c... 40 9.6
16gb|AC147708.7| Canis Familiaris, clone XX-25G10, complete sequence 40 9.6
17gb|AY812459.1| Schistosoma japonicum SJCHGC04555 protein mRNA, p... 40 9.6
18gb|AC153530.9| Mus musculus 10 BAC RP23-202A18 (Roswell Park Can... 40 9.6
19ref|XM_001002894.1| PREDICTED: Mus musculus similar to 60S ribos... 40 9.6
20ref|XM_911987.2| PREDICTED: Mus musculus similar to 60S ribosoma... 40 9.6
21ref|XM_140042.8| PREDICTED: Mus musculus similar to 60S ribosoma... 40 9.6
22gb|AC141478.3| Mus musculus BAC clone RP24-82N16 from chromosome... 40 9.6
23gb|AC132310.3| Mus musculus BAC clone RP24-295G16 from chromosom... 40 9.6
24ref|XM_801027.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 9.6
25ref|XM_803165.1| Trypanosoma cruzi strain CL Brener hypothetical... 40 9.6
26gb|AC123053.4| Mus musculus BAC clone RP24-374O20 from chromosom... 40 9.6
27gb|AC135800.24| Medicago truncatula clone mth2-14g8, complete se... 40 9.6
28emb|AL445591.10| Human DNA sequence from clone RP11-314N2 on chr... 40 9.6
29emb|AL360232.24| Human DNA sequence from clone RP11-374I18 on ch... 40 9.6
30gb|AC091536.2| Rattus norvegicus strain Brown Norway clone RP31-... 40 9.6
31emb|AL137009.8| Human DNA sequence from clone RP3-370O5 on chrom... 40 9.6
32emb|AL121978.5|HSJ520B18 Human DNA sequence from clone RP3-520B1... 40 9.6
33gb|AC158567.3| Mus musculus chromosome 15, clone RP24-93F2, comp... 40 9.6
34gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosom... 40 9.6
35gb|AC157757.24| Medicago truncatula clone mth2-16j22, complete s... 40 9.6
36gb|AC026385.19|AC026385 Mus musculus 17 BAC RP23-413K14 complete... 40 9.6
37gb|AC152945.1| Mus musculus 10 BAC RP23-257F18 (Roswell Park Can... 40 9.6
38gb|AC159473.7| Mus musculus 10 BAC RP23-215E23 (Roswell Park Can... 40 9.6
39gb|AC012396.7|AC012396 Arabidopsis thaliana chromosome 1 BAC T9L... 40 9.6
40dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome 40 9.6
41emb|CT025760.12| Mouse DNA sequence from clone RP23-351E9 on chr... 40 9.6
42gb|AC149062.3| Mus musculus BAC clone RP23-183E20 from 7, comple... 40 9.6
43gb|AC170807.2| Mus musculus BAC clone RP23-374I2 from chromosome... 40 9.6 
>emb|AL158193.13| Human DNA sequence from clone RP11-400N12 on chromosome 13 Contains the
              3' end of the UBL3 gene for ubiquitin-like 3 and a CpG
              island, complete sequence
          Length = 172896

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 509    ctccctgccctgctctgcaagga 531
              |||||||||||||||||||||||
Sbjct: 134234 ctccctgccctgctctgcaagga 134256
to top
>gb|AC115064.9| Mus musculus chromosome 1, clone RP24-401B18, complete sequence
          Length = 184893

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 396   ggatcaattaaatccaaatca 416
             |||||||||||||||||||||
Sbjct: 30869 ggatcaattaaatccaaatca 30889
to top
>gb|AC083890.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-284P20, complete
             sequence
          Length = 203967

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 506   aagctccctgccctgctctgc 526
             |||||||||||||||||||||
Sbjct: 81779 aagctccctgccctgctctgc 81759
to top
>emb|AL805961.22| Human DNA sequence from clone RP11-718D19 on chromosome 1, complete
              sequence
          Length = 166258

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 509    ctccctgccctgctctgcaaggaac 533
              ||||||||||||||||| |||||||
Sbjct: 116091 ctccctgccctgctctggaaggaac 116115
to top
>gb|AC012352.7| Homo sapiens BAC clone RP11-12M21 from 2, complete sequence
          Length = 168142

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 197    tgataaactacaacagatcat 217
              |||||||||||||||||||||
Sbjct: 134418 tgataaactacaacagatcat 134438
to top
>gb|AC009227.3|AC009227 Homo sapiens BAC clone RP11-187G20 from 2, complete sequence
          Length = 174149

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 94   attcatattcactgccatataatgttcta 122
            |||||| ||||||| ||||||||||||||
Sbjct: 5310 attcattttcactggcatataatgttcta 5338
to top
>gb|AC110033.9| Mus musculus chromosome 1, clone RP23-117O18, complete sequence
          Length = 260404

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 396   ggatcaattaaatccaaatca 416
             |||||||||||||||||||||
Sbjct: 57941 ggatcaattaaatccaaatca 57921
to top
>gb|AC108796.10| Mus musculus chromosome 1, clone RP23-349L18, complete sequence
          Length = 188713

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 396   ggatcaattaaatccaaatca 416
             |||||||||||||||||||||
Sbjct: 72460 ggatcaattaaatccaaatca 72440
to top
>dbj|AB011667.1| Ipomoea purpurea genes for dihydroflavonol 4-reductase, complete cds
          Length = 16845

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 127  tcccatgcatgcatgcaaata 147
            |||||||||||||||||||||
Sbjct: 2140 tcccatgcatgcatgcaaata 2160
to top
>emb|AL671871.4| Mouse DNA sequence from clone RP23-157M14 on chromosome 4, complete
             sequence
          Length = 199593

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 359   aatggaccaaagctggcttca 379
             |||||||||||||||||||||
Sbjct: 19356 aatggaccaaagctggcttca 19376
to top
>ref|NM_106003.2| Arabidopsis thaliana calcium ion binding AT1G73440 mRNA, complete
           cds
          Length = 988

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 270 tacataagtcatcttcttag 289
           ||||||||||||||||||||
Sbjct: 912 tacataagtcatcttcttag 931
to top
>gb|AC151766.1| Ornithorhynchus anatinus chromosome UNK clone OABb-433A1, complete
             sequence
          Length = 161653

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 494   cttctccagctgaagctccc 513
             ||||||||||||||||||||
Sbjct: 45290 cttctccagctgaagctccc 45309
to top
>ref|XM_630965.1| Dictyostelium discoideum hypothetical protein (DDB0188520), partial
            mRNA
          Length = 2694

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 397  gatcaattaaatccaaatca 416
            ||||||||||||||||||||
Sbjct: 2302 gatcaattaaatccaaatca 2283
to top
>gb|AC101948.10| Mus musculus chromosome 15, clone RP24-139K14, complete sequence
          Length = 182534

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 646    ccaatgctattgtctttata 665
              ||||||||||||||||||||
Sbjct: 147055 ccaatgctattgtctttata 147036
to top
>gb|AC115719.10| Mus musculus chromosome 18, clone RP24-356J16, complete sequence
          Length = 177037

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 672    tcaaaacttctgatgaaatt 691
              ||||||||||||||||||||
Sbjct: 176344 tcaaaacttctgatgaaatt 176325
to top
>gb|AC147708.7| Canis Familiaris, clone XX-25G10, complete sequence
          Length = 185084

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 496   tctccagctgaagctccctg 515
             ||||||||||||||||||||
Sbjct: 57108 tctccagctgaagctccctg 57089
to top
>gb|AY812459.1| Schistosoma japonicum SJCHGC04555 protein mRNA, partial cds
          Length = 914

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 590 attcagtacgaagaatgtga 609
           ||||||||||||||||||||
Sbjct: 703 attcagtacgaagaatgtga 684
to top
>gb|AC153530.9| Mus musculus 10 BAC RP23-202A18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 192392

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 124    atttcccatgcatgcatgca 143
              ||||||||||||||||||||
Sbjct: 110727 atttcccatgcatgcatgca 110746
to top
>ref|XM_001002894.1| PREDICTED: Mus musculus similar to 60S ribosomal protein L29
           (LOC672948), mRNA
          Length = 691

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 473 ctgagcacctttggaagcct 492
           ||||||||||||||||||||
Sbjct: 516 ctgagcacctttggaagcct 497
to top
>ref|XM_911987.2| PREDICTED: Mus musculus similar to 60S ribosomal protein L29
           (LOC240110), mRNA
          Length = 592

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 473 ctgagcacctttggaagcct 492
           ||||||||||||||||||||
Sbjct: 417 ctgagcacctttggaagcct 398
to top
>ref|XM_140042.8| PREDICTED: Mus musculus similar to 60S ribosomal protein L29
           (LOC240110), mRNA
          Length = 592

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 473 ctgagcacctttggaagcct 492
           ||||||||||||||||||||
Sbjct: 417 ctgagcacctttggaagcct 398
to top
>gb|AC141478.3| Mus musculus BAC clone RP24-82N16 from chromosome 18, complete sequence
          Length = 184122

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 672   tcaaaacttctgatgaaatt 691
             ||||||||||||||||||||
Sbjct: 61117 tcaaaacttctgatgaaatt 61098
to top
>gb|AC132310.3| Mus musculus BAC clone RP24-295G16 from chromosome 16, complete
             sequence
          Length = 136671

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 602   gaatgtgacaaagtcaactt 621
             ||||||||||||||||||||
Sbjct: 15745 gaatgtgacaaagtcaactt 15726
to top
>ref|XM_801027.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053507873.60) partial mRNA
          Length = 849

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 31  ttcaagtttatatcatagta 50
           ||||||||||||||||||||
Sbjct: 422 ttcaagtttatatcatagta 403
to top
>ref|XM_803165.1| Trypanosoma cruzi strain CL Brener hypothetical protein
           (Tc00.1047053510691.10) partial mRNA
          Length = 849

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 31  ttcaagtttatatcatagta 50
           ||||||||||||||||||||
Sbjct: 422 ttcaagtttatatcatagta 403
to top
>gb|AC123053.4| Mus musculus BAC clone RP24-374O20 from chromosome 7, complete sequence
          Length = 184618

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 551    ggactgaatgtgaaatgtcatcaa 574
              ||||||||||||||||||| ||||
Sbjct: 167104 ggactgaatgtgaaatgtcctcaa 167081
to top
>gb|AC135800.24| Medicago truncatula clone mth2-14g8, complete sequence
          Length = 125467

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 126   ttcccatgcatgcatgcaaa 145
             ||||||||||||||||||||
Sbjct: 60973 ttcccatgcatgcatgcaaa 60992
to top
>emb|AL445591.10| Human DNA sequence from clone RP11-314N2 on chromosome 1 Contains a novel
              processed pseudogene, the GJA8 gene for gap junction
              protein alpha 8, 50kDa (connexin 50) protein,  the 5' end
              of the gene for putative G-protein coupled receptor (SH120)
              and a CpG island, complete sequence
          Length = 140092

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 665    agggatatcaaaacttctga 684
              ||||||||||||||||||||
Sbjct: 119497 agggatatcaaaacttctga 119478
to top
>emb|AL360232.24| Human DNA sequence from clone RP11-374I18 on chromosome 6, complete
              sequence
          Length = 157784

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 17     aaacacctcttctcttcaagttta 40
              |||||||||||||||||| |||||
Sbjct: 138455 aaacacctcttctcttcacgttta 138432
to top
>gb|AC091536.2| Rattus norvegicus strain Brown Norway clone RP31-547A5, complete
             sequence
          Length = 175512

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 507   agctccctgccctgctctgc 526
             ||||||||||||||||||||
Sbjct: 95991 agctccctgccctgctctgc 95972
to top
>emb|AL137009.8| Human DNA sequence from clone RP3-370O5 on chromosome 6 Contains the 5'
             end of a novel gene containing FLJ13942 and a CpG island,
             complete sequence
          Length = 113254

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 201   aaactacaacagatcatatt 220
             ||||||||||||||||||||
Sbjct: 81366 aaactacaacagatcatatt 81347
to top
>emb|AL121978.5|HSJ520B18 Human DNA sequence from clone RP3-520B18 on chromosome 6p24.1-25.3
             Contains the 5' end of the gene for phenylalanine-tRNA
             synthetase (FARS1), a microtubule-associated protein 1A/1B
             light chain 3 pseudogene and a CpG island, complete
             sequence
          Length = 148385

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 188   aaatgaccatgataaactac 207
             ||||||||||||||||||||
Sbjct: 90328 aaatgaccatgataaactac 90347
to top
>gb|AC158567.3| Mus musculus chromosome 15, clone RP24-93F2, complete sequence
          Length = 188718

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 646    ccaatgctattgtctttata 665
              ||||||||||||||||||||
Sbjct: 124215 ccaatgctattgtctttata 124196
to top
>gb|AC159819.2| Mus musculus BAC clone RP23-180C14 from chromosome 9, complete sequence
          Length = 211119

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 511    ccctgccctgctctgcaagg 530
              ||||||||||||||||||||
Sbjct: 178712 ccctgccctgctctgcaagg 178693
to top
>gb|AC157757.24| Medicago truncatula clone mth2-16j22, complete sequence
          Length = 139728

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   ttcccatgcatgcatgcaaa 145
             ||||||||||||||||||||
Sbjct: 78684 ttcccatgcatgcatgcaaa 78665
to top
>gb|AC026385.19|AC026385 Mus musculus 17 BAC RP23-413K14 complete sequence
          Length = 222610

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 473    ctgagcacctttggaagcct 492
              ||||||||||||||||||||
Sbjct: 118560 ctgagcacctttggaagcct 118541
to top
>gb|AC152945.1| Mus musculus 10 BAC RP23-257F18 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 175982

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 509    ctccctgccctgctctgcaa 528
              ||||||||||||||||||||
Sbjct: 103977 ctccctgccctgctctgcaa 103996
to top
>gb|AC159473.7| Mus musculus 10 BAC RP23-215E23 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190387

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 509    ctccctgccctgctctgcaa 528
              ||||||||||||||||||||
Sbjct: 174597 ctccctgccctgctctgcaa 174578
to top
>gb|AC012396.7|AC012396 Arabidopsis thaliana chromosome 1 BAC T9L24 genomic sequence, complete
             sequence
          Length = 90459

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 270   tacataagtcatcttcttag 289
             ||||||||||||||||||||
Sbjct: 40677 tacataagtcatcttcttag 40658
to top
>dbj|BA000001.2| Pyrococcus horikoshii OT3 DNA, complete genome
          Length = 1738505

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 659     ctttatagggatatcaaaac 678
               ||||||||||||||||||||
Sbjct: 1179782 ctttatagggatatcaaaac 1179763
to top
>emb|CT025760.12| Mouse DNA sequence from clone RP23-351E9 on chromosome 17, complete
             sequence
          Length = 128479

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 473   ctgagcacctttggaagcct 492
             ||||||||||||||||||||
Sbjct: 80144 ctgagcacctttggaagcct 80125
to top
>gb|AC149062.3| Mus musculus BAC clone RP23-183E20 from 7, complete sequence
          Length = 229956

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 551   ggactgaatgtgaaatgtcatcaa 574
             ||||||||||||||||||| ||||
Sbjct: 80992 ggactgaatgtgaaatgtcctcaa 80969
to top
>gb|AC170807.2| Mus musculus BAC clone RP23-374I2 from chromosome 17, complete sequence
          Length = 208318

 Score = 40.1 bits (20), Expect = 9.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 473   ctgagcacctttggaagcct 492
             ||||||||||||||||||||
Sbjct: 52329 ctgagcacctttggaagcct 52310


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,258,443
Number of Sequences: 3902068
Number of extensions: 6258443
Number of successful extensions: 139422
Number of sequences better than 10.0: 43
Number of HSP's better than 10.0 without gapping: 43
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 139293
Number of HSP's gapped (non-prelim): 129
length of query: 700
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 677
effective length of database: 17,143,297,704
effective search space: 11606012545608
effective search space used: 11606012545608
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top