ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah62m19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC135418.3| Oryza sativa (japonica cultivar-group) chromosome... 141 2e-30
2dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 141 2e-30
3gb|AC150391.2| Branchiostoma floridae clone CH302-119J21, comple... 42 1.5
4gb|AY182007.1| Monoblepharella sp. JEL15 mitochondrion, complete... 42 1.5
5gb|AC107734.13| Mus musculus chromosome 7, clone RP23-399E4, com... 40 5.8
6ref|XM_630278.1| Dictyostelium discoideum hypothetical protein (... 40 5.8
7gb|AC112953.15| Mus musculus chromosome 7, clone RP23-44J21, com... 40 5.8
8gb|AY534123.1|SEG_AY534122S2 Aegilops tauschii transposons Caspa... 40 5.8
9gb|AC122923.4| Mus musculus BAC clone RP23-36G5 from 10, complet... 40 5.8
10gb|AC127319.4| Mus musculus BAC clone RP23-229N3 from 5, complet... 40 5.8
11gb|AC124120.5| Mus musculus chromosome 1, clone RP24-64M13, comp... 40 5.8
12emb|AL591804.5| Human DNA sequence from clone RP11-457O1 on chro... 40 5.8
13gb|AC161432.5| Mus musculus chromosome 1, clone RP23-453N14, com... 40 5.8
14emb|BX510946.18| Zebrafish DNA sequence from clone CH211-9F9 in ... 40 5.8
15gb|AC005185.1| Homo sapiens Xp22 BAC GSHB-383H3 (Genome Systems ... 40 5.8
16emb|CR762498.10| Zebrafish DNA sequence from clone DKEY-4J1 in l... 40 5.8
17gb|AC116364.2| Homo sapiens chromosome 5 clone RP11-767I1, compl... 40 5.8
18gb|AC019188.6| Homo sapiens BAC clone RP11-309H6 from 4, complet... 40 5.8
19gb|AC092331.2| Homo sapiens chromosome 5 clone RP11-163B12, comp... 40 5.8
20emb|CR388026.3| Mouse DNA sequence from clone RP23-39L16 on chro... 40 5.8
21gb|AC158543.2| Mus musculus BAC clone RP23-425C23 from chromosom... 40 5.8
22gb|AC158680.4| Mus musculus 6 BAC RP23-112F6 (Roswell Park Cance... 40 5.8
23gb|AC022345.2|AC022345 Drosophila melanogaster, chromosome X, re... 40 5.8
24gb|AC018488.7|AC018488 Drosophila melanogaster, chromosome X, re... 40 5.8
25gb|AC154702.2| Mus musculus BAC clone RP24-348D9 from chromosome... 40 5.8
26gb|AC116469.13| Mus musculus chromosome 5, clone RP23-171F16, co... 40 5.8
27gb|AE003498.5| Drosophila melanogaster chromosome X, section 50 ... 40 5.8
28gb|AC079681.38| Mus musculus strain C57BL/6J chromosome 10 clone... 40 5.8
29emb|AL831757.5| Mouse DNA sequence from clone RP23-279A21 on chr... 40 5.8

>gb|AC135418.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0035J16, complete sequence
          Length = 170233

 Score =  141 bits (71), Expect = 2e-30
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                         
Query: 312   aaaatcactgggaagaaatgaatctggccttcgggttttgtttgggtctctttgaagtaa 371
             |||||||| |||||||||||||| || ||||||||||||||||||||||| ||||| |||
Sbjct: 69447 aaaatcacagggaagaaatgaatttgcccttcgggttttgtttgggtctccttgaaataa 69506

                                                                   
Query: 372   acaaggataggaaattgtggccaccatagttnccagttcacaaaggttgagtac 425
             || | ||||||||||||||||||||| |||| ||| |||||||| |||||||||
Sbjct: 69507 accaagataggaaattgtggccaccacagttcccaattcacaaatgttgagtac 69560



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                               
Query: 258   gtttccgacggnccagcacgctccaccataatatcatagagttgncggcc 307
             |||||||| || ||||||||||||||||||  |||||| || || |||||
Sbjct: 69317 gtttccgaaggtccagcacgctccaccatagcatcataaagctgtcggcc 69366



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  141 bits (71), Expect = 2e-30
 Identities = 103/114 (90%)
 Strand = Plus / Plus

                                                                            
Query: 312      aaaatcactgggaagaaatgaatctggccttcgggttttgtttgggtctctttgaagtaa 371
                |||||||| |||||||||||||| || ||||||||||||||||||||||| ||||| |||
Sbjct: 19366098 aaaatcacagggaagaaatgaatttgcccttcgggttttgtttgggtctccttgaaataa 19366157

                                                                      
Query: 372      acaaggataggaaattgtggccaccatagttnccagttcacaaaggttgagtac 425
                || | ||||||||||||||||||||| |||| ||| |||||||| |||||||||
Sbjct: 19366158 accaagataggaaattgtggccaccacagttcccaattcacaaatgttgagtac 19366211



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                                  
Query: 258      gtttccgacggnccagcacgctccaccataatatcatagagttgncggcc 307
                |||||||| || ||||||||||||||||||  |||||| || || |||||
Sbjct: 19365968 gtttccgaaggtccagcacgctccaccatagcatcataaagctgtcggcc 19366017



to top

>gb|AC150391.2| Branchiostoma floridae clone CH302-119J21, complete sequence
          Length = 157607

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 137    tttcttcaaataatgcatggagatt 161
              ||||||||||||| |||||||||||
Sbjct: 107960 tttcttcaaataaagcatggagatt 107936



to top

>gb|AY182007.1| Monoblepharella sp. JEL15 mitochondrion, complete genome
          Length = 60432

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 199  gattttggctcctggaactta 219
            |||||||||||||||||||||
Sbjct: 1134 gattttggctcctggaactta 1154



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 199 gattttggctcctggaactt 218
           ||||||||||||||||||||
Sbjct: 232 gattttggctcctggaactt 213



to top

>gb|AC107734.13| Mus musculus chromosome 7, clone RP23-399E4, complete sequence
          Length = 198485

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 346    gttttgtttgggtctctttg 365
              ||||||||||||||||||||
Sbjct: 160216 gttttgtttgggtctctttg 160235



to top

>ref|XM_630278.1| Dictyostelium discoideum hypothetical protein (DDB0189286), partial
            mRNA
          Length = 4728

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 68   aacaattatttgattcatct 87
            ||||||||||||||||||||
Sbjct: 2744 aacaattatttgattcatct 2763



to top

>gb|AC112953.15| Mus musculus chromosome 7, clone RP23-44J21, complete sequence
          Length = 205513

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 372    acaaggataggaaattgtgg 391
              ||||||||||||||||||||
Sbjct: 135797 acaaggataggaaattgtgg 135816



to top

>gb|AY534123.1|SEG_AY534122S2 Aegilops tauschii transposons Caspar, XJ, Angela, and XJ, complete
             sequence; LRR protein WM1.7 (WM1.7) and LRR protein WM1.12
             (WM1.12) genes, complete cds; transposons Ophelia2,
             Angela3s, and XJ3, complete sequence; LRR protein WM1.3
             (WM1.3) gene, complete cds; Stowaway MITE, transposons
             XJ1, Jody, Angela, and XJ and Stowaway MITE, complete
             sequence; LRR protein WM1.2 (WM1.2) and LLR protein WM1.1
             (WM1.1) genes, complete cds; transposons XJ, XA, Angela,
             and Fred and WM1.11 gene, complete sequence; RPM1-like
             sequence and LRR protein WM1.10 (WM1.10) genes, complete
             cds; and transposon XJ, complete sequence
          Length = 198649

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/29 (89%)
 Strand = Plus / Plus

                                          
Query: 100   ccgtngcancgcacgggcatnctactagt 128
             |||| ||| ||||||||||| ||||||||
Sbjct: 62807 ccgtggcaacgcacgggcattctactagt 62835



to top

>gb|AC122923.4| Mus musculus BAC clone RP23-36G5 from 10, complete sequence
          Length = 242112

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 312   aaaatcactgggaagaaatg 331
             ||||||||||||||||||||
Sbjct: 62657 aaaatcactgggaagaaatg 62676



to top

>gb|AC127319.4| Mus musculus BAC clone RP23-229N3 from 5, complete sequence
          Length = 188794

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 133   gtagtttcttcaaataatgcatgg 156
             |||||||||| |||||||||||||
Sbjct: 39049 gtagtttcttaaaataatgcatgg 39072



to top

>gb|AC124120.5| Mus musculus chromosome 1, clone RP24-64M13, complete sequence
          Length = 242227

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 175    aacacacttaatgaagacac 194
              ||||||||||||||||||||
Sbjct: 160322 aacacacttaatgaagacac 160303



to top

>emb|AL591804.5| Human DNA sequence from clone RP11-457O1 on chromosome X, complete
             sequence
          Length = 112366

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 36    tacatcatgttggatataca 55
             ||||||||||||||||||||
Sbjct: 60979 tacatcatgttggatataca 60998



to top

>gb|AC161432.5| Mus musculus chromosome 1, clone RP23-453N14, complete sequence
          Length = 199303

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 175   aacacacttaatgaagacac 194
             ||||||||||||||||||||
Sbjct: 67457 aacacacttaatgaagacac 67438



to top

>emb|BX510946.18| Zebrafish DNA sequence from clone CH211-9F9 in linkage group 13,
             complete sequence
          Length = 103700

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   aagtagtttcttcaaataat 150
             ||||||||||||||||||||
Sbjct: 92683 aagtagtttcttcaaataat 92664



to top

>gb|AC005185.1| Homo sapiens Xp22 BAC GSHB-383H3 (Genome Systems Human BAC Library)
             complete sequence
          Length = 124351

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   gaaaatcactgggaagaaat 330
             ||||||||||||||||||||
Sbjct: 86021 gaaaatcactgggaagaaat 86002



to top

>emb|CR762498.10| Zebrafish DNA sequence from clone DKEY-4J1 in linkage group 13,
             complete sequence
          Length = 169361

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 131   aagtagtttcttcaaataat 150
             ||||||||||||||||||||
Sbjct: 83977 aagtagtttcttcaaataat 83958



to top

>gb|AC116364.2| Homo sapiens chromosome 5 clone RP11-767I1, complete sequence
          Length = 188887

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 125   tagttgaagtagtttcttca 144
             ||||||||||||||||||||
Sbjct: 67685 tagttgaagtagtttcttca 67704



to top

>gb|AC019188.6| Homo sapiens BAC clone RP11-309H6 from 4, complete sequence
          Length = 207835

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 144    aaataatgcatggagatttc 163
              ||||||||||||||||||||
Sbjct: 134091 aaataatgcatggagatttc 134072



to top

>gb|AC092331.2| Homo sapiens chromosome 5 clone RP11-163B12, complete sequence
          Length = 162153

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 125    tagttgaagtagtttcttca 144
              ||||||||||||||||||||
Sbjct: 129264 tagttgaagtagtttcttca 129245



to top

>emb|CR388026.3| Mouse DNA sequence from clone RP23-39L16 on chromosome 2, complete
             sequence
          Length = 26069

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 335   ctggccttcgggttttgttt 354
             ||||||||||||||||||||
Sbjct: 22243 ctggccttcgggttttgttt 22262



to top

>gb|AC158543.2| Mus musculus BAC clone RP23-425C23 from chromosome 13, complete
             sequence
          Length = 201777

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   agttgaagtagtttcttcaa 145
             ||||||||||||||||||||
Sbjct: 22763 agttgaagtagtttcttcaa 22744



to top

>gb|AC158680.4| Mus musculus 6 BAC RP23-112F6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 206705

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 310    tgaaaatcactgggaagaaatgaa 333
              |||||||||||| |||||||||||
Sbjct: 120089 tgaaaatcactgagaagaaatgaa 120066



to top

>gb|AC022345.2|AC022345 Drosophila melanogaster, chromosome X, region 12F-13A, BAC clone
              BACR10J19, complete sequence
          Length = 182416

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 53     acacttccaaataagaacaattat 76
              |||||||||| |||||||||||||
Sbjct: 175202 acacttccaattaagaacaattat 175225



to top

>gb|AC018488.7|AC018488 Drosophila melanogaster, chromosome X, region 13A-13B, BAC clone
             BACR09F03, complete sequence
          Length = 165118

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 53    acacttccaaataagaacaattat 76
             |||||||||| |||||||||||||
Sbjct: 26328 acacttccaattaagaacaattat 26351



to top

>gb|AC154702.2| Mus musculus BAC clone RP24-348D9 from chromosome 13, complete sequence
          Length = 157775

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 126   agttgaagtagtttcttcaa 145
             ||||||||||||||||||||
Sbjct: 96724 agttgaagtagtttcttcaa 96705



to top

>gb|AC116469.13| Mus musculus chromosome 5, clone RP23-171F16, complete sequence
          Length = 207364

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 133   gtagtttcttcaaataatgcatgg 156
             |||||||||| |||||||||||||
Sbjct: 15795 gtagtttcttaaaataatgcatgg 15772



to top

>gb|AE003498.5| Drosophila melanogaster chromosome X, section 50 of 74 of the complete
             sequence
          Length = 341520

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 53    acacttccaaataagaacaattat 76
             |||||||||| |||||||||||||
Sbjct: 27083 acacttccaattaagaacaattat 27106



to top

>gb|AC079681.38| Mus musculus strain C57BL/6J chromosome 10 clone rp23-310n21, complete
              sequence
          Length = 216807

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 312    aaaatcactgggaagaaatg 331
              ||||||||||||||||||||
Sbjct: 199396 aaaatcactgggaagaaatg 199415



to top

>emb|AL831757.5| Mouse DNA sequence from clone RP23-279A21 on chromosome X, complete
             sequence
          Length = 85948

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 306   ccattgaaaatcactgggaa 325
             ||||||||||||||||||||
Sbjct: 70860 ccattgaaaatcactgggaa 70879


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,645,216
Number of Sequences: 3902068
Number of extensions: 3645216
Number of successful extensions: 62158
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62079
Number of HSP's gapped (non-prelim): 79
length of query: 430
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 408
effective length of database: 17,147,199,772
effective search space: 6996057506976
effective search space used: 6996057506976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top