ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbah62l19 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC011462.4| Homo sapiens chromosome 19 clone CTC-435M10, complete sequence Length = 148841 Score = 42.1 bits (21), Expect = 0.38 Identities = 21/21 (100%) Strand = Plus / Minus Query: 29 tgctcctcagatctagctagg 49 ||||||||||||||||||||| Sbjct: 132899 tgctcctcagatctagctagg 132879
>gb|AC011510.7|AC011510 Homo sapiens chromosome 19 clone CTD-2195B23, complete sequence Length = 129402 Score = 42.1 bits (21), Expect = 0.38 Identities = 21/21 (100%) Strand = Plus / Plus Query: 29 tgctcctcagatctagctagg 49 ||||||||||||||||||||| Sbjct: 126614 tgctcctcagatctagctagg 126634
>emb|CR956639.4| Pig DNA sequence from clone CH242-279P20 on chromosome 17, complete sequence Length = 50643 Score = 42.1 bits (21), Expect = 0.38 Identities = 21/21 (100%) Strand = Plus / Plus Query: 52 ggagacagtccaaatttatac 72 ||||||||||||||||||||| Sbjct: 1798 ggagacagtccaaatttatac 1818
>gb|AC105460.4| Homo sapiens BAC clone RP11-297P16 from 4, complete sequence Length = 185755 Score = 40.1 bits (20), Expect = 1.5 Identities = 23/24 (95%) Strand = Plus / Minus Query: 1 agaaaaatgcactgctttcaagtt 24 ||||||||| |||||||||||||| Sbjct: 161747 agaaaaatgaactgctttcaagtt 161724
>emb|AL161621.11| Human DNA sequence from clone RP11-51G5 on chromosome 6 Contains two novel genes and a CpG island, complete sequence Length = 96715 Score = 38.2 bits (19), Expect = 5.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 47 agggtggagacagtccaaa 65 ||||||||||||||||||| Sbjct: 46243 agggtggagacagtccaaa 46225
>ref|XM_779127.1| PREDICTED: Strongylocentrotus purpuratus similar to Transcription intermediary factor 1-gamma (TIF1-gamma) (RET-fused gene 7 protein) (Rfg7 protein) (Tripartite motif protein 33) (LOC578991), partial mRNA Length = 633 Score = 38.2 bits (19), Expect = 5.9 Identities = 22/23 (95%) Strand = Plus / Plus Query: 4 aaaatgcactgctttcaagtttc 26 |||||||||||||| |||||||| Sbjct: 312 aaaatgcactgcttgcaagtttc 334
>ref|XM_786305.1| PREDICTED: Strongylocentrotus purpuratus similar to Transcription intermediary factor 1-gamma (TIF1-gamma) (RET-fused gene 7 protein) (Rfg7 protein) (Tripartite motif protein 33) (LOC586527), partial mRNA Length = 636 Score = 38.2 bits (19), Expect = 5.9 Identities = 22/23 (95%) Strand = Plus / Plus Query: 4 aaaatgcactgctttcaagtttc 26 |||||||||||||| |||||||| Sbjct: 312 aaaatgcactgcttgcaagtttc 334
>ref|XM_786943.1| PREDICTED: Strongylocentrotus purpuratus similar to Transcription intermediary factor 1-gamma (TIF1-gamma) (RET-fused gene 7 protein) (Rfg7 protein) (Tripartite motif protein 33) (LOC587200), mRNA Length = 828 Score = 38.2 bits (19), Expect = 5.9 Identities = 22/23 (95%) Strand = Plus / Plus Query: 4 aaaatgcactgctttcaagtttc 26 |||||||||||||| |||||||| Sbjct: 312 aaaatgcactgcttgcaagtttc 334
>gb|AC021657.19| Homo sapiens 3 BAC RP11-490B19 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 170046 Score = 38.2 bits (19), Expect = 5.9 Identities = 19/19 (100%) Strand = Plus / Plus Query: 55 gacagtccaaatttatact 73 ||||||||||||||||||| Sbjct: 45808 gacagtccaaatttatact 45826
>gb|AC116664.1| Papio hamadryas, clone RP41-57E23, complete sequence Length = 175388 Score = 38.2 bits (19), Expect = 5.9 Identities = 22/23 (95%) Strand = Plus / Plus Query: 52 ggagacagtccaaatttatactc 74 ||||||||||||||||| ||||| Sbjct: 76201 ggagacagtccaaatttttactc 76223
>gb|AE000657.1| Aquifex aeolicus VF5, complete genome Length = 1551335 Score = 38.2 bits (19), Expect = 5.9 Identities = 19/19 (100%) Strand = Plus / Minus Query: 101 tgagcgaaatggaaaaggg 119 ||||||||||||||||||| Sbjct: 248386 tgagcgaaatggaaaaggg 248368 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,008,211 Number of Sequences: 3902068 Number of extensions: 1008211 Number of successful extensions: 76412 Number of sequences better than 10.0: 11 Number of HSP's better than 10.0 without gapping: 11 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 76386 Number of HSP's gapped (non-prelim): 26 length of query: 126 length of database: 17,233,045,268 effective HSP length: 21 effective length of query: 105 effective length of database: 17,151,101,840 effective search space: 1800865693200 effective search space used: 1800865693200 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
