ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah63a12
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_026198.1| Mus musculus RIKEN cDNA 2010200O16 gene (201020... 40 4.1
2gb|BC055449.1| Mus musculus RIKEN cDNA 2010200O16 gene, mRNA (cD... 40 4.1
3gb|AC104510.6| Drosophila melanogaster X BAC RP98-26J12 (Roswell... 40 4.1
4emb|AL683823.11| Mouse DNA sequence from clone RP23-128G10 on ch... 40 4.1
5dbj|AK046697.1| Mus musculus 4 days neonate male adipose cDNA, R... 40 4.1
6dbj|AK008415.1| Mus musculus adult male small intestine cDNA, RI... 40 4.1
7dbj|AK017252.1| Mus musculus 6 days neonate head cDNA, RIKEN ful... 40 4.1
8gb|AC009277.4|AC009277 Homo sapiens chromosome 18, clone RP11-48... 40 4.1
9gb|BC050932.1| Mus musculus RIKEN cDNA 2010200O16 gene, mRNA (cD... 40 4.1
10gb|AE003485.3| Drosophila melanogaster chromosome X, section 37 ... 40 4.1
11gb|AC113207.8| Mus musculus chromosome 10, clone RP23-323O18, co... 40 4.1
12dbj|D28763.1|MBFASPC Methanobacterium thermoformicicum aspC gene... 40 4.1 
>ref|NM_026198.1| Mus musculus RIKEN cDNA 2010200O16 gene (2010200O16Rik), mRNA
          Length = 2778

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   tattaaaaagtacaggaaga 36
            ||||||||||||||||||||
Sbjct: 2443 tattaaaaagtacaggaaga 2462
to top
>gb|BC055449.1| Mus musculus RIKEN cDNA 2010200O16 gene, mRNA (cDNA clone MGC:65337
            IMAGE:3993993), complete cds
          Length = 2811

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   tattaaaaagtacaggaaga 36
            ||||||||||||||||||||
Sbjct: 2452 tattaaaaagtacaggaaga 2471
to top
>gb|AC104510.6| Drosophila melanogaster X BAC RP98-26J12 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 168583

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   gcaagcagtggaaaacatgt 125
             ||||||||||||||||||||
Sbjct: 42235 gcaagcagtggaaaacatgt 42216
to top
>emb|AL683823.11| Mouse DNA sequence from clone RP23-128G10 on chromosome 3, complete
             sequence
          Length = 180483

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 17    tattaaaaagtacaggaaga 36
             ||||||||||||||||||||
Sbjct: 76967 tattaaaaagtacaggaaga 76948
to top
>dbj|AK046697.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
            enriched library, clone:B430316J05 product:PROTEIN X 013
            homolog [Homo sapiens], full insert sequence
          Length = 2513

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   tattaaaaagtacaggaaga 36
            ||||||||||||||||||||
Sbjct: 2429 tattaaaaagtacaggaaga 2448
to top
>dbj|AK008415.1| Mus musculus adult male small intestine cDNA, RIKEN full-length
            enriched library, clone:2010200O16 product:PROTEIN X 013
            homolog [Homo sapiens], full insert sequence
          Length = 2778

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   tattaaaaagtacaggaaga 36
            ||||||||||||||||||||
Sbjct: 2443 tattaaaaagtacaggaaga 2462
to top
>dbj|AK017252.1| Mus musculus 6 days neonate head cDNA, RIKEN full-length enriched
           library, clone:5430401E11 product:unclassifiable, full
           insert sequence
          Length = 1440

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 17  tattaaaaagtacaggaaga 36
           ||||||||||||||||||||
Sbjct: 145 tattaaaaagtacaggaaga 164
to top
>gb|AC009277.4|AC009277 Homo sapiens chromosome 18, clone RP11-481E24, complete sequence
          Length = 160401

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 263   tgtatcctccttattcattt 282
             ||||||||||||||||||||
Sbjct: 28528 tgtatcctccttattcattt 28509
to top
>gb|BC050932.1| Mus musculus RIKEN cDNA 2010200O16 gene, mRNA (cDNA clone MGC:63285
            IMAGE:6811263), complete cds
          Length = 2800

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 17   tattaaaaagtacaggaaga 36
            ||||||||||||||||||||
Sbjct: 2433 tattaaaaagtacaggaaga 2452
to top
>gb|AE003485.3| Drosophila melanogaster chromosome X, section 37 of 74 of the complete
             sequence
          Length = 283075

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 106   gcaagcagtggaaaacatgt 125
             ||||||||||||||||||||
Sbjct: 22428 gcaagcagtggaaaacatgt 22409
to top
>gb|AC113207.8| Mus musculus chromosome 10, clone RP23-323O18, complete sequence
          Length = 237187

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 257    agatcatgtatcctccttat 276
              ||||||||||||||||||||
Sbjct: 172880 agatcatgtatcctccttat 172899
to top
>dbj|D28763.1|MBFASPC Methanobacterium thermoformicicum aspC gene for aspartate
            aminotransferase, complete cds
          Length = 2292

 Score = 40.1 bits (20), Expect = 4.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 19   ttaaaaagtacaggaagagc 38
            ||||||||||||||||||||
Sbjct: 1055 ttaaaaagtacaggaagagc 1074


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,867,966
Number of Sequences: 3902068
Number of extensions: 2867966
Number of successful extensions: 48775
Number of sequences better than 10.0: 12
Number of HSP's better than 10.0 without gapping: 12
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48758
Number of HSP's gapped (non-prelim): 17
length of query: 314
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 292
effective length of database: 17,147,199,772
effective search space: 5006982333424
effective search space used: 5006982333424
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top