>emb|AL161636.21| Human DNA sequence from clone RP1-140J1 on chromosome 1 Contains a
             novel gene, two novel small proline rich proteins, a
             ribosomal protein, large, P0 (RPLP0) pseudogene, the  LOR
             gene for loricri and the 3' end of the PGLYRPIalpha gene
             for peptidoglycan recognition protein-I-alpha, complete
             sequence
          Length = 137712

 Score = 44.1 bits (22), Expect = 0.65
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 183   tgctgttatatgagaaaacaac 204
             ||||||||||||||||||||||
Sbjct: 89960 tgctgttatatgagaaaacaac 89981

>dbj|AP006628.1| Onion yellows phytoplasma OY-M DNA, complete genome
          Length = 860631

 Score = 44.1 bits (22), Expect = 0.65
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 226    gacaaatctagttttttccttg 247
              ||||||||||||||||||||||
Sbjct: 326515 gacaaatctagttttttccttg 326494

>gb|AC135357.3| Mus musculus chromosome 8 clone RP24-84L15, complete sequence
          Length = 175089

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 514   acatggaaattgtcagactca 534
             |||||||||||||||||||||
Sbjct: 55495 acatggaaattgtcagactca 55515

>gb|CP000061.1| Aster yellows witches'-broom phytoplasma AYWB, complete genome
          Length = 706569

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 227    acaaatctagttttttccttg 247
              |||||||||||||||||||||
Sbjct: 451258 acaaatctagttttttccttg 451278

>gb|AC117196.3| Mus musculus BAC clone RP23-108H19 from 8, complete sequence
          Length = 185947

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 183   tgctgttatatgagaaaacaa 203
             |||||||||||||||||||||
Sbjct: 19237 tgctgttatatgagaaaacaa 19217

>emb|AL138815.6| Human DNA sequence from clone RP11-141F12 on chromosome 13 Contains
             part of the ATP8A2 gene for ATPase, aminophospholipid
             transporter-like, Class I, type 8A, member 2 (ML-1 protein
             (IB, ATP, ML-1, ATPIB, DKFZP434B1913)), a novel pseudogene
             and a CpG island, complete sequence
          Length = 160210

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 89    aatttaaaaacatgagccaat 109
             |||||||||||||||||||||
Sbjct: 26108 aatttaaaaacatgagccaat 26128

>emb|AL766849.1|SAG766849 Streptococcus agalactiae NEM316 complete genome, segment 7
          Length = 128050

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 218  ccaaaagggacaaatctagtt 238
            |||||||||||||||||||||
Sbjct: 2997 ccaaaagggacaaatctagtt 2977

>gb|AC100779.2| Homo sapiens chromosome 18, clone RP11-761D8, complete sequence
          Length = 196261

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 89   aatttaaaaacatgagccaatcatcatcc 117
            ||||||||| || ||||||||||||||||
Sbjct: 6855 aatttaaaaccaggagccaatcatcatcc 6883

>gb|AC092633.2| Homo sapiens BAC clone RP11-339P1 from 2, complete sequence
          Length = 135863

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 17    gcaagtacagaaaacaaacca 37
             |||||||||||||||||||||
Sbjct: 43639 gcaagtacagaaaacaaacca 43619

>gb|AC007563.2| Homo sapiens BAC clone RP11-506C8 from 2, complete sequence
          Length = 179859

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 336   agccatgttcattgatttatgccta 360
             ||||||||||||| |||||||||||
Sbjct: 43306 agccatgttcatttatttatgccta 43282

>emb|BX005342.14| Zebrafish DNA sequence from clone DKEY-81P7, complete sequence
          Length = 257502

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 62    ataacattacaacaggggatg 82
             |||||||||||||||||||||
Sbjct: 81751 ataacattacaacaggggatg 81771

>emb|AL772135.14| Mouse DNA sequence from clone RP23-162G11 on chromosome 2, complete
            sequence
          Length = 230161

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 536  atacttccctcacagcatctt 556
            |||||||||||||||||||||
Sbjct: 4083 atacttccctcacagcatctt 4103

>dbj|AP006074.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT40O02, TM0111b,
             complete sequence
          Length = 92724

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 266   agggaacaaatccaccctttt 286
             |||||||||||||||||||||
Sbjct: 15792 agggaacaaatccaccctttt 15812

>gb|AC170603.2| Mus musculus BAC clone RP23-140J10 from chromosome 8, complete sequence
          Length = 221596

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 514    acatggaaattgtcagactca 534
              |||||||||||||||||||||
Sbjct: 216896 acatggaaattgtcagactca 216916


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,586,939
Number of Sequences: 3902068
Number of extensions: 7586939
Number of successful extensions: 149976
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 149918
Number of HSP's gapped (non-prelim): 58
length of query: 735
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 712
effective length of database: 17,143,297,704
effective search space: 12206027965248
effective search space used: 12206027965248
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 21 (42.1 bits)