ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah62h24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X78672.1|HVCHT2B H.vulgare mRNA for chitinase 2b 676 0.0
2emb|AJ276226.1|HVU276226 Hordeum vulgare mRNA for chitinase II (... 549 e-153
3gb|AF280438.1|AF280438 Secale cereale 24.8 kDa class II endochit... 365 6e-98
4emb|X78671.1|HVCHT2A H.vulgare mRNA for chitinase 2a 313 2e-82
5dbj|AB029934.1| Triticum aestivum Chi 1 mRNA for chitinase 1, co... 305 5e-80
6gb|L40336.1|RICCHITB Oryza sativa chitinase (Rcht2) gene, comple... 184 1e-43
7gb|L40338.1|RICRCH0 Oryza sativa (clone RCH08) chitinase (Rcht2)... 184 1e-43
8gb|AF013580.1|AF013580 Oryza sativa clone RGCH8 chitinase gene, ... 182 5e-43
9gb|AF001500.1|OSAF001500 Oryza sativa clone MIRCH1 chitinase mRN... 182 5e-43
10ref|NM_197596.1| Oryza sativa (japonica cultivar-group) chitinas... 170 2e-39
11gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 geno... 170 2e-39
12dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic D... 170 2e-39
13dbj|AK070067.1| Oryza sativa (japonica cultivar-group) cDNA clon... 170 2e-39
14gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome... 170 2e-39
15dbj|AB016497.1| Oryza sativa mRNA for chitinase, complete cds 170 2e-39
16ref|NM_197598.1| Oryza sativa (japonica cultivar-group) putative... 155 1e-34
17gb|L34211.1|BLYCHI33A Hordeum vulgare chitinase (CHI33) gene, co... 82 1e-12
18gb|AF280437.1|AF280437 Secale cereale 31.7 kDa class I endochiti... 78 2e-11
19gb|AF000966.1|AF000966 Poa pratensis chitinase (Chi2) gene, comp... 74 3e-10
20gb|AF000965.1|AF000965 Poa pratensis chitinase (Chi3) pseudogene... 74 3e-10
21gb|AF000964.1|AF000964 Poa pratensis chitinase (Chi1) gene, comp... 74 3e-10
22gb|AY437443.1| Triticum aestivum cultivar Ning 7840 class I chit... 70 5e-09
23dbj|AB029936.1| Triticum aestivum Chi 3 mRNA for chitinase 3, co... 70 5e-09
24ref|XM_468715.1| Oryza sativa (japonica cultivar-group), mRNA 68 2e-08
25gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 68 2e-08
26gb|AC145386.1| Oryza sativa chromosome 3 BAC OSJNBb0028K20 genom... 68 2e-08
27gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genom... 68 2e-08
28gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete s... 68 2e-08
29gb|AY997529.2| Musa x paradisiaca chitinase (Chi-1) mRNA, comple... 68 2e-08
30dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 68 2e-08
31gb|AC132492.3| Oryza sativa (japonica cultivar-group) chromosome... 64 3e-07
32gb|AY444342.1| Oryza sativa chitinase gene, complete cds 64 3e-07
33gb|L40337.1|RICRCH1 Oryza sativa chitinase (Rcht1) mRNA, complet... 64 3e-07
34dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 64 3e-07
35gb|L37289.1|RICCHITA Oryza sativa chitinase mRNA, complete cds 64 3e-07
36emb|X76041.1|TACHIG T.aestivum (Chinese spring) chi gene for end... 62 1e-06
37dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, complete... 62 1e-06
38gb|AY532766.1| Zea diploperennis isolate d8 chitinase (chiI) gen... 58 2e-05
39gb|AY532765.1| Zea diploperennis isolate d7 chitinase (chiI) gen... 58 2e-05
40gb|AY532764.1| Zea diploperennis isolate d6 chitinase (chiI) gen... 58 2e-05
41gb|AY532763.1| Zea diploperennis isolate d5 chitinase (chiI) gen... 58 2e-05
42gb|AY532762.1| Zea diploperennis isolate d5b chitinase (chiI) ge... 58 2e-05
43gb|AY532761.1| Zea diploperennis isolate d4 chitinase (chiI) gen... 58 2e-05
44gb|AY532760.1| Zea diploperennis isolate d3 chitinase (chiI) gen... 58 2e-05
45gb|AY532759.1| Zea diploperennis isolate d2 chitinase (chiI) gen... 58 2e-05
46gb|AY532758.1| Zea diploperennis isolate d1 chitinase (chiI) gen... 58 2e-05
47gb|AY532757.1| Zea mays subsp. parviglumis isolate p15 chitinase... 58 2e-05
48gb|AY532756.1| Zea mays subsp. parviglumis isolate p14b chitinas... 58 2e-05
49gb|AY532755.1| Zea mays subsp. parviglumis isolate p14 chitinase... 58 2e-05
50gb|AY532754.1| Zea mays subsp. parviglumis isolate p13b chitinas... 58 2e-05
51gb|AY532753.1| Zea mays subsp. parviglumis isolate p13 chitinase... 58 2e-05
52gb|AY532752.1| Zea mays subsp. parviglumis isolate p12 chitinase... 58 2e-05
53gb|AY532751.1| Zea mays subsp. parviglumis isolate p11 chitinase... 58 2e-05
54gb|AY532750.1| Zea mays subsp. parviglumis isolate p9 chitinase ... 58 2e-05
55gb|AY532749.1| Zea mays subsp. parviglumis isolate p8 chitinase ... 58 2e-05
56gb|AY532748.1| Zea mays subsp. parviglumis isolate p6 chitinase ... 58 2e-05
57gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase ... 58 2e-05
58gb|AY532746.1| Zea mays subsp. parviglumis isolate p4 chitinase ... 58 2e-05
59gb|AY532745.1| Zea mays subsp. parviglumis isolate p3 chitinase ... 58 2e-05
60gb|AY532744.1| Zea mays subsp. parviglumis isolate p2 chitinase ... 58 2e-05
61gb|AY532743.1| Zea mays subsp. parviglumis isolate p1 chitinase ... 58 2e-05
62gb|U02286.1|OSU02286 Oryza sativa IR58 chitinase mRNA, complete cds 58 2e-05
63gb|AY453406.1| Bambusa oldhamii chitinase mRNA, complete cds 56 8e-05
64emb|X56787.1|OSLMRNAC O.sativa L. mRNA for endochitinase 56 8e-05
65emb|X15349.1|HVENDCHT Barley (H.vulgare) mRNA for endochitinase 56 8e-05
66gb|AF167323.1|AF167323 Medicago truncatula clone T130002g putati... 56 8e-05
67dbj|AK108949.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 8e-05
68gb|AY106654.1| Zea mays PCO078819 mRNA sequence 56 8e-05
69gb|AY103739.1| Zea mays PCO142303 mRNA sequence 56 8e-05
70dbj|D16222.1|RICCHT2 Oryza sativa (japonica cultivar-group) Cht-... 56 8e-05
71gb|U02287.1|HVU02287 Hordeum vulgare cultivar NK1558 chitinase g... 56 8e-05
72gb|L34210.1|BLYCHI26A Hordeum vulgare chitinase (CHI26) gene, co... 54 3e-04
73gb|M62904.1|BLYCHI H.vulgare L. 26kD chitinase mRNA, complete cds 54 3e-04
74ref|NM_183568.1| Oryza sativa (japonica cultivar-group), predic... 48 0.019
75dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.019
76dbj|AP002070.1| Oryza sativa (japonica cultivar-group) genomic D... 48 0.019
77dbj|AK063062.1| Oryza sativa (japonica cultivar-group) cDNA clon... 48 0.019
78dbj|AB051579.1| Secale cereale rscc mRNA for seed chitinase-c, c... 46 0.075
79gb|AY973230.1| Triticum aestivum cultivar Sumai 3 class II chiti... 46 0.075
80gb|AY973229.1| Triticum aestivum cultivar Gamenya class II chiti... 46 0.075
81emb|BX547936.5| Mouse DNA sequence from clone RP23-109A11 on chr... 44 0.30
82gb|L16798.1|MZECHITINA Zea mays class I acidic chitinase mRNA, p... 44 0.30
83dbj|AB015655.1| Cucurbita cv. Ebisu Nankin chitP1 mRNA for chiti... 44 0.30
84gb|AC182674.2| Populus trichocarpa clone Pop1-27N13, complete se... 42 1.2
85emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 42 1.2
86emb|Z78202.1|PACHI1 Persea americana mRNA for endochitinase 42 1.2
87emb|Z68152.1|GHCHI2A G.hirsutum chitinase gene (2439 bp) 42 1.2
88gb|DQ078281.1| Ulmus americana chitinase (CHT) mRNA, complete cds 42 1.2
89gb|L00973.1|MZECHITC Zea mays acidic class I chitinase mRNA, com... 42 1.2
90gb|L22032.1|ULMCHITIN Ulmus americana chitinase (pHS2) mRNA, com... 42 1.2
91gb|AY705804.1| Pinus halepensis clone 27r chitinase-like mRNA, c... 40 4.6
92gb|AY643483.1| Drosera spathulata CHIT1 (chit1) gene, partial cds 40 4.6
93gb|AY205337.1| Mycobacterium smegmatis fatty acid synthetase I (... 40 4.6
94gb|AY618888.1| Nepenthes khasiana basic chitinase 2-2 mRNA, comp... 40 4.6
95gb|AY618887.1| Nepenthes khasiana basic chitinase 2-2 gene, comp... 40 4.6
96gb|AY618886.1| Nepenthes khasiana basic chitinase 2-1 mRNA, comp... 40 4.6
97gb|AY618885.1| Nepenthes khasiana basic chitinase 2-1 gene, comp... 40 4.6
98gb|AC139334.3| Mus musculus BAC clone RP23-449C21 from chromosom... 40 4.6
99emb|Z29962.1|OSCHITIB O.sativa (PCH6) mRNA for chitinase class I 40 4.6
100emb|X54367.1|OSCHIT Oryza sativa (rice) gene for endochitinase 40 4.6
101gb|AY880227.1| Chaenorhinum minus voucher UTEP 37492 internal tr... 40 4.6
102emb|Z68153.1|GHCHI2B G.hirsutum chitinase gene (2525 bp) 40 4.6
103dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 4.6
104dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.6
105dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic D... 40 4.6
106dbj|AK061280.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 4.6
107gb|AF105426.1|AF105426 Cynodon dactylon chitinase (Cht2) gene, c... 40 4.6
108dbj|D14846.1|PSEEAPGA Pseudomonas sp. gene for endo alpha-1,4 po... 40 4.6
109dbj|D16223.1|RICCHT3 Oryza sativa (japonica cultivar-group) Cht-... 40 4.6

>emb|X78672.1|HVCHT2B H.vulgare mRNA for chitinase 2b
          Length = 1013

 Score =  676 bits (341), Expect = 0.0
 Identities = 347/349 (99%)
 Strand = Plus / Minus

                                                                       
Query: 1   acttactcgtattatcatacgacacgatcaactggatcacatatcgaattatttatttca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 950 acttactcgtattatcatacgacacgatcaactggatcacatatcgaattatttatttca 891

                                                                       
Query: 61  tgatgggatatgtgttaccccttattcatgagtgtagccctttattcgtaacacgtgcat 120
           |||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||
Sbjct: 890 tgatgggatatgtgttgccccttattcatgagtctagccctttattcgtaacacgtgcat 831

                                                                       
Query: 121 acactatccatagtgtctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctc 180
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 830 acactatccatagtgtctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctc 771

                                                                       
Query: 181 cggtggccgtgccaagcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttgg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 770 cggtggccgtgccaagcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttgg 711

                                                                       
Query: 241 cgtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgt 300
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 710 cgtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgt 651

                                                            
Query: 301 atccaggcacccgacctgcagctgtatcggcagccgtcggcgtccagcg 349
           |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 650 atccaggcacccgacctgcagctgtatcggcagccgtcggcgtccagcg 602



to top

>emb|AJ276226.1|HVU276226 Hordeum vulgare mRNA for chitinase II (pathogenesis-related protein
           3) (cht2 gene)
          Length = 890

 Score =  549 bits (277), Expect = e-153
 Identities = 281/283 (99%)
 Strand = Plus / Minus

                                                                       
Query: 67  gatatgtgttaccccttattcatgagtgtagccctttattcgtaacacgtgcatacacta 126
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 890 gatatgtgttgccccttattcatgagtgtagccctttattcgtaacacgtgcatacactr 831

                                                                       
Query: 127 tccatagtgtctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtgg 186
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 830 tccatagtgtctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtgg 771

                                                                       
Query: 187 ccgtgccaagcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgt 246
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 770 ccgtgccaagcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgt 711

                                                                       
Query: 247 tctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgtatccag 306
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 710 tctggcccatgccgcactcgagcccgccgttgatgatattggtgattacgccgtatccag 651

                                                      
Query: 307 gcacccgacctgcagctgtatcggcagccgtcggcgtccagcg 349
           |||||||||||||||||||||||||||||||||||||||||||
Sbjct: 650 gcacccgacctgcagctgtatcggcagccgtcggcgtccagcg 608



to top

>gb|AF280438.1|AF280438 Secale cereale 24.8 kDa class II endochitinase-antifreeze protein
           precursor, mRNA, complete cds
          Length = 998

 Score =  365 bits (184), Expect = 6e-98
 Identities = 208/216 (96%)
 Strand = Plus / Minus

                                                                       
Query: 134 tgtctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgcc 193
           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 840 tgtctagctagcgaagtttcgctgggtgtagcagtcgaggttgcccccggtggccgtgcc 781

                                                                       
Query: 194 aagcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcc 253
           |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 780 aagcatgccgcagtagcgtgtgtagtagccgatgcggtcgacgttggcgtcgttccggcc 721

                                                                       
Query: 254 catgccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
           |||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||
Sbjct: 720 catgccgcactcgagcccgccgttgatgatattggtgattacgccgtacccagggacccg 661

                                               
Query: 314 acctgcagctgtatcggcagccgtcggcgtccagcg 349
           ||| |||||  |||||||||||||||||||||||||
Sbjct: 660 acccgcagcgttatcggcagccgtcggcgtccagcg 625



to top

>emb|X78671.1|HVCHT2A H.vulgare mRNA for chitinase 2a
          Length = 1028

 Score =  313 bits (158), Expect = 2e-82
 Identities = 200/214 (93%)
 Strand = Plus / Minus

                                                                       
Query: 136 tctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaa 195
           |||||||||||||||| || ||||||||||||||||||||||| |||||||||||||| |
Sbjct: 830 tctagctagcgaagttccgttgggtgtagcagtcgaggttgcccccggtggccgtgccga 771

                                                                       
Query: 196 gcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggccca 255
           |||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||
Sbjct: 770 gcatgccgcagtagcgcgtgtagtagccgatgcgatcgacgttggcgtcgttccggccca 711

                                                                       
Query: 256 tgccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccgac 315
           |||||||||||||||||||||||||||||||||||||||| ||||| || || |||||||
Sbjct: 710 tgccgcactcgagcccgccgttgatgatattggtgattacaccgtagcctggaacccgac 651

                                             
Query: 316 ctgcagctgtatcggcagccgtcggcgtccagcg 349
           | ||||| || ||||| |||||||||||||||||
Sbjct: 650 cggcagcggtgtcggcggccgtcggcgtccagcg 617



 Score = 50.1 bits (25), Expect = 0.005
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 101 tttattcgtaacacgtgcatacact 125
           |||||||||||||||||||||||||
Sbjct: 880 tttattcgtaacacgtgcatacact 856



to top

>dbj|AB029934.1| Triticum aestivum Chi 1 mRNA for chitinase 1, complete cds
          Length = 979

 Score =  305 bits (154), Expect = 5e-80
 Identities = 199/214 (92%)
 Strand = Plus / Minus

                                                                       
Query: 136 tctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaa 195
           |||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
Sbjct: 848 tctagctagcgaagttcctctgggtgtagcagtcgaggttgcctccggtggccgtgccga 789

                                                                       
Query: 196 gcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggccca 255
           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 788 gcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttccggccca 729

                                                                       
Query: 256 tgccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccgac 315
           | ||||||||||||||||||||||||||||||||||| || |||||||| || ||||  |
Sbjct: 728 ttccgcactcgagcccgccgttgatgatattggtgatcactccgtatccgggtaccctgc 669

                                             
Query: 316 ctgcagctgtatcggcagccgtcggcgtccagcg 349
           | ||||| || ||||| |||||||||||||||||
Sbjct: 668 cggcagcggtgtcggcggccgtcggcgtccagcg 635



to top

>gb|L40336.1|RICCHITB Oryza sativa chitinase (Rcht2) gene, complete cds
          Length = 5595

 Score =  184 bits (93), Expect = 1e-43
 Identities = 143/157 (91%), Gaps = 2/157 (1%)
 Strand = Plus / Minus

                                                                        
Query: 137  ctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggcc-gtgccaa 195
            |||||| ||||||||||||||| |||||||||||||||||| ||| || ||| ||||| |
Sbjct: 4865 ctagctggcgaagtttcgctggttgtagcagtcgaggttgc-tcccgtagcctgtgccga 4807

                                                                        
Query: 196  gcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggccca 255
            ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
Sbjct: 4806 gcatgtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccga 4747

                                                 
Query: 256  tgccgcactcgagcccgccgttgatgatattggtgat 292
             |||||||||||  |||||||||||||| ||||||||
Sbjct: 4746 cgccgcactcgatgccgccgttgatgatgttggtgat 4710



to top

>gb|L40338.1|RICRCH0 Oryza sativa (clone RCH08) chitinase (Rcht2) mRNA, 3' end of cds
          Length = 652

 Score =  184 bits (93), Expect = 1e-43
 Identities = 143/157 (91%), Gaps = 2/157 (1%)
 Strand = Plus / Minus

                                                                       
Query: 137 ctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggcc-gtgccaa 195
           |||||| ||||||||||||||| |||||||||||||||||| ||| || ||| ||||| |
Sbjct: 528 ctagctggcgaagtttcgctggttgtagcagtcgaggttgc-tcccgtagcctgtgccga 470

                                                                       
Query: 196 gcatgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggccca 255
           ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| |
Sbjct: 469 gcatgtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccga 410

                                                
Query: 256 tgccgcactcgagcccgccgttgatgatattggtgat 292
            |||||||||||  |||||||||||||| ||||||||
Sbjct: 409 cgccgcactcgatgccgccgttgatgatgttggtgat 373



to top

>gb|AF013580.1|AF013580 Oryza sativa clone RGCH8 chitinase gene, complete cds
          Length = 2730

 Score =  182 bits (92), Expect = 5e-43
 Identities = 142/156 (91%), Gaps = 2/156 (1%)
 Strand = Plus / Minus

                                                                        
Query: 147  aagtttcgctgggtgtagcagtcgaggttgcctccggtggcc-gtgccaagcatgccgca 205
            |||||||||||| |||||||||||||||||| ||| || ||| ||||| |||||| ||||
Sbjct: 2305 aagtttcgctggttgtagcagtcgaggttgc-tcccgtagcctgtgccgagcatgtcgca 2247

                                                                        
Query: 206  gtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccatgccgcactc 265
            ||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||
Sbjct: 2246 gtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactc 2187

                                                
Query: 266  gagcccgccgttgatgatattggtgattacgccgta 301
            ||  |||||||||||||| |||||||| ||||||||
Sbjct: 2186 gatgccgccgttgatgatgttggtgatgacgccgta 2151



to top

>gb|AF001500.1|OSAF001500 Oryza sativa clone MIRCH1 chitinase mRNA, partial cds
          Length = 913

 Score =  182 bits (92), Expect = 5e-43
 Identities = 142/156 (91%), Gaps = 2/156 (1%)
 Strand = Plus / Minus

                                                                       
Query: 147 aagtttcgctgggtgtagcagtcgaggttgcctccggtggcc-gtgccaagcatgccgca 205
           |||||||||||| |||||||||||||||||| ||| || ||| ||||| |||||| ||||
Sbjct: 765 aagtttcgctggttgtagcagtcgaggttgc-tcccgtagcctgtgccgagcatgtcgca 707

                                                                       
Query: 206 gtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccatgccgcactc 265
           ||||||| |||||||||||||||||||||||||||||||||||||||| | |||||||||
Sbjct: 706 gtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgacgccgcactc 647

                                               
Query: 266 gagcccgccgttgatgatattggtgattacgccgta 301
           ||  |||||||||||||| |||||||| ||||||||
Sbjct: 646 gatgccgccgttgatgatgttggtgatgacgccgta 611



to top

>ref|NM_197596.1| Oryza sativa (japonica cultivar-group) chitinase
           (OSJNBb0015I11.14), mRNA
          Length = 924

 Score =  170 bits (86), Expect = 2e-39
 Identities = 143/162 (88%)
 Strand = Plus / Minus

                                                                       
Query: 137 ctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaag 196
           |||||| |||||||| |||||| ||||||||||||||||||  |||  | | | ||| ||
Sbjct: 786 ctagctggcgaagttgcgctggttgtagcagtcgaggttgctgccgtagcctgcgccgag 727

                                                                       
Query: 197 catgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccat 256
           |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| | 
Sbjct: 726 catgtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgac 667

                                                     
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgcc 298
           |||||||||||  |||||||||||||| |||||||| |||||
Sbjct: 666 gccgcactcgatgccgccgttgatgatgttggtgatgacgcc 625



to top

>gb|AC051633.7| Oryza sativa chromosome 10 BAC OSJNBb0015I11 genomic sequence, complete
             sequence
          Length = 138824

 Score =  170 bits (86), Expect = 2e-39
 Identities = 143/162 (88%)
 Strand = Plus / Minus

                                                                         
Query: 137   ctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaag 196
             |||||| |||||||| |||||| ||||||||||||||||||  |||  | | | ||| ||
Sbjct: 89627 ctagctggcgaagttgcgctggttgtagcagtcgaggttgctgccgtagcctgcgccgag 89568

                                                                         
Query: 197   catgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccat 256
             |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| | 
Sbjct: 89567 catgtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgac 89508

                                                       
Query: 257   gccgcactcgagcccgccgttgatgatattggtgattacgcc 298
             |||||||||||  |||||||||||||| |||||||| |||||
Sbjct: 89507 gccgcactcgatgccgccgttgatgatgttggtgatgacgcc 89466



 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                          
Query: 140    gctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaagcat 199
              |||| ||||||  |||||| ||||||||||||||||||  |||| | | | ||| |||||
Sbjct: 104350 gctatcgaagtcgcgctggttgtagcagtcgaggttgctgccggggtctgcgccgagcat 104291

                                                                          
Query: 200    gccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccatgcc 259
              | ||||||||||| |||||||||||||||||||||||||||||||||||||||| | | |
Sbjct: 104290 gtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgacgtc 104231

                                                        
Query: 260    gcactcgagcccgccgttgatgatattggtgattacgccgta 301
              ||||||||  | |||||||||||| |||||||| ||||||||
Sbjct: 104230 gcactcgaagcggccgttgatgatgttggtgatgacgccgta 104189



to top

>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete
                sequence
          Length = 22685906

 Score =  170 bits (86), Expect = 2e-39
 Identities = 143/162 (88%)
 Strand = Plus / Minus

                                                                            
Query: 137      ctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaag 196
                |||||| |||||||| |||||| ||||||||||||||||||  |||  | | | ||| ||
Sbjct: 20688175 ctagctggcgaagttgcgctggttgtagcagtcgaggttgctgccgtagcctgcgccgag 20688116

                                                                            
Query: 197      catgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccat 256
                |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| | 
Sbjct: 20688115 catgtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgac 20688056

                                                          
Query: 257      gccgcactcgagcccgccgttgatgatattggtgattacgcc 298
                |||||||||||  |||||||||||||| |||||||| |||||
Sbjct: 20688055 gccgcactcgatgccgccgttgatgatgttggtgatgacgcc 20688014



 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                            
Query: 140      gctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaagcat 199
                |||| ||||||  |||||| ||||||||||||||||||  |||| | | | ||| |||||
Sbjct: 20702898 gctatcgaagtcgcgctggttgtagcagtcgaggttgctgccggggtctgcgccgagcat 20702839

                                                                            
Query: 200      gccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccatgcc 259
                | ||||||||||| |||||||||||||||||||||||||||||||||||||||| | | |
Sbjct: 20702838 gtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgacgtc 20702779

                                                          
Query: 260      gcactcgagcccgccgttgatgatattggtgattacgccgta 301
                ||||||||  | |||||||||||| |||||||| ||||||||
Sbjct: 20702778 gcactcgaagcggccgttgatgatgttggtgatgacgccgta 20702737



to top

>dbj|AK070067.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023042L15, full
           insert sequence
          Length = 1073

 Score =  170 bits (86), Expect = 2e-39
 Identities = 143/162 (88%)
 Strand = Plus / Minus

                                                                       
Query: 137 ctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaag 196
           |||||| |||||||| |||||| ||||||||||||||||||  |||  | | | ||| ||
Sbjct: 812 ctagctggcgaagttgcgctggttgtagcagtcgaggttgctgccgtagcctgcgccgag 753

                                                                       
Query: 197 catgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccat 256
           |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| | 
Sbjct: 752 catgtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgac 693

                                                     
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgcc 298
           |||||||||||  |||||||||||||| |||||||| |||||
Sbjct: 692 gccgcactcgatgccgccgttgatgatgttggtgatgacgcc 651



to top

>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence
          Length = 22698374

 Score =  170 bits (86), Expect = 2e-39
 Identities = 143/162 (88%)
 Strand = Plus / Minus

                                                                            
Query: 137      ctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaag 196
                |||||| |||||||| |||||| ||||||||||||||||||  |||  | | | ||| ||
Sbjct: 20699447 ctagctggcgaagttgcgctggttgtagcagtcgaggttgctgccgtagcctgcgccgag 20699388

                                                                            
Query: 197      catgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccat 256
                |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| | 
Sbjct: 20699387 catgtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgac 20699328

                                                          
Query: 257      gccgcactcgagcccgccgttgatgatattggtgattacgcc 298
                |||||||||||  |||||||||||||| |||||||| |||||
Sbjct: 20699327 gccgcactcgatgccgccgttgatgatgttggtgatgacgcc 20699286



 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                            
Query: 140      gctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaagcat 199
                |||| ||||||  |||||| ||||||||||||||||||  |||| | | | ||| |||||
Sbjct: 20714170 gctatcgaagtcgcgctggttgtagcagtcgaggttgctgccggggtctgcgccgagcat 20714111

                                                                            
Query: 200      gccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccatgcc 259
                | ||||||||||| |||||||||||||||||||||||||||||||||||||||| | | |
Sbjct: 20714110 gtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgacgtc 20714051

                                                          
Query: 260      gcactcgagcccgccgttgatgatattggtgattacgccgta 301
                ||||||||  | |||||||||||| |||||||| ||||||||
Sbjct: 20714050 gcactcgaagcggccgttgatgatgttggtgatgacgccgta 20714009



to top

>dbj|AB016497.1| Oryza sativa mRNA for chitinase, complete cds
          Length = 923

 Score =  170 bits (86), Expect = 2e-39
 Identities = 143/162 (88%)
 Strand = Plus / Minus

                                                                       
Query: 137 ctagctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaag 196
           |||||| |||||||| |||||| ||||||||||||||||||  |||  | | | ||| ||
Sbjct: 792 ctagctggcgaagttgcgctggttgtagcagtcgaggttgctgccgtagcctgcgccgag 733

                                                                       
Query: 197 catgccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccat 256
           |||| ||||||||||| |||||||||||||||||||||||||||||||||||||||| | 
Sbjct: 732 catgtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgac 673

                                                     
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgcc 298
           |||||||||||  |||||||||||||| |||||||| |||||
Sbjct: 672 gccgcactcgatgccgccgttgatgatgttggtgatgacgcc 631



to top

>ref|NM_197598.1| Oryza sativa (japonica cultivar-group) putative chitinase
           (OSJNBb0015I11.16), mRNA
          Length = 891

 Score =  155 bits (78), Expect = 1e-34
 Identities = 141/162 (87%)
 Strand = Plus / Minus

                                                                       
Query: 140 gctagcgaagtttcgctgggtgtagcagtcgaggttgcctccggtggccgtgccaagcat 199
           |||| ||||||  |||||| ||||||||||||||||||  |||| | | | ||| |||||
Sbjct: 879 gctatcgaagtcgcgctggttgtagcagtcgaggttgctgccggggtctgcgccgagcat 820

                                                                       
Query: 200 gccgcagtagcgcgtgtagtagccgatgcggtcgacgttggcgtcgttctggcccatgcc 259
           | ||||||||||| |||||||||||||||||||||||||||||||||||||||| | | |
Sbjct: 819 gtcgcagtagcgcttgtagtagccgatgcggtcgacgttggcgtcgttctggccgacgtc 760

                                                     
Query: 260 gcactcgagcccgccgttgatgatattggtgattacgccgta 301
           ||||||||  | |||||||||||| |||||||| ||||||||
Sbjct: 759 gcactcgaagcggccgttgatgatgttggtgatgacgccgta 718



to top

>gb|L34211.1|BLYCHI33A Hordeum vulgare chitinase (CHI33) gene, complete cds
          Length = 1779

 Score = 81.8 bits (41), Expect = 1e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                        
Query: 258  ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccgacct 317
            |||||||||||||||||||||||||| |||||||| |||||||| || |||||||  || 
Sbjct: 1532 ccgcactcgagcccgccgttgatgatgttggtgatgacgccgtagccgggcaccctcccc 1473

                                         
Query: 318  gcagctgtatcggcagccgtcggcgtcca 346
            || || || || || ||||||||||||||
Sbjct: 1472 gccgcggtgtctgcggccgtcggcgtcca 1444



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 155  ctgggtgtagcagtcgaggttgcc 178
            |||| |||||||||||||||||||
Sbjct: 1635 ctggttgtagcagtcgaggttgcc 1612



to top

>gb|AF280437.1|AF280437 Secale cereale 31.7 kDa class I endochitinase-antifreeze protein
           precursor, mRNA, complete cds
          Length = 1192

 Score = 77.8 bits (39), Expect = 2e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
           |||||||||||||| ||||||||||| |||||||| |||||||| ||||||||||
Sbjct: 887 ccgcactcgagcccaccgttgatgatgttggtgatcacgccgtacccaggcaccc 833



to top

>gb|AF000966.1|AF000966 Poa pratensis chitinase (Chi2) gene, complete cds
          Length = 1080

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 256 tgccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
           ||||||||||||||||||| |||||||| |||||||| |||||||| || |||||||
Sbjct: 871 tgccgcactcgagcccgccattgatgatgttggtgatcacgccgtacccgggcaccc 815



to top

>gb|AF000965.1|AF000965 Poa pratensis chitinase (Chi3) pseudogene sequence
          Length = 1173

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                     
Query: 256  tgccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
            |||||||||||||||||||||||||||| || ||||| |||||||| || |||||||
Sbjct: 1034 tgccgcactcgagcccgccgttgatgatgttagtgatcacgccgtacccgggcaccc 978



to top

>gb|AF000964.1|AF000964 Poa pratensis chitinase (Chi1) gene, complete cds
          Length = 1252

 Score = 73.8 bits (37), Expect = 3e-10
 Identities = 52/57 (91%)
 Strand = Plus / Minus

                                                                    
Query: 256 tgccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
           ||||||||||||||||||| |||||||| |||||||| |||||||| || |||||||
Sbjct: 871 tgccgcactcgagcccgccattgatgatgttggtgatcacgccgtacccgggcaccc 815



to top

>gb|AY437443.1| Triticum aestivum cultivar Ning 7840 class I chitinase mRNA,
           complete cds
          Length = 1121

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
           |||||||||||||| ||||||||||| |||||||| || ||||| ||||||||||
Sbjct: 907 ccgcactcgagcccaccgttgatgatgttggtgatcacaccgtacccaggcaccc 853



to top

>dbj|AB029936.1| Triticum aestivum Chi 3 mRNA for chitinase 3, complete cds
          Length = 1148

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 50/55 (90%)
 Strand = Plus / Minus

                                                                  
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
           |||||||||||||| ||||||||||| |||||||| || ||||| ||||||||||
Sbjct: 893 ccgcactcgagcccaccgttgatgatgttggtgatcacaccgtacccaggcaccc 839



to top

>ref|XM_468715.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 981

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcac 310
           ||||||||| ||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 861 gccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcac 808



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                      
Query: 257      gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcac 310
                ||||||||| ||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 17203967 gccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcac 17203914



to top

>gb|AC145386.1| Oryza sativa chromosome 3 BAC OSJNBb0028K20 genomic sequence, complete
             sequence
          Length = 115326

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                   
Query: 257   gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcac 310
             ||||||||| ||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 36711 gccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcac 36658



to top

>gb|AC137992.2| Oryza sativa chromosome 3 BAC OSJNBb0056B16 genomic sequence, complete
             sequence
          Length = 153247

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                   
Query: 257   gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcac 310
             ||||||||| ||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 95360 gccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcac 95307



to top

>gb|AC148763.14| Medicago truncatula clone mth2-29o24, complete sequence
          Length = 104879

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 55/62 (88%)
 Strand = Plus / Plus

                                                                         
Query: 258   ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccgacct 317
             ||||| ||||||||||||||||| || |||||||| ||||||||||| || ||||| |||
Sbjct: 29219 ccgcattcgagcccgccgttgattatgttggtgatcacgccgtatccggggacccgccct 29278

               
Query: 318   gc 319
             ||
Sbjct: 29279 gc 29280



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 49/56 (87%)
 Strand = Plus / Plus

                                                                     
Query: 258   ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
             ||||| |||||||| |||||||| || |||||||| ||||||||||| || |||||
Sbjct: 25093 ccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccg 25148



 Score = 44.1 bits (22), Expect = 0.30
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                   
Query: 267   agcccgccgttgatgatattggtgattacgccgtatcc 304
             |||||||||||||| || |||||||| ||||| |||||
Sbjct: 14907 agcccgccgttgattatgttggtgatcacgccatatcc 14944



to top

>gb|AY997529.2| Musa x paradisiaca chitinase (Chi-1) mRNA, complete cds
          Length = 1082

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                 
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcac 310
           ||||||||| ||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 904 gccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcac 851



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 49/54 (90%)
 Strand = Plus / Minus

                                                                      
Query: 257      gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcac 310
                ||||||||| ||||||||||||||||| |||||||| |||||||| || |||||
Sbjct: 17197536 gccgcactccagcccgccgttgatgatgttggtgatgacgccgtagcccggcac 17197483



to top

>gb|AC132492.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0605G01,
             complete sequence
          Length = 146303

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                     
Query: 258   ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
             |||||||| | ||||||||||||||| |||||||| |||||||| || ||||||||
Sbjct: 96186 ccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccg 96131



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                         
Query: 258   ccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
             |||||||| ||||||||||||| ||| |||||||| ||||||||
Sbjct: 87274 ccgcactccagcccgccgttgacgatgttggtgatcacgccgta 87231



 Score = 46.1 bits (23), Expect = 0.075
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                            
Query: 155   ctgggtgtagcagtcgaggttgcctccggtg 185
             |||| ||||||||||||||||||| ||||||
Sbjct: 87377 ctggttgtagcagtcgaggttgccgccggtg 87347



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 61/72 (84%), Gaps = 2/72 (2%)
 Strand = Plus / Minus

                                                                         
Query: 161   gtagcagtcgaggttgcctccggtggccg-tgccaagcatgccgcagtagcgcgtgtagt 219
             |||||||||||||||| |||| || |||| |||| |||| | |||||||||||  |||| 
Sbjct: 96283 gtagcagtcgaggttg-ctcccgtagccgatgccgagcacgtcgcagtagcgctggtaga 96225

                         
Query: 220   agccgatgcggt 231
             ||||||| ||||
Sbjct: 96224 agccgatccggt 96213



to top

>gb|AY444342.1| Oryza sativa chitinase gene, complete cds
          Length = 1101

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
           |||||||| | ||||||||||||||| |||||||| |||||||| || ||||||||
Sbjct: 962 ccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccg 907



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 61/72 (84%), Gaps = 2/72 (2%)
 Strand = Plus / Minus

                                                                        
Query: 161  gtagcagtcgaggttgcctccggtggccg-tgccaagcatgccgcagtagcgcgtgtagt 219
            |||||||||||||||| |||| || |||| |||| |||| | |||||||||||  |||| 
Sbjct: 1059 gtagcagtcgaggttg-ctcccgtagccgatgccgagcacgtcgcagtagcgctggtaga 1001

                        
Query: 220  agccgatgcggt 231
            ||||||| ||||
Sbjct: 1000 agccgatccggt 989



to top

>gb|L40337.1|RICRCH1 Oryza sativa chitinase (Rcht1) mRNA, complete cds
          Length = 1204

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
           |||||||| | ||||||||||||||| |||||||| |||||||| || ||||||||
Sbjct: 869 ccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccg 814



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                        
Query: 258      ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
                |||||||| | ||||||||||||||| |||||||| |||||||| || ||||||||
Sbjct: 19292111 ccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccg 19292056



 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                            
Query: 258      ccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
                |||||||| ||||||||||||| ||| |||||||| ||||||||
Sbjct: 19283199 ccgcactccagcccgccgttgacgatgttggtgatcacgccgta 19283156



 Score = 46.1 bits (23), Expect = 0.075
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                               
Query: 155      ctgggtgtagcagtcgaggttgcctccggtg 185
                |||| ||||||||||||||||||| ||||||
Sbjct: 19283302 ctggttgtagcagtcgaggttgccgccggtg 19283272



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 61/72 (84%), Gaps = 2/72 (2%)
 Strand = Plus / Minus

                                                                            
Query: 161      gtagcagtcgaggttgcctccggtggccg-tgccaagcatgccgcagtagcgcgtgtagt 219
                |||||||||||||||| |||| || |||| |||| |||| | |||||||||||  |||| 
Sbjct: 19292208 gtagcagtcgaggttg-ctcccgtagccgatgccgagcacgtcgcagtagcgctggtaga 19292150

                            
Query: 220      agccgatgcggt 231
                ||||||| ||||
Sbjct: 19292149 agccgatccggt 19292138



to top

>gb|L37289.1|RICCHITA Oryza sativa chitinase mRNA, complete cds
          Length = 1291

 Score = 63.9 bits (32), Expect = 3e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
           |||||||| | ||||||||||||||| |||||||| |||||||| || ||||||||
Sbjct: 905 ccgcactccaacccgccgttgatgatgttggtgatcacgccgtaccccggcacccg 850



 Score = 40.1 bits (20), Expect = 4.6
 Identities = 61/72 (84%), Gaps = 2/72 (2%)
 Strand = Plus / Minus

                                                                        
Query: 161  gtagcagtcgaggttgcctccggtggccg-tgccaagcatgccgcagtagcgcgtgtagt 219
            |||||||||||||||| |||| || |||| |||| |||| | |||||||||||  |||| 
Sbjct: 1002 gtagcagtcgaggttg-ctcccgtagccgatgccgagcacgtcgcagtagcgctggtaga 944

                        
Query: 220  agccgatgcggt 231
            ||||||| ||||
Sbjct: 943  agccgatccggt 932



to top

>emb|X76041.1|TACHIG T.aestivum (Chinese spring) chi gene for endochitinase
          Length = 1985

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 49/55 (89%)
 Strand = Plus / Minus

                                                                   
Query: 258  ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
            |||||||||||||| ||||||||||| || ||||| || ||||| ||||||||||
Sbjct: 1477 ccgcactcgagcccaccgttgatgatgttagtgatcacaccgtacccaggcaccc 1423



to top

>dbj|AB029935.1| Triticum aestivum mRNA for chitinase 2, complete cds
          Length = 1163

 Score = 61.9 bits (31), Expect = 1e-06
 Identities = 46/51 (90%)
 Strand = Plus / Minus

                                                              
Query: 242 gtcgttctggcccatgccgcactcgagcccgccgttgatgatattggtgat 292
           ||||||||| ||||||||||| |||| ||||||||||||||  ||||||||
Sbjct: 860 gtcgttctgccccatgccgcattcgatcccgccgttgatgacgttggtgat 810



to top

>gb|AY532766.1| Zea diploperennis isolate d8 chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532765.1| Zea diploperennis isolate d7 chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532764.1| Zea diploperennis isolate d6 chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532763.1| Zea diploperennis isolate d5 chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532762.1| Zea diploperennis isolate d5b chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532761.1| Zea diploperennis isolate d4 chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532760.1| Zea diploperennis isolate d3 chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532759.1| Zea diploperennis isolate d2 chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532758.1| Zea diploperennis isolate d1 chitinase (chiI) gene, complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532757.1| Zea mays subsp. parviglumis isolate p15 chitinase (chiI) gene,
           complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532756.1| Zea mays subsp. parviglumis isolate p14b chitinase (chiI) gene,
           complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532755.1| Zea mays subsp. parviglumis isolate p14 chitinase (chiI) gene,
           complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532754.1| Zea mays subsp. parviglumis isolate p13b chitinase (chiI) gene,
           complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532753.1| Zea mays subsp. parviglumis isolate p13 chitinase (chiI) gene,
           complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532752.1| Zea mays subsp. parviglumis isolate p12 chitinase (chiI) gene,
           complete cds
          Length = 1082

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532751.1| Zea mays subsp. parviglumis isolate p11 chitinase (chiI) gene,
           complete cds
          Length = 1081

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 849 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 805



to top

>gb|AY532750.1| Zea mays subsp. parviglumis isolate p9 chitinase (chiI) gene,
           complete cds
          Length = 1084

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 852 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 808



to top

>gb|AY532749.1| Zea mays subsp. parviglumis isolate p8 chitinase (chiI) gene,
           complete cds
          Length = 1081

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 849 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 805



to top

>gb|AY532748.1| Zea mays subsp. parviglumis isolate p6 chitinase (chiI) gene,
           complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532747.1| Zea mays subsp. parviglumis isolate p5 chitinase (chiI) gene,
           complete cds
          Length = 1089

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 849 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 805



to top

>gb|AY532746.1| Zea mays subsp. parviglumis isolate p4 chitinase (chiI) gene,
           complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532745.1| Zea mays subsp. parviglumis isolate p3 chitinase (chiI) gene,
           complete cds
          Length = 1078

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532744.1| Zea mays subsp. parviglumis isolate p2 chitinase (chiI) gene,
           complete cds
          Length = 1087

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 846 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 802



to top

>gb|AY532743.1| Zea mays subsp. parviglumis isolate p1 chitinase (chiI) gene,
           complete cds
          Length = 1081

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||||||| |||||||  ||||||||
Sbjct: 849 gccgcactcgaggccgccgttgatgatgttggtgacgacgccgta 805



to top

>gb|U02286.1|OSU02286 Oryza sativa IR58 chitinase mRNA, complete cds
          Length = 1051

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 41/45 (91%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           ||||||||| ||||||||||||| ||| |||||||| ||||||||
Sbjct: 874 gccgcactccagcccgccgttgacgatgttggtgatcacgccgta 830



 Score = 46.1 bits (23), Expect = 0.075
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 155 ctgggtgtagcagtcgaggttgcctccggtg 185
           |||| ||||||||||||||||||| ||||||
Sbjct: 976 ctggttgtagcagtcgaggttgccgccggtg 946



to top

>gb|AY453406.1| Bambusa oldhamii chitinase mRNA, complete cds
          Length = 1232

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           ||||||||||||||||| |||||||| || ||||| ||||||||
Sbjct: 881 ccgcactcgagcccgccattgatgatgttcgtgatgacgccgta 838



to top

>emb|X56787.1|OSLMRNAC O.sativa L. mRNA for endochitinase
          Length = 1186

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||| ||||||||||||| ||| |||||||| ||||||||
Sbjct: 884 ccgcactccagcccgccgttgacgatgttggtgatcacgccgta 841



 Score = 46.1 bits (23), Expect = 0.075
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 155 ctgggtgtagcagtcgaggttgcctccggtg 185
           |||| ||||||||||||||||||| ||||||
Sbjct: 987 ctggttgtagcagtcgaggttgccgccggtg 957



to top

>emb|X15349.1|HVENDCHT Barley (H.vulgare) mRNA for endochitinase
          Length = 556

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
           |||||||||| ||||||||||| ||| |||||||| |||||  | |||||||||||
Sbjct: 419 ccgcactcgatcccgccgttgacgatgttggtgatcacgccaaacccaggcacccg 364



to top

>gb|AF167323.1|AF167323 Medicago truncatula clone T130002g putative chitinase gene, partial
           cds
          Length = 260

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
           ||||| |||||||| |||||||| || |||||||| ||||||||||| || |||||
Sbjct: 177 ccgcattcgagcccaccgttgattatgttggtgatcacgccgtatccggggacccg 122



to top

>dbj|AK108949.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-153-C03, full
           insert sequence
          Length = 979

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||| ||||||||||||| ||| |||||||| ||||||||
Sbjct: 549 ccgcactccagcccgccgttgacgatgttggtgatcacgccgta 506



 Score = 46.1 bits (23), Expect = 0.075
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 155 ctgggtgtagcagtcgaggttgcctccggtg 185
           |||| ||||||||||||||||||| ||||||
Sbjct: 652 ctggttgtagcagtcgaggttgccgccggtg 622



to top

>gb|AY106654.1| Zea mays PCO078819 mRNA sequence
          Length = 574

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 258 ccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||| ||| ||||||||||| |||||||| ||||||||
Sbjct: 309 ccgcactcgatcccaccgttgatgatgttggtgatcacgccgta 352



to top

>gb|AY103739.1| Zea mays PCO142303 mRNA sequence
          Length = 1077

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 248 ctggcccatgccgcactcgagcccgccgttgatgat 283
           ||||||| |||||||||| |||||||||||||||||
Sbjct: 712 ctggcccttgccgcactctagcccgccgttgatgat 677



to top

>dbj|D16222.1|RICCHT2 Oryza sativa (japonica cultivar-group) Cht-2 gene for endochitinase,
            complete cds
          Length = 2986

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 258  ccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
            |||||||| ||||||||||||| ||| |||||||| ||||||||
Sbjct: 2319 ccgcactccagcccgccgttgacgatgttggtgatcacgccgta 2276



 Score = 46.1 bits (23), Expect = 0.075
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 155  ctgggtgtagcagtcgaggttgcctccggtg 185
            |||| ||||||||||||||||||| ||||||
Sbjct: 2422 ctggttgtagcagtcgaggttgccgccggtg 2392



to top

>gb|U02287.1|HVU02287 Hordeum vulgare cultivar NK1558 chitinase gene, complete cds
          Length = 1684

 Score = 56.0 bits (28), Expect = 8e-05
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 258  ccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcacccg 313
            |||||||||| ||||||||||| ||| |||||||| |||||  | |||||||||||
Sbjct: 1438 ccgcactcgatcccgccgttgacgatgttggtgatcacgccaaacccaggcacccg 1383



to top

>gb|L34210.1|BLYCHI26A Hordeum vulgare chitinase (CHI26) gene, complete cds
          Length = 3169

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                               
Query: 258  ccgcactcgagcccgccgttgatgatattggtgat 292
            |||||||||| ||||||||||||||| ||||||||
Sbjct: 2380 ccgcactcgatcccgccgttgatgatgttggtgat 2346



to top

>gb|M62904.1|BLYCHI H.vulgare L. 26kD chitinase mRNA, complete cds
          Length = 998

 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 33/35 (94%)
 Strand = Plus / Minus

                                              
Query: 258 ccgcactcgagcccgccgttgatgatattggtgat 292
           |||||||||| ||||||||||||||| ||||||||
Sbjct: 743 ccgcactcgatcccgccgttgatgatgttggtgat 709



to top

>ref|NM_183568.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1086

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 260 gcactcgagcccgccgttgatgatattggtga 291
           |||||||||||||||||||| ||| |||||||
Sbjct: 969 gcactcgagcccgccgttgacgatgttggtga 938



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 260      gcactcgagcccgccgttgatgatattggtga 291
                |||||||||||||||||||| ||| |||||||
Sbjct: 10340370 gcactcgagcccgccgttgacgatgttggtga 10340401



to top

>dbj|AP002070.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0511C01
          Length = 170402

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                             
Query: 260   gcactcgagcccgccgttgatgatattggtga 291
             |||||||||||||||||||| ||| |||||||
Sbjct: 47090 gcactcgagcccgccgttgacgatgttggtga 47121



to top

>dbj|AK063062.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-110-F11, full
           insert sequence
          Length = 1055

 Score = 48.1 bits (24), Expect = 0.019
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 260 gcactcgagcccgccgttgatgatattggtga 291
           |||||||||||||||||||| ||| |||||||
Sbjct: 787 gcactcgagcccgccgttgacgatgttggtga 756



to top

>dbj|AB051579.1| Secale cereale rscc mRNA for seed chitinase-c, complete cds
          Length = 1018

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 258 ccgcactcgagcccgccgttgatgatattggtgat 292
           |||||||||||||| || |||||||| ||||||||
Sbjct: 737 ccgcactcgagcccaccattgatgatgttggtgat 703



to top

>gb|AY973230.1| Triticum aestivum cultivar Sumai 3 class II chitinase gene,
           complete cds
          Length = 811

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 258 ccgcactcgagcccgccgttgatgatattggtgat 292
           |||||||||| ||| ||||||||||| ||||||||
Sbjct: 683 ccgcactcgatcccaccgttgatgatgttggtgat 649



to top

>gb|AY973229.1| Triticum aestivum cultivar Gamenya class II chitinase gene,
           complete cds
          Length = 891

 Score = 46.1 bits (23), Expect = 0.075
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 258 ccgcactcgagcccgccgttgatgatattggtgat 292
           |||||||||| ||| ||||||||||| ||||||||
Sbjct: 683 ccgcactcgatcccaccgttgatgatgttggtgat 649



to top

>emb|BX547936.5| Mouse DNA sequence from clone RP23-109A11 on chromosome X, complete
            sequence
          Length = 70333

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 44   tcgaattatttatttcatgatg 65
            ||||||||||||||||||||||
Sbjct: 5730 tcgaattatttatttcatgatg 5751



to top

>gb|L16798.1|MZECHITINA Zea mays class I acidic chitinase mRNA, partial cds
          Length = 1012

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 272 gccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||| ||||||||
Sbjct: 663 gccgttgatgatgttggtgatgacgccgta 634



to top

>dbj|AB015655.1| Cucurbita cv. Ebisu Nankin chitP1 mRNA for chitinase, complete cds
          Length = 1058

 Score = 44.1 bits (22), Expect = 0.30
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 261 cactcgagcccgccgttgatgatattggtgattacgccgtatccaggcac 310
           ||||||||||| || |||||||| |||||||| || || || ||||||||
Sbjct: 841 cactcgagcccaccattgatgatgttggtgatgacaccatacccaggcac 792



to top

>gb|AC182674.2| Populus trichocarpa clone Pop1-27N13, complete sequence
          Length = 118702

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 272   gccgttgatgatattggtgat 292
             |||||||||||||||||||||
Sbjct: 65745 gccgttgatgatattggtgat 65765



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 142    tagcgaagtttcgctgggtgt 162
              |||||||||||||||||||||
Sbjct: 206606 tagcgaagtttcgctgggtgt 206626



to top

>emb|Z78202.1|PACHI1 Persea americana mRNA for endochitinase
          Length = 1120

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 256 tgccgcactcgagcccgccgttgatgatattggtgat 292
           ||||||| |||| ||| ||||||||||| ||||||||
Sbjct: 866 tgccgcattcgatcccaccgttgatgatgttggtgat 830



to top

>emb|Z68152.1|GHCHI2A G.hirsutum chitinase gene (2439 bp)
          Length = 2439

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 276  ttgatgatattggtgattacgccgtatccaggcacccgacc 316
            |||||||| ||||| || || ||||||||||| ||||||||
Sbjct: 1519 ttgatgatgttggtaatgacaccgtatccagggacccgacc 1479



to top

>gb|DQ078281.1| Ulmus americana chitinase (CHT) mRNA, complete cds
          Length = 966

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 273 ccgttgatgatattggtgattacgccgta 301
           |||||||| ||||||||||| ||||||||
Sbjct: 809 ccgttgataatattggtgatcacgccgta 781



to top

>gb|L00973.1|MZECHITC Zea mays acidic class I chitinase mRNA, complete cds
          Length = 1128

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgta 301
           |||||||||||| |||||||||  ||| |||||||  ||||||||
Sbjct: 864 gccgcactcgaggccgccgttggagatgttggtgacgacgccgta 820



to top

>gb|L22032.1|ULMCHITIN Ulmus americana chitinase (pHS2) mRNA, complete cds
          Length = 1193

 Score = 42.1 bits (21), Expect = 1.2
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 273 ccgttgatgatattggtgattacgccgta 301
           |||||||| ||||||||||| ||||||||
Sbjct: 896 ccgttgataatattggtgatcacgccgta 868



to top

>gb|AY705804.1| Pinus halepensis clone 27r chitinase-like mRNA, complete sequence
          Length = 1332

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 258 ccgcactcgagcccgccgttgatgatattggt 289
           ||||| || ||||||||||||||||| |||||
Sbjct: 885 ccgcattccagcccgccgttgatgatgttggt 854



to top

>gb|AY643483.1| Drosera spathulata CHIT1 (chit1) gene, partial cds
          Length = 911

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 270 ccgccgttgatgatattggtgattacgccgta 301
           |||||||||||||| |||||||| || |||||
Sbjct: 907 ccgccgttgatgatgttggtgatcaccccgta 876



to top

>gb|AY205337.1| Mycobacterium smegmatis fatty acid synthetase I (fas1) and acyl
            carrier protein synthetase (acpS) genes, complete cds
          Length = 10279

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 233  gacgttggcgtcgttctggcccat 256
            |||| |||||||||||||||||||
Sbjct: 7606 gacgatggcgtcgttctggcccat 7583



to top

>gb|AY618888.1| Nepenthes khasiana basic chitinase 2-2 mRNA, complete cds
          Length = 957

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
           |||||| |||| ||| ||||||||||| || ||||  || ||| ||||||||||||
Sbjct: 816 gccgcattcgaccccaccgttgatgatgtttgtgaccacaccgaatccaggcaccc 761



to top

>gb|AY618887.1| Nepenthes khasiana basic chitinase 2-2 gene, complete cds
          Length = 1674

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 257  gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
            |||||| |||| ||| ||||||||||| || ||||  || ||| ||||||||||||
Sbjct: 1533 gccgcattcgaccccaccgttgatgatgtttgtgaccacaccgaatccaggcaccc 1478



to top

>gb|AY618886.1| Nepenthes khasiana basic chitinase 2-1 mRNA, complete cds
          Length = 957

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 257 gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
           |||||| |||| ||| ||||||||||| || ||||  || ||| ||||||||||||
Sbjct: 816 gccgcattcgaccccaccgttgatgatgtttgtgaccacaccgaatccaggcaccc 761



to top

>gb|AY618885.1| Nepenthes khasiana basic chitinase 2-1 gene, complete cds
          Length = 1673

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                    
Query: 257  gccgcactcgagcccgccgttgatgatattggtgattacgccgtatccaggcaccc 312
            |||||| |||| ||| ||||||||||| || ||||  || ||| ||||||||||||
Sbjct: 1532 gccgcattcgaccccaccgttgatgatgtttgtgaccacaccgaatccaggcaccc 1477



to top

>gb|AC139334.3| Mus musculus BAC clone RP23-449C21 from chromosome 18, complete sequence
          Length = 194665

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 48     attatttatttcatgatggg 67
              ||||||||||||||||||||
Sbjct: 116014 attatttatttcatgatggg 115995



to top

>emb|Z29962.1|OSCHITIB O.sativa (PCH6) mRNA for chitinase class I
          Length = 1100

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 270 ccgccgttgatgatattggtgattacgccgta 301
           |||||||||||||| ||||||||  |||||||
Sbjct: 839 ccgccgttgatgatgttggtgatctcgccgta 808



to top

>emb|X54367.1|OSCHIT Oryza sativa (rice) gene for endochitinase
          Length = 1237

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 270 ccgccgttgatgatattggtgattacgccgta 301
           |||||||||||||| ||||||||  |||||||
Sbjct: 966 ccgccgttgatgatgttggtgatctcgccgta 935



to top

>gb|AY880227.1| Chaenorhinum minus voucher UTEP 37492 internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence
          Length = 601

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 232 cgacgttggcgtcgttctgg 251
           ||||||||||||||||||||
Sbjct: 104 cgacgttggcgtcgttctgg 123



to top

>emb|Z68153.1|GHCHI2B G.hirsutum chitinase gene (2525 bp)
          Length = 2525

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 276  ttgatgatattggtgattacgccgtatccagg 307
            |||||||| |||||||| || |||||||||||
Sbjct: 1569 ttgatgatgttggtgatgacaccgtatccagg 1538



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                                
Query: 270      ccgccgttgatgatattggtgattacgccgta 301
                |||||||||||||| ||||||||  |||||||
Sbjct: 30372217 ccgccgttgatgatgttggtgatctcgccgta 30372186



to top

>dbj|AP004685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
            clone:P0017G10
          Length = 166700

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 270  ccgccgttgatgatattggtgattacgccgta 301
            |||||||||||||| ||||||||  |||||||
Sbjct: 9578 ccgccgttgatgatgttggtgatctcgccgta 9547



to top

>dbj|AP003685.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0548E04
          Length = 138037

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 270    ccgccgttgatgatattggtgattacgccgta 301
              |||||||||||||| ||||||||  |||||||
Sbjct: 118812 ccgccgttgatgatgttggtgatctcgccgta 118781



to top

>dbj|AK061280.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-F06, full
           insert sequence
          Length = 1169

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 270 ccgccgttgatgatattggtgattacgccgta 301
           |||||||||||||| ||||||||  |||||||
Sbjct: 904 ccgccgttgatgatgttggtgatctcgccgta 873



to top

>gb|AF105426.1|AF105426 Cynodon dactylon chitinase (Cht2) gene, complete cds
          Length = 1788

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 260  gcactcgagcccgccgttgatgatattggtga 291
            |||||||||||| ||||||| ||| |||||||
Sbjct: 1060 gcactcgagcccaccgttgacgatgttggtga 1029



to top

>dbj|D14846.1|PSEEAPGA Pseudomonas sp. gene for endo alpha-1,4 polygalactosaminidase
           precusor, complete cds
          Length = 1233

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 324 gtatcggcagccgtcggcgtccag 347
           ||||||||| ||||||||||||||
Sbjct: 346 gtatcggcaaccgtcggcgtccag 323



to top

>dbj|D16223.1|RICCHT3 Oryza sativa (japonica cultivar-group) Cht-3 gene for endochitinase,
            complete cds
          Length = 2808

 Score = 40.1 bits (20), Expect = 4.6
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 270  ccgccgttgatgatattggtgattacgccgta 301
            |||||||||||||| ||||||||  |||||||
Sbjct: 2659 ccgccgttgatgatgttggtgatctcgccgta 2628


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,078,256
Number of Sequences: 3902068
Number of extensions: 2078256
Number of successful extensions: 35675
Number of sequences better than 10.0: 109
Number of HSP's better than 10.0 without gapping: 109
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 35407
Number of HSP's gapped (non-prelim): 253
length of query: 349
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 327
effective length of database: 17,147,199,772
effective search space: 5607134325444
effective search space used: 5607134325444
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top