ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah62g18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF495586.1| Setaria italica putative C4 phosphoenolpyruvate c... 343 4e-91
2emb|X17379.1|SVPEPC Sorghum vulgare mRNA for phosphoenolpyruvate... 335 1e-88
3emb|AJ318338.1|SSP318338 Saccharum spontaneum mRNA for putative ... 333 4e-88
4gb|AY135709.1| Saccharum hybrid cultivar putative C4 phosphoenol... 325 1e-85
5emb|AJ293347.1|SVE293347 Sorghum verticilliflorum partial mRNA f... 325 1e-85
6emb|X63756.1|SVPEPCAA S.vulgare PEPC gene 319 6e-84
7emb|AJ293346.1|SOF293346 Saccharum officinarum mRNA for putative... 317 3e-83
8emb|AJ318582.1|EAU318582 Eulalia aurea partial 3' end mRNA for p... 313 4e-82
9emb|AJ318583.1|VZI318583 Vetiveria zizanioides partial 3' end mR... 309 6e-81
10emb|AJ536629.1|ZMA536629 Zea mays mRNA for phosphoenolpyruvate c... 301 2e-78
11emb|X15238.1|ZMPEPC1 Maize mRNA for phosphoenolpyruvate carboxyl... 301 2e-78
12gb|AY103747.1| Zea mays PCO070206 mRNA sequence 301 2e-78
13emb|X15239.1|ZMPEPC1G Maize PEPC1 gene for phosphoenolpyruvate c... 299 6e-78
14emb|X15642.1|ZMPEP Z.mays gene for phosphoenolpyruvate carboxyla... 291 1e-75
15emb|X03613.1|ZMPEPCR Maize mRNA for phosphoenolpyruvate carboxyl... 285 9e-74
16emb|X65137.1|SVPEPCGX S.vulgare pepC gene for PEP carboxylase 280 6e-72
17emb|X55664.1|SVPEPCA Sorghum vulgare mRNA for phosphoenolpyruvat... 280 6e-72
18emb|AJ318339.1|SSP318339 Saccharum hybrid cultivar R570 partial ... 280 6e-72
19gb|AY109352.1| Zea mays CL1793_1 mRNA sequence 280 6e-72
20dbj|AB012228.1| Zea mays mRNA for phosphoenolpyruvate carboxylas... 280 6e-72
21emb|AJ293348.1|CLA293348 Coix lacryma-jobi partial mRNA for puta... 276 9e-71
22emb|AJ318341.1|SSP318341 Saccharum hybrid cultivar R570 partial ... 272 1e-69
23gb|BT017928.1| Zea mays clone EL01N0519G10.c mRNA sequence 264 3e-67
24gb|AY491400.1| Setaria italica C3 phosphoenolpyruvate carboxylas... 258 2e-65
25emb|AJ318340.1|SSP318340 Saccharum hybrid cultivar R570 partial ... 256 8e-65
26gb|AY251482.1| Echinochloa crus-galli phosphoenolpyruvate carbox... 256 8e-65
27gb|AY995212.1| Echinochloa crus-galli C4 phosphoenolpyruvate car... 190 4e-45
28dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 184 2e-43
29gb|AF271995.1|AF271995 Oryza sativa phosphoenolpyruvate carboxyl... 184 2e-43
30dbj|AP004117.3| Oryza sativa (japonica cultivar-group) genomic D... 184 2e-43
31dbj|AK065425.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
32dbj|AK065029.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
33dbj|AK062201.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
34gb|AF268091.1|AF268091 Chloris gayana phosphoenolpyruvate carbox... 135 2e-28
35ref|NM_188369.1| Oryza sativa (japonica cultivar-group), predic... 129 1e-26
36dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
37dbj|AP003052.3| Oryza sativa (japonica cultivar-group) genomic D... 129 1e-26
38dbj|AK066635.1| Oryza sativa (japonica cultivar-group) cDNA clon... 129 1e-26
39emb|AJ318342.1|SSP318342 Saccharum hybrid cultivar R570 partial ... 127 5e-26
40emb|AJ318343.1|SSP318343 Saccharum hybrid cultivar R570 partial ... 127 5e-26
41dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
42dbj|AP005802.3| Oryza sativa (japonica cultivar-group) genomic D... 127 5e-26
43emb|X61489.1|ZMPHOPCAR Zea mays pep gene for (C3 type) phosphoen... 119 1e-23
44emb|X59925.1|SVPEPCG S.vulgare PEPC gene for phosphoenolpyruvate... 117 5e-23
45gb|AY111910.1| Zea mays CL16446_1 mRNA sequence 109 1e-20
46gb|M86661.1|SCFSCPEPCD Saccharum hybrid cultivar H32-8560 phosph... 105 2e-19
47gb|AY107882.1| Zea mays PCO089178 mRNA sequence 101 3e-18
48emb|AJ312652.1|KPI312652 Kalanchoe pinnata partial mRNA for phos... 98 4e-17
49emb|AJ312651.1|KPI312651 Kalanchoe pinnata partial mRNA for phos... 98 4e-17
50emb|AJ312650.1|KPI312650 Kalanchoe pinnata partial mRNA for phos... 98 4e-17
51emb|AJ344058.1|KPI344058 Kalanchoe pinnata partial mRNA for phos... 98 4e-17
52emb|AJ344057.1|KPI344057 Kalanchoe pinnata partial mRNA for phos... 98 4e-17
53emb|AJ344056.1|KPI344056 Kalanchoe pinnata partial mRNA for phos... 98 4e-17
54emb|AJ007705.1|TAE7705 Triticum aestivum PEPC gene 88 4e-14
55ref|NM_188892.2| Oryza sativa (japonica cultivar-group), mRNA 84 7e-13
56ref|XM_507204.1| PREDICTED Oryza sativa (japonica cultivar-group... 84 7e-13
57dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
58dbj|AP003913.3| Oryza sativa (japonica cultivar-group) genomic D... 84 7e-13
59dbj|AK073703.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 7e-13
60dbj|AK070742.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 7e-13
61dbj|AK067572.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 7e-13
62dbj|AK061683.1| Oryza sativa (japonica cultivar-group) cDNA clon... 84 7e-13
63gb|AY187619.1| Oryza sativa (indica cultivar-group) phosphoenolp... 84 7e-13
64gb|AY349322.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 ... 80 1e-11
65gb|AY349321.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 ... 80 1e-11
66gb|AY349316.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 ... 80 1e-11
67gb|AY349312.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 ... 80 1e-11
68gb|AY349311.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 ... 80 1e-11
69gb|AY349310.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 ... 80 1e-11
70gb|AY349308.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 ... 80 1e-11
71gb|AY349306.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 ... 80 1e-11
72gb|AY349304.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 ... 80 1e-11
73gb|AY349303.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 ... 80 1e-11
74gb|AY349302.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 ... 80 1e-11
75gb|AY349298.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 ... 80 1e-11
76emb|Y15897.1|TAPEPC Triticum aestivum mRNA for phosphoenolpyruva... 80 1e-11
77emb|AJ312627.1|VPL312627 Vanilla planifolia partial mRNA for pho... 80 1e-11
78dbj|D13987.1|BNAPE3 Brassica napus PE3-PEPCase gene for phosphoe... 80 1e-11
79gb|AY349319.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 ... 72 3e-09
80gb|AY349318.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 ... 72 3e-09
81gb|AY349317.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 ... 72 3e-09
82gb|AY349315.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 ... 72 3e-09
83gb|AY349314.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 ... 72 3e-09
84gb|AY349313.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 ... 72 3e-09
85gb|AY349309.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 ... 72 3e-09
86gb|AY349307.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 ... 72 3e-09
87gb|AY349305.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 ... 72 3e-09
88gb|AY349301.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 ... 72 3e-09
89gb|AY349299.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 ... 72 3e-09
90emb|AJ312626.1|VPL312626 Vanilla planifolia partial mRNA for pho... 72 3e-09
91emb|AJ252929.1|VPAJ2929 Vanilla pompona partial mRNA for phospho... 72 3e-09
92emb|AJ312663.1|MEX312663 Microcoelia exilis partial mRNA for pho... 70 1e-08
93emb|AJ312632.1|KDA312632 Kalanchoe daigremontiana partial mRNA f... 70 1e-08
94emb|AJ252946.1|KGAJ2946 Kalanchoe gracilipes partial mRNA for ph... 68 4e-08
95emb|AJ252923.1|KSAJ2923 Kalanchoe streptantha partial mRNA for p... 68 4e-08
96emb|AJ231303.1|KSAJ1303 Kalanchoe streptantha partial mRNA for p... 68 4e-08
97emb|AJ231288.1|KGAJ1288 Kalanchoe gracilipes partial mRNA for ph... 68 4e-08
98ref|NM_191306.1| Oryza sativa (japonica cultivar-group), predic... 66 2e-07
99gb|DQ320104.1| Clusia hilariana phosphoenolpyruvate carboxylase ... 66 2e-07
100emb|AJ312680.1|KFE312680 Kalanchoe fedtschenkoi partial mRNA for... 66 2e-07
101emb|AJ312674.1|ABA312674 Aloe vera partial mRNA for phosphoenolp... 66 2e-07
102emb|AJ312624.1|VPL312624 Vanilla planifolia partial mRNA for pho... 66 2e-07
103emb|AJ252928.1|VAAJ2928 Vanilla aphylla partial mRNA for phospho... 66 2e-07
104emb|AJ252924.1|KSAJ2924 Kalanchoe streptantha partial mRNA for p... 66 2e-07
105dbj|AP003409.4| Oryza sativa (japonica cultivar-group) genomic D... 66 2e-07
106dbj|AK101274.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 2e-07
107dbj|AK070480.1| Oryza sativa (japonica cultivar-group) cDNA clon... 66 2e-07
108gb|AY210895.1| Arabidopsis thaliana phosphoenolpyruvate carboxyl... 66 2e-07
109dbj|AB055075.1| Oryza sativa (japonica cultivar-group) mRNA for ... 66 2e-07
110gb|AY349320.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 ... 64 6e-07
111gb|AY349300.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 ... 64 6e-07
112emb|AJ312644.1|MCR312644 Mesembryanthemum crystallinum partial m... 64 6e-07
113emb|AJ252947.1|KPAJ2947 Kalanchoe petitiana partial mRNA for pho... 64 6e-07
114emb|AJ231295.1|KPAJ1295 Kalanchoe petitiana partial mRNA for pho... 64 6e-07
115gb|AF236126.1| Vitis vinifera PEP carboxylase (GPEPC) mRNA, part... 64 6e-07
116gb|AY517644.1| Chlamydomonas reinhardtii phosphoenolpyruvate car... 64 6e-07
117emb|Z71976.1|FTPPCC F.trinervia ppcC gene (partial) 62 2e-06
118emb|AJ312681.1|KFE312681 Kalanchoe fedtschenkoi partial mRNA for... 62 2e-06
119emb|AJ312661.1|MEX312661 Microcoelia exilis partial mRNA for pho... 62 2e-06
120emb|AJ400987.1|EST400987 Epidendrum stamfordianum partial mRNA f... 62 2e-06
121emb|AJ300742.1|PAM300742 Phalaenopsis amabilis partial ppc gene ... 62 2e-06
122emb|AJ300741.1|PEQ300741 Phalaenopsis equestris partial ppc gene... 62 2e-06
123emb|AJ252921.1|KPAJ2921 Kalanchoe pinnata partial mRNA for phosp... 62 2e-06
124emb|AJ231294.1|PCAJ1294 Polytrichum commune partial mRNA for pho... 62 2e-06
125emb|AJ231280.1|BRAJ1280 Bucegia romanica partial mRNA for phosph... 62 2e-06
126gb|AF248080.1|AF248080 Flaveria trinervia phosphoenolpyruvate ca... 62 2e-06
127emb|X87820.1|KBRNAPPC3 K.blossfeldiana mRNA for phosphoenolpyruv... 60 1e-05
128emb|AJ231284.1|DSAJ1284 Dicranum scoparium partial mRNA for phos... 60 1e-05
129emb|AJ312682.1|KFE312682 Kalanchoe fedtschenkoi partial mRNA for... 60 1e-05
130emb|AJ312679.1|KFE312679 Kalanchoe fedtschenkoi partial mRNA for... 60 1e-05
131emb|AJ312678.1|KFE312678 Kalanchoe fedtschenkoi partial mRNA for... 60 1e-05
132emb|AJ312673.1|ABA312673 Aloe vera partial mRNA for phosphoenolp... 60 1e-05
133emb|AJ312668.1|LBI312668 Leptotes bicolor partial mRNA for phosp... 60 1e-05
134emb|AJ312665.1|SAP312665 Solenangis aphylla partial mRNA for pho... 60 1e-05
135emb|AJ312662.1|MEX312662 Microcoelia exilis partial mRNA for pho... 60 1e-05
136emb|AJ312660.1|ETI312660 Euphorbia tirucalli partial mRNA for ph... 60 1e-05
137emb|AJ312649.1|KPI312649 Kalanchoe pinnata partial mRNA for phos... 60 1e-05
138emb|AJ312646.1|KPI312646 Kalanchoe pinnata partial mRNA for phos... 60 1e-05
139emb|AJ312634.1|KDA312634 Kalanchoe daigremontiana partial mRNA f... 60 1e-05
140emb|AJ344055.1|KPI344055 Kalanchoe pinnata partial mRNA for phos... 60 1e-05
141emb|AJ344052.1|KPI344052 Kalanchoe pinnata partial mRNA for phos... 60 1e-05
142emb|AJ252925.1|KSAJ2925 Kalanchoe streptantha partial mRNA for p... 60 1e-05
143emb|AJ252922.1|KPAJ2922 Kalanchoe pinnata partial mRNA for phosp... 60 1e-05
144gb|AF008939.1|AF008939 Gossypium hirsutum phosphoenolpyruvate ca... 60 1e-05
145emb|AJ312655.1|TUS312655 Tillandsia usneoides partial mRNA for p... 60 1e-05
146emb|AJ001028.1|KFPEPC458 Kalanchoe fedtschenkoi mRNA for phospho... 60 1e-05
147emb|X91406.1|TUPPC T.usneoides mRNA for phosphoenolpyruvate deca... 58 4e-05
148emb|AJ252948.1|VPAJ2948 Vanilla phalaenopsis partial mRNA for ph... 58 4e-05
149emb|AJ252932.1|VPAJ2932 Vanilla phalaenopsis partial mRNA for ph... 58 4e-05
150emb|AJ252930.1|VPAJ2930 Vanilla phalaenopsis partial mRNA for ph... 58 4e-05
151emb|AJ252927.1|VAAJ2927 Vanilla aphylla partial mRNA for phospho... 58 4e-05
152gb|AF271161.2| Hydrilla verticillata phosphoenolpyruvate carboxy... 56 2e-04
153emb|AJ312670.1|LBI312670 Leptotes bicolor partial mRNA for phosp... 56 2e-04
154emb|AJ312647.1|KPI312647 Kalanchoe pinnata partial mRNA for phos... 56 2e-04
155emb|AJ312635.1|KDA312635 Kalanchoe daigremontiana partial mRNA f... 56 2e-04
156emb|AJ312630.1|ACO312630 Ananas comosus partial mRNA for phospho... 56 2e-04
157emb|AJ312628.1|ACO312628 Ananas comosus partial mRNA for phospho... 56 2e-04
158emb|AJ312617.1|CRE312617 Cycas revoluta partial mRNA for phospho... 56 2e-04
159emb|AJ344053.1|KPI344053 Kalanchoe pinnata partial mRNA for phos... 56 2e-04
160emb|AJ252920.1|KPAJ2920 Kalanchoe pinnata partial mRNA for phosp... 56 2e-04
161emb|AJ252919.1|KPAJ2919 Kalanchoe pinnata partial mRNA for phosp... 56 2e-04
162emb|AJ252915.1|KKAJ2915 Kalanchoe kewensis partial mRNA for phos... 56 2e-04
163emb|AJ231293.1|MHAJ1293 Mnium hornum partial mRNA for phosphoeno... 56 2e-04
164emb|AJ312683.1|KFE312683 Kalanchoe fedtschenkoi partial mRNA for... 54 6e-04
165emb|AJ312648.1|KPI312648 Kalanchoe pinnata partial mRNA for phos... 54 6e-04
166emb|AJ312641.1|MCR312641 Mesembryanthemum crystallinum partial m... 54 6e-04
167emb|AJ344054.1|KPI344054 Kalanchoe pinnata partial mRNA for phos... 54 6e-04
168emb|AJ252918.1|KGAJ2918 Kalanchoe grandiflora partial mRNA for p... 54 6e-04
169emb|AJ231296.1|PFAJ1296 Polytrichum formosum partial mRNA for ph... 54 6e-04
170emb|AJ231289.1|LCAJ1289 Lunularia cruciata partial mRNA for phos... 54 6e-04
171dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone... 54 6e-04
172dbj|AB092821.1| Lotus japonicus LjPEPC2 mRNA for phosphoenolpyru... 54 6e-04
173emb|X95856.1|NAPPC1 Neoregelia ampullacea mRNA for phosphoenolpy... 52 0.002
174emb|X87819.1|KBRNAPPC2 K.blossfeldiana mRNA for phosphoenolpyruv... 52 0.002
175emb|X87818.1|KBRNAPPC1 K.blossfeldiana mRNA for phosphoenolpyruv... 52 0.002
176emb|X87149.1|VPPPCGE1 V.planifolia mRNA for phosphoenolpyruvate ... 52 0.002
177emb|X14588.1|MCPPCB Mesembryanthemum crystallinum ppc2 gene for ... 52 0.002
178emb|AJ312654.1|TUS312654 Tillandsia usneoides partial mRNA for p... 52 0.002
179emb|AJ312653.1|TUS312653 Tillandsia usneoides partial mRNA for p... 52 0.002
180emb|AJ312633.1|KDA312633 Kalanchoe daigremontiana partial mRNA f... 52 0.002
181emb|AJ252926.1|KPAJ2926 Kalanchoe petitiana partial mRNA for pho... 52 0.002
182emb|AJ252914.1|KKAJ2914 Kalanchoe kewensis partial mRNA for phos... 52 0.002
183emb|AJ243416.1|LES243416 Lycopersicon esculentum mRNA for phosph... 52 0.002
184emb|AJ231290.1|LJAJ1290 Leucobryum juniperoideum partial mRNA fo... 52 0.002
185dbj|D10717.1|SOYGMPPC Glycine max mRNA for phosphoenolpyruvate c... 52 0.002
186emb|Z48966.1|FPPPCAMR F.pringlei ppcA mRNA for phosphoenolpyruva... 50 0.009
187emb|X64144.2|FPPPCA Flaveria pringlei ppcA1 gene for phosphoenol... 50 0.009
188gb|DQ320106.1| Clusia multiflora phosphoenolpyruvate carboxylase... 50 0.009
189gb|DQ320102.1| Clusia hilariana phosphoenolpyruvate carboxylase ... 50 0.009
190emb|AJ312656.1|TUS312656 Tillandsia usneoides partial mRNA for p... 50 0.009
191emb|AJ312638.1|CUV312638 Clusia uvitana partial mRNA for phospho... 50 0.009
192emb|AJ252945.1|KGAJ2945 Kalanchoe grandiflora partial mRNA for p... 50 0.009
193emb|AJ231291.1|LPAJ1291 Leptobryum pyriforme partial mRNA for ph... 50 0.009
194emb|AJ231283.1|DHAJ1283 Dicranella heteromalla partial mRNA for ... 50 0.009
195dbj|AB078718.1| Nicotiana sylvestris Nsppc1 gene for phosphoenol... 50 0.009
196gb|AF271163.1| Hydrilla verticillata phosphoenolpyruvate carboxy... 48 0.037
197gb|AF271162.1| Hydrilla verticillata phosphoenolpyruvate carboxy... 48 0.037
198emb|X87821.1|KBRNAPCC4 K.blossfeldiana mRNA for phosphoenolpyruv... 48 0.037
199gb|DQ320105.1| Clusia minor phosphoenolpyruvate carboxylase (pep... 48 0.037
200emb|AJ312637.1|CUV312637 Clusia uvitana partial mRNA for phospho... 48 0.037
201emb|AJ252917.1|KTAJ2917 Kalanchoe tomentosa partial mRNA for pho... 48 0.037
202emb|AJ252916.1|KTAJ2916 Kalanchoe tomentosa partial mRNA for pho... 48 0.037
203emb|AJ231292.1|MCAJ1292 Marchantia calcarata partial mRNA for ph... 48 0.037
204emb|BX511072.8| Zebrafish DNA sequence from clone CH211-63A11 in... 48 0.037
205gb|AF512995.1| Citrus junos phosphoenolpyruvate carboxylase (pep... 48 0.037
206emb|BX682557.11| Zebrafish DNA sequence from clone DKEY-288D17 i... 48 0.037
207gb|AY663388.1| Lupinus albus phosphoenolpyruvate carboxylase 4 m... 48 0.037
208emb|AM237200.1| Lupinus luteus mRNA for phosphoenolpyrovate carb... 48 0.037
209ref|NM_180042.1| Arabidopsis thaliana ATPPC2 (PHOSPHOENOLPYRUVAT... 46 0.14
210ref|NM_180041.1| Arabidopsis thaliana ATPPC2 (PHOSPHOENOLPYRUVAT... 46 0.14
211emb|CR356245.25| Zebrafish DNA sequence from clone CH211-257I15 ... 46 0.14
212emb|CR759774.13| Zebrafish DNA sequence from clone CH211-147P17 ... 46 0.14
213gb|AC125474.16| Medicago truncatula clone mth2-16l11, complete s... 46 0.14
214emb|CR405713.7| Zebrafish DNA sequence from clone DKEY-12D5 in l... 46 0.14
215gb|AY074346.2| Arabidopsis thaliana At2g42600 mRNA sequence 46 0.14
216emb|Z71974.1|FTPPCB F.trinervia ppcB gene (partial) 46 0.14
217emb|Z71973.1|FPPPCB F.pringlei ppcB gene (partial) 46 0.14
218emb|Z25853.1|FAPHOCAR F.australasica mRNA for phosphoenolpyruvat... 46 0.14
219emb|X95861.1|VPPPC1 Vanilla planifolia mRNA for phosphoenolpyruv... 46 0.14
220emb|X91631.1|AEPPCGENE A.eburneum mRNA for phosphoenolpyruvate c... 46 0.14
221emb|X64143.2|FTPPCA Flaveria trinervia ppcA1 gene for phosphoeno... 46 0.14
222emb|X61304.1|FTPEPC F.trinervia mRNA for phosphoenolpyruvate car... 46 0.14
223emb|AJ312675.1|PLO312675 Pyrrosia longifolia partial mRNA for ph... 46 0.14
224emb|AJ532902.1|ATH532902 Arabidopsis thaliana mRNA for phosphoen... 46 0.14
225emb|AJ417435.1|CSA417435 Cucumis sativus partial mRNA for phosph... 46 0.14
226emb|AJ286750.1|SRO286750 Sesbania rostrata mRNA for phosphoenolp... 46 0.14
227emb|AJ231297.1|PQAJ1297 Preissia quadrata partial mRNA for phosp... 46 0.14
228emb|AJ231281.1|BSAJ1281 Brachythecium salebrosum partial mRNA fo... 46 0.14
229emb|AJ011302.1|VFA011302 Vicia faba mRNA for phosphoenolpyruvate... 46 0.14
230emb|BX908769.7| Zebrafish DNA sequence from clone DKEY-78I1 in l... 46 0.14
231emb|BX324226.16| Zebrafish DNA sequence from clone DKEY-202B10 i... 46 0.14
232emb|BX510990.32| Zebrafish DNA sequence from clone CH211-67F13 i... 46 0.14
233gb|AC007087.7| Arabidopsis thaliana chromosome 2 clone F14N22 ma... 46 0.14
234gb|AC104533.3| Homo sapiens chromosome 19 clone LLNLR-276C7, com... 46 0.14
235emb|BX001025.23| Zebrafish DNA sequence from clone CH211-240D20,... 46 0.14
236emb|BX511164.11| Zebrafish DNA sequence from clone DKEY-63J1 in ... 46 0.14
237gb|AC004597.1|AC004597 Homo sapiens chromosome 19, cosmid F20722... 46 0.14
238emb|BX248115.12| Zebrafish DNA sequence from clone CH211-208K15 ... 46 0.14
239gb|AF288382.1|AF288382 Phaseolus vulgaris phosphoenolpyruvate ca... 46 0.14
240emb|BX821882.1|CNS0A9A6 Arabidopsis thaliana Full-length cDNA Co... 46 0.14
241gb|AF248079.1|AF248079 Flaveria trinervia phosphoenolpyruvate ca... 46 0.14
242emb|BX255962.9| Zebrafish DNA sequence from clone CH211-269C21 i... 46 0.14
243emb|BX510916.7| Zebrafish DNA sequence from clone DKEY-208B17 in... 46 0.14
244emb|BX005129.6| Zebrafish DNA sequence from clone CH211-241D24 i... 46 0.14
245dbj|AB097087.1| Glycine max GmPEPC15 gene for phosphoenolpyruvat... 46 0.14
246emb|BX957233.8| Zebrafish DNA sequence from clone DKEY-224H10 in... 46 0.14
247gb|AF145301.1|AF145301 Arabidopsis thaliana 14-3-3 protein GF14 ... 46 0.14
248gb|AF135371.1|AF135371 Lotus corniculatus phosphoenol pyruvate c... 46 0.14
249emb|AM235211.1| Lupinus luteus mRNA for phosphoenolpyruvate carb... 46 0.14
250dbj|D13998.1|SOYPEPC Glycine max gmppc1 mRNA for phosphoenolpyru... 46 0.14
251emb|CR352262.23| Zebrafish DNA sequence from clone DKEY-39F23 in... 46 0.14
252emb|CR759821.9| Zebrafish DNA sequence from clone DKEY-190C14 in... 46 0.14
253emb|BX936386.9| Zebrafish DNA sequence from clone CH211-232P21 i... 46 0.14
254gb|M83086.1|ALFPPPCA Medicago sativa phosphoenolpyruvate carboxy... 46 0.14
255gb|L39371.1|ALFPEPC Medicago sativa phosphoenolpyruvate carboxyl... 46 0.14
256dbj|D64037.1|PEASPARKLE Pea mRNA for phosphoenolpyruvate carboxy... 46 0.14
257dbj|AB008542.1| Glycine max mRNA for phosphoenolpyruvate carboxy... 46 0.14
258gb|AY830136.1| Synechococcus sp. PCC 7002 phosphoenolpyruvate ca... 44 0.57
259ref|NM_185571.2| Oryza sativa (japonica cultivar-group), mRNA 44 0.57
260ref|XM_479618.1| Oryza sativa (japonica cultivar-group), mRNA 44 0.57
261gb|AC163492.3| Mus musculus chromosome 18, clone RP23-411L20, co... 44 0.57
262gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, co... 44 0.57
263gb|AC025260.29| Homo sapiens 12 BAC RP11-356O22 (Roswell Park Ca... 44 0.57
264gb|AC121246.28| Medicago truncatula clone mth2-35m8, complete se... 44 0.57
265emb|BX901897.6| Zebrafish DNA sequence from clone DKEY-115H20 in... 44 0.57
266emb|Z99758.8|HS800F24 Human DNA sequence from clone RP4-800F24 o... 44 0.57
267emb|AL353787.21| Human DNA sequence from clone RP11-667H17 on ch... 44 0.57
268emb|AL136109.11| Human DNA sequence from clone RP5-924G13 on chr... 44 0.57
269emb|AL138815.6| Human DNA sequence from clone RP11-141F12 on chr... 44 0.57
270emb|X91634.1|VAPPCGENE V.aphylla mRNA for phosphoenolpyruvate ca... 44 0.57
271emb|AJ310353.1|GSP310353 Sticherus bifidus partial mRNA for phos... 44 0.57
272emb|AJ231299.1|SBAJ1299 Symphyogyna brongniartii partial mRNA fo... 44 0.57
273emb|AJ231285.1|FHAJ1285 Funaria hygrometrica partial mRNA for ph... 44 0.57
274emb|BX510938.11| Zebrafish DNA sequence from clone DKEY-92K1 in ... 44 0.57
275gb|AE005927.1| Caulobacter crescentus CB15 section 253 of 359 of... 44 0.57
276gb|AC091614.3| Homo sapiens chromosome 1 clone RP4-665J23, compl... 44 0.57
277gb|AC008615.8| Homo sapiens chromosome 5 clone CTB-144A14, compl... 44 0.57
278emb|BX294395.15| Zebrafish DNA sequence from clone CH211-220B11 ... 44 0.57
279dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.57
280dbj|AB097088.1| Glycine max GmPEPC7 gene for phosphoenolpyruvate... 44 0.57
281dbj|AK100433.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.57
282dbj|AK071795.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.57
283dbj|AP004333.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.57
284gb|AC109499.21| Mus musculus chromosome 18, clone RP23-349E12, c... 44 0.57
285dbj|AB111050.1| Oryza sativa (japonica cultivar-group) PDC3 mRNA... 44 0.57
286gb|U07338.1|OSU07338 Oryza sativa pyruvate decarboxylase (pdc3) ... 44 0.57
287dbj|AB008540.1| Glycine max mRNA for phosphoenolpyruvate carboxy... 44 0.57
288gb|BT016688.1| Zea mays clone Contig521 mRNA sequence 42 2.3
289gb|BC035710.1| Homo sapiens zinc finger and BTB domain containin... 42 2.3
290ref|NM_172926.1| Mus musculus sorting nexin 14 (Snx14), mRNA 42 2.3
291gb|AF119709.3| Homo sapiens chromosome 8 clone GS1-169I10 map q2... 42 2.3
292ref|XM_544073.2| PREDICTED: Canis familiaris similar to CG12002-... 42 2.3
293gb|AC087428.3| Homo sapiens chromosome 3 clone RP11-18I13 map 3p... 42 2.3
294gb|AE014311.1| Homo sapiens chromosome 13q34 schizophrenia regio... 42 2.3
295emb|AL606970.12| Human DNA sequence from clone RP11-503C24 on ch... 42 2.3
296emb|AL606823.4| Human DNA sequence from clone RP11-49K6 on chrom... 42 2.3
297emb|AL359852.20| Human DNA sequence from clone RP11-299J5 on chr... 42 2.3
298emb|AL359272.9| Human DNA sequence from clone RP11-554P16 on chr... 42 2.3
299emb|AL354944.22| Human DNA sequence from clone RP11-106H5 on chr... 42 2.3
300emb|AL354695.12| Human DNA sequence from clone RP11-265G8 on chr... 42 2.3
301emb|AL161910.19| Human DNA sequence from clone RP11-260L6 on chr... 42 2.3
302emb|AL157711.12| Human DNA sequence from clone RP11-21M8 on chro... 42 2.3
303gb|AC025774.5| Homo sapiens chromosome 5 clone CTD-2292N2, compl... 42 2.3
304emb|AL021939.1|HS352A20 Human DNA sequence from clone RP3-352A20... 42 2.3
305emb|Z68125.1|AHC4PHPEC A.hypochondriacus mRNA for C4 photosynthe... 42 2.3
306emb|Y17843.1|SWI17843 Selenicereus wittii mRNA for phosphoenolpy... 42 2.3
307emb|X95862.1|EHPPC13 Equisetum hyemale mRNA for phosphoenolpyruv... 42 2.3
308emb|X95860.1|PAPPC1 Pereskia aculeata mRNA for phosphoenolpyruva... 42 2.3
309emb|X91636.1|AEPPCGEN1 A.eburneum mRNA for phosphoenolpyruvate c... 42 2.3
310emb|X17555.1|ZMPDCGENE Zea mays mRNA for pyruvate decarboxylase 42 2.3
311gb|DQ320103.1| Clusia hilariana phosphoenolpyruvate carboxylase ... 42 2.3
312emb|AJ312677.1|PLO312677 Pyrrosia longifolia partial mRNA for ph... 42 2.3
313emb|AJ312631.1|ACO312631 Ananas comosus partial mRNA for phospho... 42 2.3
314emb|AJ231300.1|SNAJ1300 Scapania nemorea partial mRNA for phosph... 42 2.3
315emb|AJ231286.1|HCAJ1286 Hypnum cupressiforme partial mRNA for ph... 42 2.3
316emb|CR855397.9| Zebrafish DNA sequence from clone CH73-77E20 in ... 42 2.3
317emb|BX784034.8| Zebrafish DNA sequence from clone CH211-194O4 in... 42 2.3
318gb|AC090337.5| Homo sapiens chromosome 18, clone RP11-674P19, co... 42 2.3
319dbj|AK133266.1| Mus musculus adult male testis cDNA, RIKEN full-... 42 2.3
320gb|U65001.3|SSU65001 Sphingomonas xenophaga strain BN6 putative ... 42 2.3
321gb|AC093328.3| Homo sapiens chromosome 8, clone RP11-30J20, comp... 42 2.3
322ref|XM_937669.1| PREDICTED: Homo sapiens zinc finger and BTB dom... 42 2.3
323gb|AC026585.9| Homo sapiens, clone RP11-17E3, complete sequence 42 2.3
324ref|XM_928961.1| PREDICTED: Homo sapiens zinc finger and BTB dom... 42 2.3
325dbj|AK046839.1| Mus musculus 10 days neonate medulla oblongata c... 42 2.3
326gb|AC040914.5|AC040914 Homo sapiens chromosome 8, clone RP11-343... 42 2.3
327dbj|AK049371.1| Mus musculus ES cells cDNA, RIKEN full-length en... 42 2.3
328dbj|AK082389.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE... 42 2.3
329gb|AC108037.3| Homo sapiens BAC clone RP11-168E17 from 4, comple... 42 2.3
330gb|AC116340.3| Homo sapiens chromosome 5 clone RP11-118I21, comp... 42 2.3
331gb|AC020718.7| Homo sapiens BAC clone RP11-472L21 from 2, comple... 42 2.3
332gb|AC000371.1|HSAC000371 Human cosmid g1980a181, complete sequence 42 2.3
333gb|AC011609.9|AC011609 Homo sapiens 3 BAC RP11-114K9 (Roswell Pa... 42 2.3
334gb|BC080799.1| Mus musculus sorting nexin 14, mRNA (cDNA clone M... 42 2.3
335emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome comple... 42 2.3
336gb|AY109914.1| Zea mays CL1676_1 mRNA sequence 42 2.3
337gb|L49175.1|AMHCPPC Amaranthus hypochondriacus C4 photosynthetic... 42 2.3
338gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 42 2.3
339gb|AC005584.1|AC005584 Homo sapiens clone UWGC:g5129z012 from 7q... 42 2.3
340emb|CT025673.8| Mouse DNA sequence from clone RP24-286H7 on chro... 42 2.3
341gb|AC002498.1|AC002498 Human Cosmid g5129g124 from 7q31.3, compl... 42 2.3
342gb|AF008940.1|AF008940 Gossypium hirsutum phosphoenolpyruvate ca... 42 2.3
343dbj|AB092820.1| Lotus japonicus LjPEPC1 mRNA for phosphoenolpyru... 42 2.3
344dbj|AB082524.1| Homo sapiens mRNA for KIAA1993 protein 42 2.3
345ref|NM_112356.2| Arabidopsis thaliana ATPPC3 (PHOSPHOENOLPYRUVAT... 40 8.9
346gb|AC136227.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.9
347gb|AC136224.2| Oryza sativa (japonica cultivar-group) chromosome... 40 8.9
348gb|BT017181.1| Zea mays clone EL01N0369E04.c mRNA sequence 40 8.9
349gb|AC161268.5| Mus musculus BAC clone RP23-198F11 from chromosom... 40 8.9
350gb|AC161235.6| Mus musculus chromosome 3, clone RP24-86C19, comp... 40 8.9
351gb|AC160987.4| Mus musculus BAC clone RP23-248O24 from chromosom... 40 8.9
352gb|AC185978.2| Pan troglodytes BAC clone CH251-508B17 from chrom... 40 8.9
353gb|AC139568.5| Mus musculus chromosome 12, clone RP23-208G5, com... 40 8.9
354gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, c... 40 8.9
355gb|CP000352.1| Ralstonia metallidurans CH34, complete genome 40 8.9
356ref|XM_842861.1| Leishmania major strain Friedlin hypothetical p... 40 8.9
357emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete ... 40 8.9
358emb|BX548019.36| Zebrafish DNA sequence from clone DKEY-20D1 in ... 40 8.9
359emb|CR855332.7| Zebrafish DNA sequence from clone DKEY-31M14 in ... 40 8.9
360gb|AC114774.5| Homo sapiens BAC clone RP11-466J24 from 4, comple... 40 8.9
361gb|AC152061.6| Mus musculus BAC clone RP23-351K4 from chromosome... 40 8.9
362gb|AF068709.1| Caenorhabditis elegans cosmid C24B9, complete seq... 40 8.9
363emb|CR759881.16| Zebrafish DNA sequence from clone CH211-165K16 ... 40 8.9
364emb|Z92545.1|HS50A13 Human DNA sequence from clone RP1-50A13 on ... 40 8.9
365emb|AL607079.7| Human DNA sequence from clone RP11-565A2 on chro... 40 8.9
366emb|AL590608.6| Human DNA sequence from clone RP11-363F12 on chr... 40 8.9
367emb|AL512290.11| Human DNA sequence from clone RP13-143G15 on ch... 40 8.9
368emb|AL451046.8| Human DNA sequence from clone RP11-174C7 on chro... 40 8.9
369emb|AL449363.12| Human DNA sequence from clone CTA-444M12 on chr... 40 8.9
370emb|AL356473.11| Human DNA sequence from clone RP11-560O20 on ch... 40 8.9
371emb|AL353751.13| Human DNA sequence from clone RP11-149I23 on ch... 40 8.9
372emb|AL163542.8| Human DNA sequence from clone RP11-360I23 on chr... 40 8.9
373emb|AL161786.12| Human DNA sequence from clone RP11-344L17 on ch... 40 8.9
374emb|AL159980.14| Human DNA sequence from clone RP11-56M2 on chro... 40 8.9
375emb|AL160275.14| Human DNA sequence from clone RP11-402G3 on chr... 40 8.9
376emb|AL158824.11| Human DNA sequence from clone RP11-165N19 on ch... 40 8.9
377gb|CP000091.1| Ralstonia eutropha JMP134 chromosome 2, complete ... 40 8.9
378emb|AL136991.26| Human DNA sequence from clone RP11-189J1 on chr... 40 8.9
379emb|AL138709.19| Human DNA sequence from clone RP11-460G11 on ch... 40 8.9
380gb|AC131213.4| Homo sapiens 12 BAC RP13-544K12 (Roswell Park Can... 40 8.9
381emb|AL031293.1|HS864I18 Human DNA sequence from clone RP5-864I18... 40 8.9
382emb|AL023575.1|HS931E15 Human DNA sequence from clone RP5-931E15... 40 8.9
383emb|BX908389.7| Zebrafish DNA sequence from clone DKEY-98G7 in l... 40 8.9
384gb|AC091204.3| Drosophila melanogaster 3L NOVECTOR RP98-27G13 (R... 40 8.9
385emb|X95857.1|CFPPC3 Chara fragalis mRNA for phosphoenolpyruvate ... 40 8.9
386emb|X95853.1|CCPPC1 Conocephalum conicum mRNA for phosphoenolpyr... 40 8.9
387emb|X14587.1|MCPPCA Mesembryanthemum crystallinum ppc1 gene for ... 40 8.9
388emb|X13660.1|MCPPCR Mesembryanthemum crystallinum mRNA for phosp... 40 8.9
389gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 40 8.9
390gb|AC098799.2| Homo sapiens BAC clone RP11-642E20 from 4, comple... 40 8.9
391emb|AL607152.21| Mouse DNA sequence from clone RP23-198N14 on ch... 40 8.9
392emb|BX571661.1| Wolinella succinogenes, complete genome; segment... 40 8.9
393emb|AL627265.1| Salmonella enterica serovar Typhi (Salmonella ty... 40 8.9
394emb|AL138650.1|ATT5N23 Arabidopsis thaliana DNA chromosome 3, BA... 40 8.9
395emb|AJ312659.1|ETI312659 Euphorbia tirucalli partial mRNA for ph... 40 8.9
396emb|AJ312657.1|ETI312657 Euphorbia tirucalli partial mRNA for ph... 40 8.9
397emb|AJ312643.1|MCR312643 Mesembryanthemum crystallinum partial m... 40 8.9
398emb|AJ312642.1|MCR312642 Mesembryanthemum crystallinum partial m... 40 8.9
399emb|AJ243415.1|PPE243415 Prunus persica partial partial mRNA for... 40 8.9
400emb|AJ231302.1|SPAJ1302 Scleropodium purum partial mRNA for phos... 40 8.9
401emb|AJ223497.1|BRJ223497 Brassica juncea mRNA for phosphoenolpyr... 40 8.9
402emb|AJ131710.1|ATH131710 Arabidopsis thaliana pepc gene, exons 1-10 40 8.9
403emb|CR932960.3| Medicago truncatula chromosome 5 clone mth4-7a5,... 40 8.9
404gb|AC105130.8| Homo sapiens chromosome 8, clone RP11-357L10, com... 40 8.9
405emb|CR392344.7| Zebrafish DNA sequence from clone CH211-239D11 i... 40 8.9
406emb|BX571721.8| Zebrafish DNA sequence from clone DKEY-250L23 in... 40 8.9
407emb|CR857356.1| Pongo pygmaeus mRNA; cDNA DKFZp469K2332 (from cl... 40 8.9
408gb|AC080096.21| Homo sapiens 3 BAC RP11-443O18 (Roswell Park Can... 40 8.9
409gb|AC009879.8| Homo sapiens, clone RP11-346I3, complete sequence 40 8.9
410gb|AC117444.6| Homo sapiens 3 BAC RP11-215L17 (Roswell Park Canc... 40 8.9
411emb|BX544881.7| Zebrafish DNA sequence from clone DKEY-64F15 in ... 40 8.9
412gb|AC023449.11| Homo sapiens chromosome 15, clone RP11-345J18, c... 40 8.9
413gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 8.9
414emb|BX530023.5| Zebrafish DNA sequence from clone DKEYP-50D11 in... 40 8.9
415gb|AC087763.10| Homo sapiens chromosome 8, clone RP11-62H7, comp... 40 8.9
416gb|AC087726.36| Chlamydomonas reinhardtii clone cr-40a20, comple... 40 8.9
417gb|AC090433.10| Chlamydomonas reinhardtii clone cr-19b23, comple... 40 8.9
418gb|AE011708.1| Xanthomonas axonopodis pv. citri str. 306, secti... 40 8.9
419tpg|BK005078.1| TPA: TPA_inf: Oryza sativa (indica cultivar-grou... 40 8.9
420gb|AC108215.4| Homo sapiens BAC clone RP11-630A13 from 4, comple... 40 8.9
421gb|AC161015.4| Pan troglodytes BAC clone CH251-489I22 from chrom... 40 8.9
422gb|AE012171.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 8.9
423gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 8.9
424gb|AC116345.2| Homo sapiens chromosome 5 clone RP11-232L2, compl... 40 8.9
425gb|AC108695.2| Homo sapiens 3 BAC RP11-744C8 (Roswell Park Cance... 40 8.9
426gb|AC091225.2| Drosophila melanogaster 3L BAC RP98-34B24 (Roswel... 40 8.9
427gb|AC020944.4| Homo sapiens chromosome 19 clone LLNLF-123D5, com... 40 8.9
428gb|AC012492.9| Homo sapiens BAC clone RP11-224B10 from 2, comple... 40 8.9
429gb|AC160829.3| Xenopus tropicalis MLC2 gene, complete cds, compl... 40 8.9
430gb|AC091609.2| Homo sapiens chromosome 1 clone RP11-109I2, compl... 40 8.9
431gb|AC025445.5| Homo sapiens chromosome 5 clone CTD-2049O17, comp... 40 8.9
432gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome 40 8.9
433gb|AC020942.6| Homo sapiens chromosome 5 clone CTD-2361L15, comp... 40 8.9
434gb|AF325500.1|AF325500 Antheraea yamamai transposon mariner-like... 40 8.9
435gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 8.9
436gb|AY517643.1| Chlamydomonas reinhardtii phosphoenolpyruvate car... 40 8.9
437gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete g... 40 8.9
438gb|AC153881.4| Mus musculus 10 BAC RP23-257B9 (Roswell Park Canc... 40 8.9
439gb|AC159476.5| Mus musculus 10 BAC RP23-53O16 (Roswell Park Canc... 40 8.9
440emb|BX324225.7| Zebrafish DNA sequence from clone DKEY-180I22 in... 40 8.9
441dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
442gb|AC027559.17| Homo sapiens chromosome 15, clone RP11-89K11, co... 40 8.9
443emb|BX255936.11| Zebrafish DNA sequence from clone CH211-113K19 ... 40 8.9
444gb|AC026416.4|AC026416 Homo sapiens chromosome 5 clone CTD-2048J... 40 8.9
445gb|AC009120.8|AC009120 Homo sapiens chromosome 16 clone RP11-484... 40 8.9
446gb|AC005798.10|AC005798 Homo sapiens chromosome 4 clone RP11-442... 40 8.9
447gb|AC074378.4| Homo sapiens BAC clone RP11-4I17 from 4, complete... 40 8.9
448gb|AC105384.3| Homo sapiens BAC clone RP11-89B16 from 4, complet... 40 8.9
449gb|AC021101.8| Homo sapiens BAC clone RP11-114P18 from 4, comple... 40 8.9
450gb|AC133109.3| Homo sapiens BAC clone RP11-698M13 from 2, comple... 40 8.9
451gb|AC147328.4| Pan troglodytes BAC clone RP43-30N11 from chromos... 40 8.9
452gb|AC154651.2| Mus musculus BAC clone RP24-261K2 from chromosome... 40 8.9
453gb|AC139700.7| Homo sapiens 3 BAC RP11-963H1 (Roswell Park Cance... 40 8.9
454gb|AC140484.1| Homo sapiens BAC clone RP11-806A6 from 4, complet... 40 8.9
455dbj|AP003376.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
456gb|AC108715.2| Homo sapiens 3 BAC RP11-184F3 (Roswell Park Cance... 40 8.9
457gb|AC022311.5| Homo sapiens BAC clone RP11-146M24 from 2, comple... 40 8.9
458gb|BT004642.1| Arabidopsis thaliana At3g14940 gene, complete cds 40 8.9
459gb|AC011235.4| Homo sapiens BAC clone RP11-295A19 from 2, comple... 40 8.9
460gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 8.9
461gb|AC177793.1| Pan troglodytes chromosome X clone CH251-542N20 m... 40 8.9
462gb|AC109512.12| Homo sapiens chromosome 15, clone RP11-931B1, co... 40 8.9
463gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 8.9
464dbj|BA000016.3| Clostridium perfringens str. 13 DNA, complete ge... 40 8.9
465emb|AL954143.9| Zebrafish DNA sequence from clone CH211-206A7 in... 40 8.9
466emb|BX537115.11| Zebrafish DNA sequence from clone CH211-207B20 ... 40 8.9
467dbj|BS000057.1| Pan troglodytes chromosome 22 clone:RP43-020J03,... 40 8.9
468emb|BX005018.8| Zebrafish DNA sequence from clone DKEY-209K18, c... 40 8.9
469dbj|AP000370.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 40 8.9
470dbj|AB020742.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 8.9
471dbj|AB013394.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 8.9
472ref|XM_560538.1| Anopheles gambiae str. PEST ENSANGP00000025779 ... 40 8.9
473gb|AC002460.1|AC002460 Human BAC clone CTB-191D16, complete sequ... 40 8.9
474gb|AC005993.2|AC005993 Homo sapiens PAC clone RP6-114E22 from 14... 40 8.9
475emb|Z82976.1|HS506G2B Human DNA sequence from clone RP3-506G2 on... 40 8.9
476emb|AL591807.1|CNS07EGQ Human chromosome 14 DNA sequence BAC R-1... 40 8.9
477emb|CR381668.8| Zebrafish DNA sequence from clone CH211-238A12 i... 40 8.9
478emb|BX276101.6| Zebrafish DNA sequence from clone CH211-101L18 i... 40 8.9
479emb|BX005474.6| Zebrafish DNA sequence from clone CH211-141E22 i... 40 8.9
480gb|AY104181.1| Zea mays PCO060230 mRNA sequence 40 8.9
481emb|CR931761.6| Zebrafish DNA sequence from clone DKEY-27P1 in l... 40 8.9
482gb|AE014613.1| Salmonella enterica subsp. enterica serovar Typhi... 40 8.9
483gb|AC005598.6|AC005598 Homo sapiens chromosome 4 clone C0024K08 ... 40 8.9
484emb|AL132639.4|CNS01DT4 Human chromosome 14 DNA sequence BAC R-4... 40 8.9
485gb|AE003557.4| Drosophila melanogaster chromosome 3L, section 28... 40 8.9
486emb|AL133502.4|CNS01DVA Human chromosome 14 DNA sequence BAC R-1... 40 8.9
487gb|AE017220.1| Salmonella enterica subsp. enterica serovar Chole... 40 8.9
488dbj|AP001695.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.9
489dbj|AP001678.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.9
490emb|CT010481.8| M.truncatula DNA sequence from clone MTH2-62G7 o... 40 8.9
491dbj|AB085948.1| Eleocharis vivipara pep1 mRNA for phosphoenolpyr... 40 8.9
492gb|AF071788.1|AF071788 Arabidopsis thaliana phosphoenolpyruvate ... 40 8.9
493emb|AL732494.16| Mouse DNA sequence from clone RP23-322L22 on ch... 40 8.9
494gb|AC153417.1| Mus musculus BAC clone RP24-169H4 from 9, complet... 40 8.9
495gb|AC003002.1|AC003002 Human DNA from overlapping chromosome 19-... 40 8.9
496emb|AL928954.9| Zebrafish DNA sequence from clone CH211-127D4 in... 40 8.9
497dbj|AP006074.1| Lotus japonicus genomic DNA, chromosome 3, clone... 40 8.9
498gb|U65227.1|HVU65227 Hydrilla verticillata phosphoenolpyruvate c... 40 8.9
499emb|AL935045.6| Zebrafish DNA sequence from clone CH211-183M1, c... 40 8.9
500emb|AL109967.2|HS22F01 Homo sapiens chromosome 21 PAC LLNCO21F01... 40 8.9

>gb|AF495586.1| Setaria italica putative C4 phosphoenolpyruvate carboxylase (ppc)
            mRNA, complete cds
          Length = 3214

 Score =  343 bits (173), Expect = 4e-91
 Identities = 328/377 (87%), Gaps = 2/377 (0%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2958 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 2899

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgc-cggctggttct 397
            |||||||||| |||| |||||||||| |||||||||||| | |  ||| |||||||||||
Sbjct: 2898 cagccccggcccgtactcgctcgccgggttgagcttcacaatcc-cgcgcggctggttct 2840

                                                                        
Query: 398  cgtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccgga 457
            ||||||||||||||||||||||||||||||||| |||||||| |||| | |||||||  |
Sbjct: 2839 cgtcggcgaactccttggacagcggcggctgcggcgtcaccttgaagttcgggtccctta 2780

                                                                        
Query: 458  tccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagcc 517
            ||| |||||| ||||||||||| |||||||| ||  |||||||||||||||| |||||||
Sbjct: 2779 tcctcttcagggtgtaggcctgccacacgttaagaatggtgatgtaggggtcgcgcagcc 2720

                                                                        
Query: 518  gcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctgga 577
            ||||| |||||||||||   || |||  |||||| |  ||| | || ||||||||||| |
Sbjct: 2719 gcagctgctgcttcaggccgggatcgctttcaaggatttccttgtgcccagcaacctgca 2660

                                                                        
Query: 578  cgagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagct 637
             ||  |||||||  || ||| || ||||| ||||||||||||||||||  |||||||| |
Sbjct: 2659 ggataagcttctctgtttccacgtagttgttcctgagctgctccccgaatggcttgagtt 2600

                             
Query: 638  cgtcggcgacaagcagc 654
            |||||||||| ||||||
Sbjct: 2599 cgtcggcgacgagcagc 2583



to top

>emb|X17379.1|SVPEPC Sorghum vulgare mRNA for phosphoenolpyruvate involved in C4
            photosynthesis (EC 4.1.1.31)
          Length = 3192

 Score =  335 bits (169), Expect = 1e-88
 Identities = 326/376 (86%), Gaps = 3/376 (0%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 2914 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 2855

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||||||||||| ||| ||||||||||  || |||||||||||    || |||| ||||||
Sbjct: 2854 cagccccggcg-gtactcgctcgccg--ttcagcttcaccagtccggcgggcttgttctc 2798

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||  ||
Sbjct: 2797 gtcggcgaactccttggacagcggcggctgcggcgtcaccttgaagctggggtcccttat 2738

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||| ||||||||||||||||||||||||| |  ||||| ||
Sbjct: 2737 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtagggattgcgcagacg 2678

                                                                        
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctggac 578
            ||||| |||||||||||| || ||| ||||||||| |||| | || ||||| | ||| | 
Sbjct: 2677 cagcccctgcttcaggtaaggatcgccttcaagaatgtccttgtgcccagcgatctgtag 2618

                                                                        
Query: 579  gagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagctc 638
            ||| |||| ||  || ||| || | |||  ||||||||||| ||| | ||||||||| ||
Sbjct: 2617 gagaagctgctgtgtctccacgtatttgtccctgagctgcttcccaaagggcttgagttc 2558

                            
Query: 639  gtcggcgacaagcagc 654
             |||||||||||||||
Sbjct: 2557 ctcggcgacaagcagc 2542



to top

>emb|AJ318338.1|SSP318338 Saccharum spontaneum mRNA for putative C4 phosphoenolpyruvate
            carboxylase (pepc gene), (C4 PPCSs-1)
          Length = 3015

 Score =  333 bits (168), Expect = 4e-88
 Identities = 324/376 (86%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| ||
Sbjct: 2886 ctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtcttc 2827

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            |||||| |||| |||||||||||||| ||| |||||||||||    || |||| ||||||
Sbjct: 2826 cagcccgggcgggtattcgctcgccgggttcagcttcaccagtccggcgggcttgttctc 2767

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            ||||||||||||||||||||| |||||||||| |||||||| ||||||||||||||  ||
Sbjct: 2766 gtcggcgaactccttggacagtggcggctgcggcgtcaccttgaagctggggtcccttat 2707

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||  ||||||||||||||||||||||||| |  || |||||
Sbjct: 2706 ccgcttcagcgtgtaggcctgcaacacgttcagggtggtgatgtagggattgcgtagccg 2647

                                                                        
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctggac 578
            ||||| |||||||||||| || ||| |||||||||  ||| | || ||||| | ||| | 
Sbjct: 2646 cagcccctgcttcaggtaaggatcgccttcaagaatatccttgtgcccagcgatctgtag 2587

                                                                        
Query: 579  gagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagctc 638
            ||| |||||||  || |||  | | |||  ||||||||||| ||| | ||||||||| ||
Sbjct: 2586 gagaagcttctctgtctccatgtatttgtccctgagctgcttcccaaagggcttgagatc 2527

                            
Query: 639  gtcggcgacaagcagc 654
            ||||||||||||||||
Sbjct: 2526 gtcggcgacaagcagc 2511



to top

>gb|AY135709.1| Saccharum hybrid cultivar putative C4 phosphoenolpyruvate carboxylase
            mRNA, complete cds
          Length = 3205

 Score =  325 bits (164), Expect = 1e-85
 Identities = 323/376 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| ||
Sbjct: 2981 ctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtcttc 2922

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            |||||| |||| ||| |||||||||| ||| |||||||||||    || |||| ||||||
Sbjct: 2921 cagcccgggcgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgttctc 2862

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||| ||||||||||| |||||||| |||||| || ||||  ||
Sbjct: 2861 gtcggcgaactccttggacaacggcggctgcggcgtcaccttgaagctcggatcccttat 2802

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||  ||||||||||||||||||||||||| |  ||||||||
Sbjct: 2801 ccgcttcagcgtgtaggcctgcaacacgttcagggtggtgatgtagggattgcgcagccg 2742

                                                                        
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctggac 578
            ||||| |||||||||||| || ||| |||||||||  ||| | || ||||| | ||| | 
Sbjct: 2741 cagcccctgcttcaggtaaggatcgccttcaagaatatccttgtgcccagcgatctgtag 2682

                                                                        
Query: 579  gagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagctc 638
            ||| |||||||  || ||| || | |||  ||||||||||| ||| | ||||||||| ||
Sbjct: 2681 gagaagcttctctgtctccacgtatttgtccctgagctgcttcccaaagggcttgagatc 2622

                            
Query: 639  gtcggcgacaagcagc 654
            ||||||||||||||||
Sbjct: 2621 gtcggcgacaagcagc 2606



to top

>emb|AJ293347.1|SVE293347 Sorghum verticilliflorum partial mRNA for putative C4
           phosphoenolpyruvate carboyxlase (PEPC gene)
          Length = 504

 Score =  325 bits (164), Expect = 1e-85
 Identities = 251/280 (89%)
 Strand = Plus / Minus

                                                                       
Query: 279 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
           |||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 321 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagagtgtcttc 262

                                                                       
Query: 339 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
           ||||||||| | ||| |||||||||| ||| |||||||||||    || |||| ||||||
Sbjct: 261 cagccccggtgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgttctc 202

                                                                       
Query: 399 gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
           |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||  ||
Sbjct: 201 gtcggcgaactccttggacagcggcggctgcggcgtcaccttgaagctggggtcccttat 142

                                                                       
Query: 459 ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
           |||||||||||||||||||||| ||||||||||||||||||||||||| |  ||||| ||
Sbjct: 141 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtagggattgcgcagacg 82

                                                   
Query: 519 cagccgctgcttcaggtacgggtcgtcttcaagaacgtcc 558
           ||||| |||||||||||| || ||| ||||||||| ||||
Sbjct: 81  cagcccctgcttcaggtaaggatcgccttcaagaatgtcc 42



to top

>emb|X63756.1|SVPEPCAA S.vulgare PEPC gene
          Length = 7071

 Score =  319 bits (161), Expect = 6e-84
 Identities = 252/280 (90%), Gaps = 3/280 (1%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 6551 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 6492

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||||||||||| ||| ||||||||||  || |||||||||||    || |||| ||||||
Sbjct: 6491 cagccccggcg-gtactcgctcgccg--ttcagcttcaccagtccggcgggcttgttctc 6435

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||  ||
Sbjct: 6434 gtcggcgaactccttggacagcggcggctgcggcgtcaccttgaagctggggtcccttat 6375

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||| ||||||||||||||||||||||||| |  ||||| ||
Sbjct: 6374 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtagggattgcgcagacg 6315

                                                    
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtcc 558
            ||||| |||||||||||| || ||| ||||||||| ||||
Sbjct: 6314 cagcccctgcttcaggtaaggatcgccttcaagaatgtcc 6275



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 41/46 (89%)
 Strand = Plus / Minus

                                                          
Query: 609  cctgagctgctccccgaggggcttgagctcgtcggcgacaagcagc 654
            ||||||||||| ||| | ||||||||| || |||||||||||||||
Sbjct: 6112 cctgagctgcttcccaaagggcttgagttcctcggcgacaagcagc 6067



to top

>emb|AJ293346.1|SOF293346 Saccharum officinarum mRNA for putative C4 phosphoenolpyruvate
            carboxylase (PEPC gene)
          Length = 3067

 Score =  317 bits (160), Expect = 3e-83
 Identities = 322/376 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| ||
Sbjct: 2886 ctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtcttc 2827

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            |||||| |||| ||| |||||||||| ||| |||||||||||    || |||| ||||||
Sbjct: 2826 cagcccgggcgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgttctc 2767

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||||| |||||||| |||||  || ||||  ||
Sbjct: 2766 gtcggcgaactccttggacagcggcggctgcggcgtcaccttgaagcacggatcccttat 2707

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||  ||||||||||||||||||||||||| |  || |||||
Sbjct: 2706 ccgcttcagcgtgtaggcctgcaacacgttcagggtggtgatgtagggattgcgtagccg 2647

                                                                        
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctggac 578
            ||||| |||||||||||| || ||| |||||||||  ||| | || ||||| | ||| | 
Sbjct: 2646 cagcccctgcttcaggtaaggatcgccttcaagaatatccttgtgcccagcgatctgtag 2587

                                                                        
Query: 579  gagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagctc 638
            ||| |||||||  || ||| || | |||  ||||||||||| ||| | ||||||||| ||
Sbjct: 2586 gagaagcttctctgtctccacgtatttgtccctgagctgcttcccaaagggcttgagatc 2527

                            
Query: 639  gtcggcgacaagcagc 654
            ||||||||||||||||
Sbjct: 2526 gtcggcgacaagcagc 2511



to top

>emb|AJ318582.1|EAU318582 Eulalia aurea partial 3' end mRNA for putative phosphoenolpyruvate
           carboxylase, (pepc gene)
          Length = 506

 Score =  313 bits (158), Expect = 4e-82
 Identities = 233/258 (90%)
 Strand = Plus / Minus

                                                                       
Query: 279 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
           |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 321 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 262

                                                                       
Query: 339 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
           |||||| |||| ||| |||||||||| ||| |||||||||||    || |||| ||||||
Sbjct: 261 cagccctggcgggtactcgctcgccgggttcagcttcaccaggccggcgggcttgttctc 202

                                                                       
Query: 399 gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
           |||||||||||||||||||||||||||||||| |||||||| ||||||||||||||  ||
Sbjct: 201 gtcggcgaactccttggacagcggcggctgcggcgtcaccttgaagctggggtccctaat 142

                                                                       
Query: 459 ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
           || ||||||||||||||||||| ||||||||||||||||||||||||| |  ||||| ||
Sbjct: 141 cctcttcagcgtgtaggcctggaacacgttcagggtggtgatgtagggattgcgcaggcg 82

                             
Query: 519 cagccgctgcttcaggta 536
           ||||| ||||||||||||
Sbjct: 81  cagcccctgcttcaggta 64



to top

>emb|AJ318583.1|VZI318583 Vetiveria zizanioides partial 3' end mRNA for putative
           phosphoenolpyruvate carboxylase (pepc gene)
          Length = 515

 Score =  309 bits (156), Expect = 6e-81
 Identities = 249/280 (88%)
 Strand = Plus / Minus

                                                                       
Query: 279 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
           |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 321 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 262

                                                                       
Query: 339 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
           ||| || |||| ||| |||||||||| ||||||||| |||||    || ||||  |||||
Sbjct: 261 caggcctggcgggtactcgctcgccgggttgagctttaccagtccggcgggctctttctc 202

                                                                       
Query: 399 gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
           |||||||||||||||||||||||||||||| | |||||||| ||||||||||||||  ||
Sbjct: 201 gtcggcgaactccttggacagcggcggctgtggcgtcaccttgaagctggggtcccttat 142

                                                                       
Query: 459 ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
           |||||||||||||||||||||| ||||||||||||||||||||||||| |  ||||| ||
Sbjct: 141 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtagggattgcgcaggcg 82

                                                   
Query: 519 cagccgctgcttcaggtacgggtcgtcttcaagaacgtcc 558
           ||||| |||||||||||| || ||| ||||||||| ||||
Sbjct: 81  cagcccctgcttcaggtaaggatcgccttcaagaatgtcc 42



to top

>emb|AJ536629.1|ZMA536629 Zea mays mRNA for phosphoenolpyruvate carboxylase (ppc1 gene), clone
            pM500
          Length = 2913

 Score =  301 bits (152), Expect = 2e-78
 Identities = 320/376 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 2913 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 2854

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || |||| ||| |||||||||| ||| ||||| |||||    || |||| ||||||
Sbjct: 2853 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2794

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||| | |||||||| |||| |||||||||  ||
Sbjct: 2793 gtcggcgaactccttggacagcggcggctggggcgtcaccttgaagttggggtcccttat 2734

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||| |||||||||||||||||||||||||||  ||||||  
Sbjct: 2733 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtaggggttgcgcagcac 2674

                                                                        
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctggac 578
            ||||| |||||||||| | || ||| |||||||||  ||| | || ||||| | ||||| 
Sbjct: 2673 cagcccctgcttcaggaatggatcgccttcaagaatatccttgtgcccagcgatctggag 2614

                                                                        
Query: 579  gagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagctc 638
            ||| |||| ||  || ||| || | |||  ||||||||||| ||| | ||||||||| ||
Sbjct: 2613 gagaagctgctgtgtctccacgtatttgtccctgagctgcttcccaaagggcttgagttc 2554

                            
Query: 639  gtcggcgacaagcagc 654
             || || |||||||||
Sbjct: 2553 ttctgccacaagcagc 2538



to top

>emb|X15238.1|ZMPEPC1 Maize mRNA for phosphoenolpyruvate carboxylase (EC 4.1.1.31)
          Length = 3265

 Score =  301 bits (152), Expect = 2e-78
 Identities = 320/376 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 2993 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 2934

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || |||| ||| |||||||||| ||| ||||| |||||    || |||| ||||||
Sbjct: 2933 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2874

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||| | |||||||| |||| |||||||||  ||
Sbjct: 2873 gtcggcgaactccttggacagcggcggctggggcgtcaccttgaagttggggtcccttat 2814

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||| |||||||||||||||||||||||||||  ||||||  
Sbjct: 2813 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtaggggttgcgcagcac 2754

                                                                        
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctggac 578
            ||||| |||||||||| | || ||| |||||||||  ||| | || ||||| | ||||| 
Sbjct: 2753 cagcccctgcttcaggaatggatcgccttcaagaatatccttgtgcccagcgatctggag 2694

                                                                        
Query: 579  gagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagctc 638
            ||| |||| ||  || ||| || | |||  ||||||||||| ||| | ||||||||| ||
Sbjct: 2693 gagaagctgctgtgtctccacgtatttgtccctgagctgcttcccaaagggcttgagttc 2634

                            
Query: 639  gtcggcgacaagcagc 654
             || || |||||||||
Sbjct: 2633 ttccgccacaagcagc 2618



to top

>gb|AY103747.1| Zea mays PCO070206 mRNA sequence
          Length = 3289

 Score =  301 bits (152), Expect = 2e-78
 Identities = 320/376 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 2993 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 2934

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || |||| ||| |||||||||| ||| ||||| |||||    || |||| ||||||
Sbjct: 2933 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2874

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||| | |||||||| |||| |||||||||  ||
Sbjct: 2873 gtcggcgaactccttggacagcggcggctggggcgtcaccttgaagttggggtcccttat 2814

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||| |||||||||||||||||||||||||||  ||||||  
Sbjct: 2813 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtaggggttgcgcagcac 2754

                                                                        
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctggac 578
            ||||| |||||||||| | || ||| |||||||||  ||| | || ||||| | ||||| 
Sbjct: 2753 cagcccctgcttcaggaatggatcgccttcaagaatatccttgtgcccagcgatctggag 2694

                                                                        
Query: 579  gagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagctc 638
            ||| |||| ||  || ||| || | |||  ||||||||||| ||| | ||||||||| ||
Sbjct: 2693 gagaagctgctgtgtctccacgtatttgtccctgagctgcttcccaaagggcttgagttc 2634

                            
Query: 639  gtcggcgacaagcagc 654
             || || |||||||||
Sbjct: 2633 ttccgccacaagcagc 2618



to top

>emb|X15239.1|ZMPEPC1G Maize PEPC1 gene for phosphoenolpyruvate carboxylase (EC 4.1.1.31)
          Length = 6151

 Score =  299 bits (151), Expect = 6e-78
 Identities = 244/275 (88%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 5674 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 5615

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || |||| ||| |||||||||| ||| ||||| |||||    || |||| ||||||
Sbjct: 5614 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 5555

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||| | |||||||| |||| |||||||||  ||
Sbjct: 5554 gtcggcgaactccttggacagcggcggctggggcgtcaccttgaagttggggtcccttat 5495

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||| |||||||||||||||||||||||||||  ||||||  
Sbjct: 5494 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtaggggttgcgcagcac 5435

                                               
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaa 553
            ||||| |||||||||| | || ||| |||||||||
Sbjct: 5434 cagcccctgcttcaggaatggatcgccttcaagaa 5400



to top

>emb|X15642.1|ZMPEP Z.mays gene for phosphoenolpyruvate carboxylase (EC 4.1.1.31)
          Length = 6781

 Score =  291 bits (147), Expect = 1e-75
 Identities = 243/275 (88%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||
Sbjct: 6318 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 6259

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || |||| ||| |||||||||| ||| ||||| |||||    || |||| ||||||
Sbjct: 6258 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 6199

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||| | |||||||| |||| |||||||||  ||
Sbjct: 6198 gtcggcgaactccttggacagcggcggctggggcgtcaccttgaagttggggtcccttat 6139

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||| |||||||||||||||||||||||||||  ||||||  
Sbjct: 6138 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtaggggttgcgcagcac 6079

                                               
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaa 553
            ||| | |||||||||| | || ||| |||||||||
Sbjct: 6078 cagtccctgcttcaggaatggatcgccttcaagaa 6044



to top

>emb|X03613.1|ZMPEPCR Maize mRNA for phosphoenolpyruvate carboxylase (PEPCase EC 4.1.1.31)
          Length = 3028

 Score =  285 bits (144), Expect = 9e-74
 Identities = 318/376 (84%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||  |||||||||||||||||||||||||||||| ||
Sbjct: 2809 ctagccagtgttctgcatgccggcgcggatgcccttcatggtgaggatgagcgtgtcttc 2750

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || |||| ||| |||||||||| ||| ||||| |||||    || |||| ||||||
Sbjct: 2749 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2690

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||||||||||||||||||||||||||||| | |||||||| |||| |||||||||  ||
Sbjct: 2689 gtcggcgaactccttggacagcggcggctggggcgtcaccttgaagttggggtcccttat 2630

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            |||||||||||||||||||||| |||||||||||||||||||||||||||  ||||||  
Sbjct: 2629 ccgcttcagcgtgtaggcctggaacacgttcagggtggtgatgtaggggttgcgcagcac 2570

                                                                        
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctggac 578
            ||||| |||||||||| | || ||| |||||||||  ||| | || ||||| | ||||| 
Sbjct: 2569 cagcccctgcttcaggaatggatcgccttcaagaatatccttgtgcccagcgatctggag 2510

                                                                        
Query: 579  gagcagcttcttggtgtcctcgaagttgctcctgagctgctccccgaggggcttgagctc 638
            ||| |||| ||  || ||| || | |||  ||||||||||| ||| | ||||||||| ||
Sbjct: 2509 gagaagctgctgtgtctccacgtatttgtccctgagctgcttcccaaagggcttgagttc 2450

                            
Query: 639  gtcggcgacaagcagc 654
             || || |||||||||
Sbjct: 2449 ttccgccacaagcagc 2434



to top

>emb|X65137.1|SVPEPCGX S.vulgare pepC gene for PEP carboxylase
          Length = 7586

 Score =  280 bits (141), Expect = 6e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| || |||||||||||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 7249 ctagccggtattctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 7190

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || |||||||| ||||||  |  ||| |||| |||||||  | |||||||| ||||
Sbjct: 7189 caggcctggcgcgtactcgctctgctggttcagctgcaccagctccaccggctggctctc 7130

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            ||||| ||||||||||||||| ||||||||||   ||||||||||||| ||||| || ||
Sbjct: 7129 gtcggtgaactccttggacaggggcggctgcgggctcacctggaagctcgggtcacgtat 7070

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            ||||||||| ||||||||||||||||||||||| |||||||||||||  |||||||||||
Sbjct: 7069 ccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtaggactcacgcagccg 7010

                                                                     
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
            ||| |||||||||||||| || ||| ||||||| |||||| | || |||||||||||
Sbjct: 7009 cagacgctgcttcaggtaaggatcgccttcaaggacgtccttgtgaccagcaacctg 6953



to top

>emb|X55664.1|SVPEPCA Sorghum vulgare mRNA for phosphoenolpyruvate carboxylase (PEPC)
          Length = 3128

 Score =  280 bits (141), Expect = 6e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| || |||||||||||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 2883 ctagccggtattctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 2824

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || |||||||| ||||||  |  ||| |||| |||||||  | |||||||| ||||
Sbjct: 2823 caggcctggcgcgtactcgctctgctggttcagctgcaccagctccaccggctggctctc 2764

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            ||||| ||||||||||||||| ||||||||||   ||||||||||||| ||||| || ||
Sbjct: 2763 gtcggtgaactccttggacaggggcggctgcgggctcacctggaagctcgggtcacgtat 2704

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            ||||||||| ||||||||||||||||||||||| |||||||||||||  |||||||||||
Sbjct: 2703 ccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtaggactcacgcagccg 2644

                                                                     
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
            ||| |||||||||||||| || ||| ||||||| |||||| | || |||||||||||
Sbjct: 2643 cagacgctgcttcaggtaaggatcgccttcaaggacgtccttgtgaccagcaacctg 2587



to top

>emb|AJ318339.1|SSP318339 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase (PPCS-1-1)
          Length = 755

 Score =  280 bits (141), Expect = 6e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 279 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
           |||||| ||||||||||||||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 582 ctagccggtgttctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 523

                                                                       
Query: 339 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
           ||| || |||||||| ||||||  |  ||| |||| |||||||  ||| |||||  ||||
Sbjct: 522 caggcctggcgcgtactcgctctgctggttcagctgcaccagctccgctggctgactctc 463

                                                                       
Query: 399 gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
           ||||| ||||||||||||||| ||||||||||   ||||||||||||| ||||| || ||
Sbjct: 462 gtcggtgaactccttggacaggggcggctgcgggctcacctggaagctcgggtcacgtat 403

                                                                       
Query: 459 ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
           ||||||||| ||||||||||||||||||||||| |||||||||||||  |||||||||||
Sbjct: 402 ccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtaggactcacgcagccg 343

                                                                    
Query: 519 cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
           ||| |||||||||||||| || ||| ||||||| |||||| | || |||||||||||
Sbjct: 342 cagacgctgcttcaggtaaggatcgccttcaaggacgtccttgtgaccagcaacctg 286



to top

>gb|AY109352.1| Zea mays CL1793_1 mRNA sequence
          Length = 3349

 Score =  280 bits (141), Expect = 6e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 3080 ctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgtcctc 3021

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || || ||||| ||||||  |  ||| |||| |||||||  |||||||||  ||||
Sbjct: 3020 caggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgactctc 2961

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            ||||| ||||||||||||||| ||||||||||   ||||||||||||| ||||| || ||
Sbjct: 2960 gtcggtgaactccttggacaggggcggctgcgggctcacctggaagctcgggtcgcgtat 2901

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            ||||||||| ||||||||||||||||||||||| |||||||||||||  |||||||||||
Sbjct: 2900 ccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtaggactcacgcagccg 2841

                                                                     
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
            ||| ||||||||||| || || ||  ||||||| |||||| | || |||||||||||
Sbjct: 2840 cagacgctgcttcagataaggatcaccttcaaggacgtccttgtgaccagcaacctg 2784



to top

>dbj|AB012228.1| Zea mays mRNA for phosphoenolpyruvate carboxylase, complete cds
          Length = 3319

 Score =  280 bits (141), Expect = 6e-72
 Identities = 258/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 3080 ctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgtcctc 3021

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || || ||||| ||||||  |  ||| |||| |||||||  |||||||||  ||||
Sbjct: 3020 caggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgactctc 2961

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            ||||| ||||||||||||||| ||||||||||   ||||||||||||| ||||| || ||
Sbjct: 2960 gtcggtgaactccttggacaggggcggctgcgggctcacctggaagctcgggtcgcgtat 2901

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            ||||||||| ||||||||||||||||||||||| |||||||||||||  |||||||||||
Sbjct: 2900 ccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtaggactcacgcagccg 2841

                                                                     
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
            ||| ||||||||||| || || ||  ||||||| |||||| | || |||||||||||
Sbjct: 2840 cagacgctgcttcagataaggatcaccttcaaggacgtccttgtgaccagcaacctg 2784



to top

>emb|AJ293348.1|CLA293348 Coix lacryma-jobi partial mRNA for putative C4 phosphoenolpyruvate
           carboxylase (PEPC gene)
          Length = 506

 Score =  276 bits (139), Expect = 9e-71
 Identities = 241/275 (87%)
 Strand = Plus / Minus

                                                                       
Query: 279 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
           |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 321 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 262

                                                                       
Query: 339 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
           |||||| |||| ||| |||||||||| ||| || ||||||||    || |||| |||| |
Sbjct: 261 cagccctggcgggtagtcgctcgccgggttcagtttcaccagttcggcgggcttgttcgc 202

                                                                       
Query: 399 gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
           |||||||||||||||||||||||||||| ||| ||||  || |||| |||||||||  ||
Sbjct: 201 gtcggcgaactccttggacagcggcggcagcggcgtcgtcttgaagttggggtcccttat 142

                                                                       
Query: 459 ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
           ||||||||||||||||||||||  |||||||||||||||||||||||| |  ||||| ||
Sbjct: 141 ccgcttcagcgtgtaggcctggagcacgttcagggtggtgatgtagggattgcgcaggcg 82

                                              
Query: 519 cagccgctgcttcaggtacgggtcgtcttcaagaa 553
           ||||| |||||||||||| || ||| |||||||||
Sbjct: 81  cagcccctgcttcaggtaaggatcggcttcaagaa 47



to top

>emb|AJ318341.1|SSP318341 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-1-3)
          Length = 743

 Score =  272 bits (137), Expect = 1e-69
 Identities = 257/297 (86%)
 Strand = Plus / Minus

                                                                       
Query: 279 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
           |||||| ||||||||||||||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 573 ctagccggtgttctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 514

                                                                       
Query: 339 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
           ||| || ||||| || ||||||  |  ||| |||| |||||||  ||| |||||  ||||
Sbjct: 513 caggcctggcgcatactcgctctgctggttcagctgcaccagctccgctggctgactctc 454

                                                                       
Query: 399 gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
           ||||| ||||||||||||||| ||||||||||   ||||||||||||| ||||| || ||
Sbjct: 453 gtcggtgaactccttggacaggggcggctgcgggctcacctggaagctcgggtcacgtat 394

                                                                       
Query: 459 ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
           ||||||||| ||||||||||||||||||||||| |||||||||||||  |||||||||||
Sbjct: 393 ccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtaggactcacgcagccg 334

                                                                    
Query: 519 cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
           ||| |||||||||||||| || ||| ||||||| |||||| | || |||||||||||
Sbjct: 333 cagacgctgcttcaggtaaggatcgccttcaaggacgtccttgtgaccagcaacctg 277



to top

>gb|BT017928.1| Zea mays clone EL01N0519G10.c mRNA sequence
          Length = 1453

 Score =  264 bits (133), Expect = 3e-67
 Identities = 256/297 (86%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||||||||||||||||||||||||||| |||||||| ||||||||
Sbjct: 1178 ctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgtcctc 1119

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| || || ||||| ||||||  |  ||| |||| |||||||  |||||||||  ||||
Sbjct: 1118 caggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgactctc 1059

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            ||||| ||||||||||||||| ||||||||||   ||||||||||||| ||||| || ||
Sbjct: 1058 gtcggtgaactccttggacaggggcggctgcgggctcacctggaagctcgggtcgcgtat 999

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            ||||||||| ||||||||||||||||||||||| ||||| |||||||  |||||||||||
Sbjct: 998  ccgcttcagggtgtaggcctggcacacgttcagagtggtaatgtaggactcacgcagccg 939

                                                                     
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
            ||  ||||||||||| || || ||  ||||||| |||||| | || |||||||||||
Sbjct: 938  caaacgctgcttcagataaggatcaccttcaaggacgtccttgtgaccagcaacctg 882



to top

>gb|AY491400.1| Setaria italica C3 phosphoenolpyruvate carboxylase (ppc1) mRNA,
            complete cds
          Length = 2886

 Score =  258 bits (130), Expect = 2e-65
 Identities = 226/258 (87%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| ||||||||||| ||||||||||| ||||||||||| ||||| |||||||||||
Sbjct: 2886 ctagccggtgttctgcatcccggcggcgatacccttcatggtcaggatcagcgtgtcctc 2827

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| ||||||||||| |||||| | | ||| |||| |||||||  |||||||||| ||||
Sbjct: 2826 caggcccggcgcgtactcgctctcggggttcagctgcaccagctgcgccggctggctctc 2767

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            ||||| ||||||||||||||| | |||||| |   ||||||||||||  ||||| || ||
Sbjct: 2766 gtcggtgaactccttggacagagccggctgggggctcacctggaagccagggtcacgaat 2707

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            ||||||||| |||||||||||||| |||||||||||||||||||| |  |||||||||||
Sbjct: 2706 ccgcttcagggtgtaggcctggcagacgttcagggtggtgatgtacgactcacgcagccg 2647

                              
Query: 519  cagccgctgcttcaggta 536
            ||| ||||||||||||||
Sbjct: 2646 cagacgctgcttcaggta 2629



to top

>emb|AJ318340.1|SSP318340 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-1-2)
          Length = 714

 Score =  256 bits (129), Expect = 8e-65
 Identities = 255/297 (85%)
 Strand = Plus / Minus

                                                                       
Query: 279 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
           |||||| |||| |||||||||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 582 ctagccggtgtcctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 523

                                                                       
Query: 339 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
           ||| || ||||| || ||||||  |  ||| |||| |||||||   || |||||  ||||
Sbjct: 522 caggcctggcgcatactcgctctgctggttcagctgcaccagctctgctggctgactctc 463

                                                                       
Query: 399 gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
           ||||| ||||||||||||||| ||||||||||   ||||||||||||| ||||| || ||
Sbjct: 462 gtcggtgaactccttggacaggggcggctgcgggctcacctggaagctcgggtcacgtat 403

                                                                       
Query: 459 ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
           ||||||||| ||||||||||||||||||||||| |||||||||||||  |||||||||||
Sbjct: 402 ccgcttcagggtgtaggcctggcacacgttcagagtggtgatgtaggactcacgcagccg 343

                                                                    
Query: 519 cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
           ||| |||||||||||||| || ||| ||||||| |||||| | || |||||||||||
Sbjct: 342 cagacgctgcttcaggtaaggatcgccttcaaggacgtccttgtgaccagcaacctg 286



to top

>gb|AY251482.1| Echinochloa crus-galli phosphoenolpyruvate carboxylase (ppc) mRNA,
            complete cds
          Length = 2886

 Score =  256 bits (129), Expect = 8e-65
 Identities = 255/297 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||||||||||||| |||||||||||||| ||||| ||||||| |||
Sbjct: 2886 ctagccggtgttctgcatgccggcggcaatgcccttcatggtcaggatcagcgtgttctc 2827

                                                                        
Query: 339  cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 398
            ||| ||||||||||| |||||| | | ||| ||   |||||||  ||| |||||| ||||
Sbjct: 2826 caggcccggcgcgtactcgctctcagggttcagtcgcaccagctccgcaggctggctctc 2767

                                                                        
Query: 399  gtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccggat 458
            |||  |||||||||||||||| | ||||||||   ||||||||||||||||||| || ||
Sbjct: 2766 gtcaacgaactccttggacagggccggctgcgggctcacctggaagctggggtcgcgaat 2707

                                                                        
Query: 459  ccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccg 518
            ||||||||| ||||| |||||||| |||||||||||||||||||| |  |||||||| ||
Sbjct: 2706 ccgcttcagggtgtacgcctggcatacgttcagggtggtgatgtacgactcacgcaggcg 2647

                                                                     
Query: 519  cagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
            ||| |||||||||||||| || ||| ||||||| |||||| | || |||||||||||
Sbjct: 2646 cagacgctgcttcaggtaaggatcgccttcaaggacgtccttgtgaccagcaacctg 2590



to top

>gb|AY995212.1| Echinochloa crus-galli C4 phosphoenolpyruvate carboxylase mRNA,
           partial cds
          Length = 391

 Score =  190 bits (96), Expect = 4e-45
 Identities = 246/296 (83%)
 Strand = Plus / Minus

                                                                       
Query: 358 ctcgccgcgttgagcttcaccagcgacgccggctggttctcgtcggcgaactccttggac 417
           ||||||| ||| ||||||||||||   || |||| |||| |||||  |||||||||||||
Sbjct: 386 ctcgccgggttcagcttcaccagcccggcgggcttgttcacgtcgttgaactccttggac 327

                                                                       
Query: 418 agcggcggctgcgccgtcacctggaagctggggtcccggatccgcttcagcgtgtaggcc 477
           |||||||| | |  |||||||| |||| |||||||||  || | ||||||||||||||||
Sbjct: 326 agcggcgggttcagcgtcaccttgaagttggggtccctaattctcttcagcgtgtaggcc 267

                                                                       
Query: 478 tggcacacgttcagggtggtgatgtaggggtcacgcagccgcagccgctgcttcaggtac 537
           ||| |||||||||| ||||||||||||||||| | ||| ||||| |||||||||||||| 
Sbjct: 266 tggaacacgttcagcgtggtgatgtaggggtccctcaggcgcaggcgctgcttcaggtag 207

                                                                       
Query: 538 gggtcgtcttcaagaacgtccctatggccagcaacctggacgagcagcttcttggtgtcc 597
           || ||| ||||||| |  ||| | || ||||||||||| | ||| |||| |   ||||| 
Sbjct: 206 ggatcgccttcaaggatttccttgtgcccagcaacctgcaggagaagctgcactgtgtcg 147

                                                                   
Query: 598 tcgaagttgctcctgagctgctccccgaggggcttgagctcgtcggcgacaagcag 653
             | ||||  |||||||||||||||||| ||||||||| |||||||||||||||||
Sbjct: 146 atgtagttcttcctgagctgctccccgaagggcttgagttcgtcggcgacaagcag 91



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score =  184 bits (93), Expect = 2e-43
 Identities = 219/261 (83%)
 Strand = Plus / Plus

                                                                           
Query: 276     aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
               ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 8177149 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 8177208

                                                                           
Query: 336     ctccagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggtt 395
               |||||| || || ||||| |||||||| ||||| || |  ||||||   || ||||||||
Sbjct: 8177209 ctccaggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggtt 8177268

                                                                           
Query: 396     ctcgtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccg 455
                  |||| |||||||||| ||||  | |||||||| | |||||| |||||| ||||||| 
Sbjct: 8177269 gctgtcgacgaactccttcgacaaggccggctgcgacatcacctcgaagctagggtccct 8177328

                                                                           
Query: 456     gatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcag 515
                ||||||||||| |||||||| ||||| ||||||| ||| |||||||| |  ||||||||
Sbjct: 8177329 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgtacgactcacgcag 8177388

                                    
Query: 516     ccgcagccgctgcttcaggta 536
               |||||| ||||||||||||||
Sbjct: 8177389 ccgcagacgctgcttcaggta 8177409



to top

>gb|AF271995.1|AF271995 Oryza sativa phosphoenolpyruvate carboxylase mRNA, complete cds
          Length = 3307

 Score =  184 bits (93), Expect = 2e-43
 Identities = 219/261 (83%)
 Strand = Plus / Minus

                                                                        
Query: 276  aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 3070 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 3011

                                                                        
Query: 336  ctccagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggtt 395
            |||||| || || ||||| |||||||| ||||| || |  ||||||   || ||||||||
Sbjct: 3010 ctccaggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggtt 2951

                                                                        
Query: 396  ctcgtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccg 455
               |||| |||||||||| ||||  | |||||||| | |||||| |||||| ||||||| 
Sbjct: 2950 gctgtcgacgaactccttcgacaaggccggctgcgacatcacctcgaagctagggtccct 2891

                                                                        
Query: 456  gatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcag 515
             ||||||||||| |||||||| ||||| ||||||| ||| |||||||| |  ||||||||
Sbjct: 2890 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgtacgactcacgcag 2831

                                 
Query: 516  ccgcagccgctgcttcaggta 536
            |||||| ||||||||||||||
Sbjct: 2830 ccgcagacgctgcttcaggta 2810



to top

>dbj|AP004117.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1134_F06
          Length = 130968

 Score =  184 bits (93), Expect = 2e-43
 Identities = 219/261 (83%)
 Strand = Plus / Plus

                                                                        
Query: 276  aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 9295 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 9354

                                                                        
Query: 336  ctccagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggtt 395
            |||||| || || ||||| |||||||| ||||| || |  ||||||   || ||||||||
Sbjct: 9355 ctccaggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggtt 9414

                                                                        
Query: 396  ctcgtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccg 455
               |||| |||||||||| ||||  | |||||||| | |||||| |||||| ||||||| 
Sbjct: 9415 gctgtcgacgaactccttcgacaaggccggctgcgacatcacctcgaagctagggtccct 9474

                                                                        
Query: 456  gatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcag 515
             ||||||||||| |||||||| ||||| ||||||| ||| |||||||| |  ||||||||
Sbjct: 9475 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgtacgactcacgcag 9534

                                 
Query: 516  ccgcagccgctgcttcaggta 536
            |||||| ||||||||||||||
Sbjct: 9535 ccgcagacgctgcttcaggta 9555



to top

>dbj|AK065425.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013011N21, full
            insert sequence
          Length = 3809

 Score =  184 bits (93), Expect = 2e-43
 Identities = 219/261 (83%)
 Strand = Plus / Minus

                                                                        
Query: 276  aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 3080 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 3021

                                                                        
Query: 336  ctccagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggtt 395
            |||||| || || ||||| |||||||| ||||| || |  ||||||   || ||||||||
Sbjct: 3020 ctccaggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggtt 2961

                                                                        
Query: 396  ctcgtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccg 455
               |||| |||||||||| ||||  | |||||||| | |||||| |||||| ||||||| 
Sbjct: 2960 gctgtcgacgaactccttcgacaaggccggctgcgacatcacctcgaagctagggtccct 2901

                                                                        
Query: 456  gatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcag 515
             ||||||||||| |||||||| ||||| ||||||| ||| |||||||| |  ||||||||
Sbjct: 2900 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgtacgactcacgcag 2841

                                 
Query: 516  ccgcagccgctgcttcaggta 536
            |||||| ||||||||||||||
Sbjct: 2840 ccgcagacgctgcttcaggta 2820



to top

>dbj|AK065029.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001G17, full
            insert sequence
          Length = 3310

 Score =  184 bits (93), Expect = 2e-43
 Identities = 219/261 (83%)
 Strand = Plus / Minus

                                                                        
Query: 276  aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 3080 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 3021

                                                                        
Query: 336  ctccagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggtt 395
            |||||| || || ||||| |||||||| ||||| || |  ||||||   || ||||||||
Sbjct: 3020 ctccaggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggtt 2961

                                                                        
Query: 396  ctcgtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccg 455
               |||| |||||||||| ||||  | |||||||| | |||||| |||||| ||||||| 
Sbjct: 2960 gctgtcgacgaactccttcgacaaggccggctgcgacatcacctcgaagctagggtccct 2901

                                                                        
Query: 456  gatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcag 515
             ||||||||||| |||||||| ||||| ||||||| ||| |||||||| |  ||||||||
Sbjct: 2900 tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgtacgactcacgcag 2841

                                 
Query: 516  ccgcagccgctgcttcaggta 536
            |||||| ||||||||||||||
Sbjct: 2840 ccgcagacgctgcttcaggta 2820



to top

>dbj|AK062201.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G07, full
            insert sequence
          Length = 1389

 Score =  184 bits (93), Expect = 2e-43
 Identities = 219/261 (83%)
 Strand = Plus / Minus

                                                                        
Query: 276  aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| |||||
Sbjct: 1159 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 1100

                                                                        
Query: 336  ctccagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggtt 395
            |||||| || || ||||| |||||||| ||||| || |  ||||||   || ||||||||
Sbjct: 1099 ctccaggccaggtgcgtactcgctcgcagcgttcagttggaccagctcggcaggctggtt 1040

                                                                        
Query: 396  ctcgtcggcgaactccttggacagcggcggctgcgccgtcacctggaagctggggtcccg 455
               |||| |||||||||| ||||  | |||||||| | |||||| |||||| ||||||| 
Sbjct: 1039 gctgtcgacgaactccttcgacaaggccggctgcgacatcacctcgaagctagggtccct 980

                                                                        
Query: 456  gatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcag 515
             ||||||||||| |||||||| ||||| ||||||| ||| |||||||| |  ||||||||
Sbjct: 979  tatccgcttcagggtgtaggcttggcaaacgttcaaggtagtgatgtacgactcacgcag 920

                                 
Query: 516  ccgcagccgctgcttcaggta 536
            |||||| ||||||||||||||
Sbjct: 919  ccgcagacgctgcttcaggta 899



to top

>gb|AF268091.1|AF268091 Chloris gayana phosphoenolpyruvate carboxylase (ppc) mRNA, complete
            cds
          Length = 3137

 Score =  135 bits (68), Expect = 2e-28
 Identities = 119/136 (87%)
 Strand = Plus / Minus

                                                                        
Query: 418  agcggcggctgcgccgtcacctggaagctggggtcccggatccgcttcagcgtgtaggcc 477
            ||||||||||||| | |||||| |||| ||||||||| |||| |||| || |||||||||
Sbjct: 2769 agcggcggctgcgtcttcaccttgaagttggggtccctgatctgcttgagggtgtaggcc 2710

                                                                        
Query: 478  tggcacacgttcagggtggtgatgtaggggtcacgcagccgcagccgctgcttcaggtac 537
            ||| | ||||| |||||||||||||||||||||||||| ||||| |||||||||||||| 
Sbjct: 2709 tggaagacgttgagggtggtgatgtaggggtcacgcaggcgcaggcgctgcttcaggtaa 2650

                            
Query: 538  gggtcgtcttcaagaa 553
            || ||| | |||||||
Sbjct: 2649 ggatcggcctcaagaa 2634



 Score =  125 bits (63), Expect = 2e-25
 Identities = 93/103 (90%)
 Strand = Plus / Minus

                                                                        
Query: 278  tctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcct 337
            ||||||| ||||||||||| ||||||||||| ||||||||||||| |||||| |||||||
Sbjct: 2888 tctagccggtgttctgcataccggcggcgatacccttcatggtgatgatgagggtgtcct 2829

                                                       
Query: 338  ccagccccggcgcgtattcgctcgccgcgttgagcttcaccag 380
            |||| ||||||||||| ||||| |||| ||||||||| |||||
Sbjct: 2828 ccagtcccggcgcgtactcgctggccgggttgagcttgaccag 2786



to top

>ref|NM_188369.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2331

 Score =  129 bits (65), Expect = 1e-26
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                        
Query: 281  agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 2329 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 2270

                                                     
Query: 341  gccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            |||| ||  |||| |||||    | ||||||||||||||||
Sbjct: 2269 gcccggggtcgtactcgctgtttgggttgagcttcaccagc 2229



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 80/90 (88%)
 Strand = Plus / Minus

                                                                        
Query: 450  gtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtc 509
            |||||||||||||||||||||||| ||||||||||||||||| |  |||||||| | |||
Sbjct: 2157 gtcccggatccgcttcagcgtgtacgcctggcacacgttcagcgccgtgatgtacgagtc 2098

                                          
Query: 510  acgcagccgcagccgctgcttcaggtacgg 539
             ||||||  |||||||||| ||||||||||
Sbjct: 2097 ccgcagcatcagccgctgcctcaggtacgg 2068



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
               sequence
          Length = 43261740

 Score =  129 bits (65), Expect = 1e-26
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                           
Query: 281     agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
               ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5908267 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 5908208

                                                        
Query: 341     gccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
               |||| ||  |||| |||||    | ||||||||||||||||
Sbjct: 5908207 gcccggggtcgtactcgctgtttgggttgagcttcaccagc 5908167



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 80/90 (88%)
 Strand = Plus / Minus

                                                                           
Query: 450     gtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtc 509
               |||||||||||||||||||||||| ||||||||||||||||| |  |||||||| | |||
Sbjct: 5908095 gtcccggatccgcttcagcgtgtacgcctggcacacgttcagcgccgtgatgtacgagtc 5908036

                                             
Query: 510     acgcagccgcagccgctgcttcaggtacgg 539
                ||||||  |||||||||| ||||||||||
Sbjct: 5908035 ccgcagcatcagccgctgcctcaggtacgg 5908006



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                     
Query: 286      gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
                ||||||||||| || || ||||||||||||||||| |||||||| ||||||||
Sbjct: 31852803 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 31852855



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                            
Query: 295      atgccggcggcgatgcccttcatggtga 322
                ||||||||||||||||| || |||||||
Sbjct: 31192163 atgccggcggcgatgccgttgatggtga 31192136



to top

>dbj|AP003052.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:OSJNBa0016I09
          Length = 148517

 Score =  129 bits (65), Expect = 1e-26
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                          
Query: 281    agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
              ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 112008 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 111949

                                                       
Query: 341    gccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
              |||| ||  |||| |||||    | ||||||||||||||||
Sbjct: 111948 gcccggggtcgtactcgctgtttgggttgagcttcaccagc 111908



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 80/90 (88%)
 Strand = Plus / Minus

                                                                          
Query: 450    gtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtc 509
              |||||||||||||||||||||||| ||||||||||||||||| |  |||||||| | |||
Sbjct: 111836 gtcccggatccgcttcagcgtgtacgcctggcacacgttcagcgccgtgatgtacgagtc 111777

                                            
Query: 510    acgcagccgcagccgctgcttcaggtacgg 539
               ||||||  |||||||||| ||||||||||
Sbjct: 111776 ccgcagcatcagccgctgcctcaggtacgg 111747



to top

>dbj|AK066635.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071A07, full
            insert sequence
          Length = 3495

 Score =  129 bits (65), Expect = 1e-26
 Identities = 92/101 (91%)
 Strand = Plus / Minus

                                                                        
Query: 281  agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 3202 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 3143

                                                     
Query: 341  gccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            |||| ||  |||| |||||    | ||||||||||||||||
Sbjct: 3142 gcccggggtcgtactcgctgtttgggttgagcttcaccagc 3102



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 80/90 (88%)
 Strand = Plus / Minus

                                                                        
Query: 450  gtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtc 509
            |||||||||||||||||||||||| ||||||||||||||||| |  |||||||| | |||
Sbjct: 3030 gtcccggatccgcttcagcgtgtacgcctggcacacgttcagcgccgtgatgtacgagtc 2971

                                          
Query: 510  acgcagccgcagccgctgcttcaggtacgg 539
             ||||||  |||||||||| ||||||||||
Sbjct: 2970 ccgcagcatcagccgctgcctcaggtacgg 2941



to top

>emb|AJ318342.1|SSP318342 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-2-1)
          Length = 573

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| | |
Sbjct: 318 gggtcacggatccgcttcagggtgtaggcctggcacacgttcagggtggtgatgtatgcg 259

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || ||||||||||||||||| |||||  |||| || |  ||||| || |||
Sbjct: 258 tcacggaggcggagccgctgcttcaggtaggggtcaccttccaggagatccctgtgccca 199

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 198 gcaacctg 191



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcg 357
           ||||| || |||||||||||||| |||||||| ||||| ||||||||||| |||||||||
Sbjct: 471 ccggctgctatgcccttcatggtcaggatgagggtgtcttccagccccggtgcgtattcg 412

                                   
Query: 358 ctcgccgcgttgagcttcaccagc 381
           ||  | | ||| ||||||||||||
Sbjct: 411 ctgccagggttcagcttcaccagc 388



to top

>emb|AJ318343.1|SSP318343 Saccharum hybrid cultivar R570 partial pepc gene for putative
           phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-2-2)
          Length = 537

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| | |
Sbjct: 325 gggtcacggatccgcttcagggtgtaggcctggcacacgttcagggtggtgatgtatgcg 266

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || ||||||||||||||||| |||||  |||| || |  ||||| || |||
Sbjct: 265 tcacggaggcggagccgctgcttcaggtaggggtcaccttccaggagatccctgtgccca 206

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 205 gcaacctg 198



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 73/84 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 ccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcg 357
           ||||| || |||||||||||||| |||||||| ||||| ||||||||||| |||||||||
Sbjct: 478 ccggctgctatgcccttcatggtcaggatgagggtgtcttccagccccggtgcgtattcg 419

                                   
Query: 358 ctcgccgcgttgagcttcaccagc 381
           ||  | | ||| ||||||||||||
Sbjct: 418 ctgccagggttcagcttcaccagc 395



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
               sequence
          Length = 22696651

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                           
Query: 448     gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
               ||||| |||||||| |||||||||||||| ||||| || ||||||||||| ||||||| |
Sbjct: 8638470 gggtcgcggatccgtttcagcgtgtaggcttggcagacattcagggtggttatgtaggcg 8638529

                                                                           
Query: 508     tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
               || || || || ||||||||||||||||| |||||  |||||||||  ||||||||||||
Sbjct: 8638530 tcgcggagtcggagccgctgcttcaggtaggggtcaccttcaagaagatccctatggcca 8638589

                       
Query: 568     gcaacctg 575
               ||||||||
Sbjct: 8638590 gcaacctg 8638597



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                           
Query: 286     gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
               ||||||||||  || || || |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 8638305 gtgttctgcaaccctgcagcaatgcccttcatggtcaggatgagggtgtcctccagccct 8638364

                                               
Query: 346     ggcgcgtattcgctcgccgcgttgagcttcac 377
               |||||||| |||||  ||| ||| ||||||||
Sbjct: 8638365 ggcgcgtactcgctacccgggttcagcttcac 8638396



to top

>dbj|AP005802.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OSJNBa0057D11
          Length = 190790

 Score =  127 bits (64), Expect = 5e-26
 Identities = 112/128 (87%)
 Strand = Plus / Plus

                                                                         
Query: 448   gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
             ||||| |||||||| |||||||||||||| ||||| || ||||||||||| ||||||| |
Sbjct: 68266 gggtcgcggatccgtttcagcgtgtaggcttggcagacattcagggtggttatgtaggcg 68325

                                                                         
Query: 508   tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
             || || || || ||||||||||||||||| |||||  |||||||||  ||||||||||||
Sbjct: 68326 tcgcggagtcggagccgctgcttcaggtaggggtcaccttcaagaagatccctatggcca 68385

                     
Query: 568   gcaacctg 575
             ||||||||
Sbjct: 68386 gcaacctg 68393



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Plus

                                                                         
Query: 286   gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
             ||||||||||  || || || |||||||||||||| |||||||| |||||||||||||| 
Sbjct: 68101 gtgttctgcaaccctgcagcaatgcccttcatggtcaggatgagggtgtcctccagccct 68160

                                             
Query: 346   ggcgcgtattcgctcgccgcgttgagcttcac 377
             |||||||| |||||  ||| ||| ||||||||
Sbjct: 68161 ggcgcgtactcgctacccgggttcagcttcac 68192



to top

>emb|X61489.1|ZMPHOPCAR Zea mays pep gene for (C3 type) phosphoenolpyruvate carboxylase
          Length = 3213

 Score =  119 bits (60), Expect = 1e-23
 Identities = 111/128 (86%)
 Strand = Plus / Minus

                                                                        
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
            ||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| |  
Sbjct: 2832 gggtcacggatccgcttcagggtgtaggcctggcagacgttcagggtggtgatgtacgca 2773

                                                                        
Query: 508  tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
            |||||||| || |||||||||||||||||  ||||  |||| ||||  ||||| || |||
Sbjct: 2772 tcacgcaggcggagccgctgcttcaggtagaggtcaccttccagaagatccctgtgccca 2713

                    
Query: 568  gcaacctg 575
            ||||||||
Sbjct: 2712 gcaacctg 2705



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            |||||||| | |||||| || |||||||||||||| |||||||| |||||||||||||||
Sbjct: 2997 gtgttctggaggccggctgctatgcccttcatggtcaggatgagggtgtcctccagcccc 2938

                          
Query: 346  ggcgcgtattcgct 359
            || |||||||||||
Sbjct: 2937 ggtgcgtattcgct 2924



to top

>emb|X59925.1|SVPEPCG S.vulgare PEPC gene for phosphoenolpyruvate carboxylase
          Length = 6018

 Score =  117 bits (59), Expect = 5e-23
 Identities = 86/95 (90%)
 Strand = Plus / Minus

                                                                        
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
            ||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| | |
Sbjct: 5526 gggtcacggatccgcttcagggtgtaggcctggcagacgttcagggtggtgatgtacgcg 5467

                                               
Query: 508  tcacgcagccgcagccgctgcttcaggtacgggtc 542
            ||||| || || ||||||||||||||||| |||||
Sbjct: 5466 tcacggaggcggagccgctgcttcaggtaagggtc 5432



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 71/84 (84%)
 Strand = Plus / Minus

                                                                        
Query: 298  ccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcg 357
            ||||| || |||||||||||||| || ||||| ||||||||||||||||| || || |||
Sbjct: 5679 ccggctgctatgcccttcatggtcagaatgagggtgtcctccagccccggtgcatactcg 5620

                                    
Query: 358  ctcgccgcgttgagcttcaccagc 381
            ||  | | ||| ||||||||||||
Sbjct: 5619 ctgccagggttcagcttcaccagc 5596



to top

>gb|AY111910.1| Zea mays CL16446_1 mRNA sequence
          Length = 607

 Score =  109 bits (55), Expect = 1e-20
 Identities = 73/79 (92%)
 Strand = Plus / Plus

                                                                       
Query: 281 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
           |||||||||||||||| ||||| ||||||||||||||||| |||||||| ||||||||||
Sbjct: 141 agcccgtgttctgcatcccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 200

                              
Query: 341 gccccggcgcgtattcgct 359
           ||||||| ||||| |||||
Sbjct: 201 gccccggggcgtactcgct 219



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Plus

                                                                       
Query: 434 tcacctggaagctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcaggg 493
           ||||||||||||  ||||||| ||| ||||||||||||||||||||||| |||||||| |
Sbjct: 297 tcacctggaagccagggtccctgatgcgcttcagcgtgtaggcctggcaaacgttcagcg 356

                                                             
Query: 494 tggtgatgtaggggtcacgcagccgcagccgctgcttcaggtacgggtcg 543
             ||| |||| | |||||| |  ||||||| |||||||||||||||||||
Sbjct: 357 ccgtggtgtacgagtcacggatgcgcagcctctgcttcaggtacgggtcg 406



to top

>gb|M86661.1|SCFSCPEPCD Saccharum hybrid cultivar H32-8560 phosphoenolpyruvate carboxylase
            (SCPEPCD1) gene, complete cds
          Length = 8638

 Score =  105 bits (53), Expect = 2e-19
 Identities = 86/97 (88%)
 Strand = Plus / Minus

                                                                        
Query: 281  agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||| ||||||||||| ||||| ||||||||||||||||| |||||||| ||||||||||
Sbjct: 8111 agccggtgttctgcattccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 8052

                                                 
Query: 341  gccccggcgcgtattcgctcgccgcgttgagcttcac 377
            | ||||| ||||| |||||||  | ||||||||||||
Sbjct: 8051 gtcccggggcgtactcgctcgtggtgttgagcttcac 8015



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 119/142 (83%)
 Strand = Plus / Minus

                                                                        
Query: 434  tcacctggaagctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcaggg 493
            ||||||||||||  ||||||| ||| ||||||||| |||| || ||||||||||||||||
Sbjct: 7955 tcacctggaagccagggtccctgatgcgcttcagcatgtaagcttggcacacgttcaggg 7896

                                                                        
Query: 494  tggtgatgtaggggtcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaa 553
              |||||||||| |||||| |  ||||||| |||||||||||| |||||| | || ||||
Sbjct: 7895 cagtgatgtaggagtcacggatgcgcagcctctgcttcaggtaagggtcgccctccagaa 7836

                                  
Query: 554  cgtccctatggccagcaacctg 575
             |||  | || |||||||||||
Sbjct: 7835 ggtctttgtgcccagcaacctg 7814



to top

>gb|AY107882.1| Zea mays PCO089178 mRNA sequence
          Length = 1373

 Score =  101 bits (51), Expect = 3e-18
 Identities = 72/79 (91%)
 Strand = Plus / Minus

                                                                        
Query: 281  agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||| ||||||||||| ||||| ||||||||||||||||| |||||||| ||||||||||
Sbjct: 1242 agccggtgttctgcatcccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 1183

                               
Query: 341  gccccggcgcgtattcgct 359
            ||||||| ||||| |||||
Sbjct: 1182 gccccggggcgtactcgct 1164



 Score = 99.6 bits (50), Expect = 1e-17
 Identities = 95/110 (86%)
 Strand = Plus / Minus

                                                                        
Query: 434  tcacctggaagctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcaggg 493
            ||||||||||||  ||||||| ||| ||||||||||||||||||||||| |||||||| |
Sbjct: 1086 tcacctggaagccagggtccctgatgcgcttcagcgtgtaggcctggcaaacgttcagcg 1027

                                                              
Query: 494  tggtgatgtaggggtcacgcagccgcagccgctgcttcaggtacgggtcg 543
              ||| |||| | |||||| |  ||||||| |||||||||||||||||||
Sbjct: 1026 ccgtggtgtacgagtcacggatgcgcagcctctgcttcaggtacgggtcg 977



to top

>emb|AJ312652.1|KPI312652 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform G
          Length = 1119

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           |||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||||
Sbjct: 946 agctcgggtctcggatccgcttgagcgtgtaggcctggcacacgttcagagtcgtgatgt 887

                                                    
Query: 503 aggggtcacgcagccgcagccgctgcttcaggtacgggtcg 543
           ||| ||| || || || ||||| ||||| ||||| ||||||
Sbjct: 886 aggagtcccggagacggagccgttgcttgaggtaagggtcg 846



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                        
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgcc 363
            |||||||| |||||||| || ||||||||||||||||| ||||| ||||| |||||||  
Sbjct: 1115 gcgatgcctttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctcgtg 1056

                              
Query: 364  gcgttgagcttcaccagc 381
            | ||||||||||||||||
Sbjct: 1055 gtgttgagcttcaccagc 1038



to top

>emb|AJ312651.1|KPI312651 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform F
          Length = 1119

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                        
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctc 360
            |||||||||||||||||||| || ||||||||||||||||| ||||| ||||| ||||||
Sbjct: 1118 gcggcgatgcccttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctc 1059

                                 
Query: 361  gccgcgttgagcttcaccagc 381
            |  | ||||||||||||||||
Sbjct: 1058 gtggtgttgagcttcaccagc 1038



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           |||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||||
Sbjct: 946 agctcgggtctcggatccgcttgagcgtgtaggcctggcacacgttcagagtcgtgatgt 887

                                                    
Query: 503 aggggtcacgcagccgcagccgctgcttcaggtacgggtcg 543
           ||| ||| || || || ||||| ||||| ||||| ||||||
Sbjct: 886 aggagtcccggagacggagccgttgcttgaggtaagggtcg 846



to top

>emb|AJ312650.1|KPI312650 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform E
          Length = 1119

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           |||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||||
Sbjct: 946 agctcgggtctcggatccgcttgagcgtgtaggcctggcacacgttcagagtcgtgatgt 887

                                                    
Query: 503 aggggtcacgcagccgcagccgctgcttcaggtacgggtcg 543
           ||| ||| || || || ||||| ||||| ||||| ||||||
Sbjct: 886 aggagtcccggagacggagccgttgcttgaggtaagggtcg 846



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 61/69 (88%)
 Strand = Plus / Minus

                                                                        
Query: 313  ttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgccgcgttgagc 372
            |||||||| || ||||||||||||||||| ||||| ||||| |||||||  | |||||||
Sbjct: 1106 ttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctcgtggtgttgagc 1047

                     
Query: 373  ttcaccagc 381
            |||||||||
Sbjct: 1046 ttcaccagc 1038



to top

>emb|AJ344058.1|KPI344058 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
           (ppc gene), isogene 7
          Length = 1119

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           |||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||||
Sbjct: 946 agctcgggtctcggatccgcttgagcgtgtaggcctggcacacgttcagagtcgtgatgt 887

                                                    
Query: 503 aggggtcacgcagccgcagccgctgcttcaggtacgggtcg 543
           ||| ||| || || || ||||| ||||| ||||| ||||||
Sbjct: 886 aggagtcccggagacggagccgttgcttgaggtaagggtcg 846



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 69/78 (88%)
 Strand = Plus / Minus

                                                                        
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgcc 363
            |||||||| |||||||| || ||||||||||||||||| ||||| ||||| |||||||  
Sbjct: 1115 gcgatgcctttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctcgtg 1056

                              
Query: 364  gcgttgagcttcaccagc 381
            | ||||||||||||||||
Sbjct: 1055 gtgttgagcttcaccagc 1038



to top

>emb|AJ344057.1|KPI344057 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (ppc gene), isogene 6
          Length = 1119

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 73/81 (90%)
 Strand = Plus / Minus

                                                                        
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctc 360
            |||||||||||||||||||| || ||||||||||||||||| ||||| ||||| ||||||
Sbjct: 1118 gcggcgatgcccttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctc 1059

                                 
Query: 361  gccgcgttgagcttcaccagc 381
            |  | ||||||||||||||||
Sbjct: 1058 gtggtgttgagcttcaccagc 1038



 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           |||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||||
Sbjct: 946 agctcgggtctcggatccgcttgagcgtgtaggcctggcacacgttcagagtcgtgatgt 887

                                                    
Query: 503 aggggtcacgcagccgcagccgctgcttcaggtacgggtcg 543
           ||| ||| || || || ||||| ||||| ||||| ||||||
Sbjct: 886 aggagtcccggagacggagccgttgcttgaggtaagggtcg 846



to top

>emb|AJ344056.1|KPI344056 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
           (ppc gene), isogene 5
          Length = 1119

 Score = 97.6 bits (49), Expect = 4e-17
 Identities = 88/101 (87%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           |||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||||
Sbjct: 946 agctcgggtctcggatccgcttgagcgtgtaggcctggcacacgttcagagtcgtgatgt 887

                                                    
Query: 503 aggggtcacgcagccgcagccgctgcttcaggtacgggtcg 543
           ||| ||| || || || ||||| ||||| ||||| ||||||
Sbjct: 886 aggagtcccggagacggagccgttgcttgaggtaagggtcg 846



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 61/69 (88%)
 Strand = Plus / Minus

                                                                        
Query: 313  ttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgccgcgttgagc 372
            |||||||| || ||||||||||||||||| ||||| ||||| |||||||  | |||||||
Sbjct: 1106 ttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctcgtggtgttgagc 1047

                     
Query: 373  ttcaccagc 381
            |||||||||
Sbjct: 1046 ttcaccagc 1038



to top

>emb|AJ007705.1|TAE7705 Triticum aestivum PEPC gene
          Length = 5845

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 107/128 (83%)
 Strand = Plus / Minus

                                                                        
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
            ||||| ||||||| |||||  ||||| |||||||| ||||||| |||||||||||| | |
Sbjct: 5387 gggtcacggatcctcttcaatgtgtatgcctggcagacgttcatggtggtgatgtacgcg 5328

                                                                        
Query: 508  tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
            ||||| || || ||||||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 5327 tcacggaggcggagccgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 5268

                    
Query: 568  gcaacctg 575
            ||||||||
Sbjct: 5267 gcaacctg 5260



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 69/80 (86%)
 Strand = Plus / Minus

                                                                        
Query: 298  ccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcg 357
            ||||| || |||||||||||||| | |||||| || |||||||||||||||||||| || 
Sbjct: 5540 ccggcagcaatgcccttcatggtcaagatgagggtatcctccagccccggcgcgtactca 5481

                                
Query: 358  ctcgccgcgttgagcttcac 377
            ||||||| ||| ||| ||||
Sbjct: 5480 ctcgccgggttcagcgtcac 5461



to top

>ref|NM_188892.2| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 3158

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 280  tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
            ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 2949 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2890

                                                      
Query: 340  agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 2889 agccccggcgcatactcactggtcgggttcagcttcaccagc 2848



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
            ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 2778 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 2721



to top

>ref|XM_507204.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1484_G09.129-1
            mRNA
          Length = 3539

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 280  tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
            ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 3214 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 3155

                                                      
Query: 340  agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 3154 agccccggcgcatactcactggtcgggttcagcttcaccagc 3113



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
            ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 3043 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 2986



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
                sequence
          Length = 28434780

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Plus

                                                                            
Query: 280      tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
                ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 16957794 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 16957853

                                                          
Query: 340      agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
                ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 16957854 agccccggcgcatactcactggtcgggttcagcttcaccagc 16957895



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                          
Query: 448      gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
                ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 16957965 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 16958022



to top

>dbj|AP003913.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OJ1484_G09
          Length = 124695

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Plus

                                                                          
Query: 280    tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
              ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 104805 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 104864

                                                        
Query: 340    agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
              ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 104865 agccccggcgcatactcactggtcgggttcagcttcaccagc 104906



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Plus

                                                                        
Query: 448    gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
              ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 104976 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 105033



to top

>dbj|AK073703.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033055B18, full
            insert sequence
          Length = 3538

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 280  tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
            ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 3213 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 3154

                                                      
Query: 340  agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 3153 agccccggcgcatactcactggtcgggttcagcttcaccagc 3112



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
            ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 3042 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 2985



to top

>dbj|AK070742.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061C12, full
            insert sequence
          Length = 4317

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 280  tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
            ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 4115 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 4056

                                                      
Query: 340  agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 4055 agccccggcgcatactcactggtcgggttcagcttcaccagc 4014



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
            ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 3944 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 3887



to top

>dbj|AK067572.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108G24, full
            insert sequence
          Length = 3158

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 280  tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
            ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 2949 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2890

                                                      
Query: 340  agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 2889 agccccggcgcatactcactggtcgggttcagcttcaccagc 2848



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
            ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 2778 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 2721



to top

>dbj|AK061683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A07, full
            insert sequence
          Length = 1704

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 280  tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
            ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 1505 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 1446

                                                      
Query: 340  agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 1445 agccccggcgcatactcactggtcgggttcagcttcaccagc 1404



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
            ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 1334 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 1277



to top

>gb|AY187619.1| Oryza sativa (indica cultivar-group) phosphoenolpyruvate carboxylase
            (PEPC) mRNA, complete cds
          Length = 2981

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 87/102 (85%)
 Strand = Plus / Minus

                                                                        
Query: 280  tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
            ||||| ||||||||||| || || || || ||||||||||| |||||||| |||||||||
Sbjct: 2955 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2896

                                                      
Query: 340  agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 381
            ||||||||||| || || || | || ||| ||||||||||||
Sbjct: 2895 agccccggcgcatactcactggtcgggttcagcttcaccagc 2854



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 52/58 (89%)
 Strand = Plus / Minus

                                                                      
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
            ||||| ||||| ||||||| |||||| |||||||| || |||||||||||||||||||
Sbjct: 2784 gggtcgcggattcgcttcatcgtgtaagcctggcagacattcagggtggtgatgtagg 2727



to top

>gb|AY349322.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>gb|AY349321.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>gb|AY349316.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349312.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>gb|AY349311.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>gb|AY349310.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>gb|AY349308.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>gb|AY349306.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>gb|AY349304.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1153

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1140 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1081

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1080 ggcgcgtactcactcgccgggttcagcgtcac 1049



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 975 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 916

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 915 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 856

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 855 gcaacctg 848



to top

>gb|AY349303.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>gb|AY349302.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349298.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1151

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 79/92 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 973 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 914

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 913 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 854

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 853 gcaacctg 846



to top

>emb|Y15897.1|TAPEPC Triticum aestivum mRNA for phosphoenolpyruvate carboxykinase,
           partial
          Length = 1148

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| || |||| |||||||||||| | |
Sbjct: 814 gggtcacggatcctcttcaatgtgtatgcttggcagacattcatggtggtgatgtacgcg 755

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || ||||||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 754 tcacggaggcggagccgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 695

                                           
Query: 568 gcaacctggacgagcagcttcttggtgtcctc 599
           |||||||| |  |||||||||| ||| |||||
Sbjct: 694 gcaacctgaagaagcagcttctgggtctcctc 663



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                       
Query: 286 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
           ||||||||||  ||||| || |||||||||||||| | |||||| || ||||||||||||
Sbjct: 982 gtgttctgcagaccggcagcaatgcccttcatggtcaagatgagggtatcctccagcccc 923

                   
Query: 346 ggcgcgta 353
           || |||||
Sbjct: 922 ggtgcgta 915



to top

>emb|AJ312627.1|VPL312627 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 4
          Length = 1092

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                        
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            ||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 1091 gcggcgatgcccttcatggtgaggatgagggtgtcctccagccc 1048



to top

>dbj|D13987.1|BNAPE3 Brassica napus PE3-PEPCase gene for phosphoenolpyruvate carboxylase,
            complete cds
          Length = 6603

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 100/120 (83%)
 Strand = Plus / Minus

                                                                        
Query: 439  tggaagctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtg 498
            |||||||| ||||| |||||| |||| || || ||||| |||||||||||||  || |||
Sbjct: 5660 tggaagctcgggtcacggatctgcttgagagtataggcttggcacacgttcaacgtcgtg 5601

                                                                        
Query: 499  atgtaggggtcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtcc 558
            ||||| |||||||||||| ||||||  ||| ||||||| || ||  ||||||||| ||||
Sbjct: 5600 atgtacgggtcacgcagctgcagcctttgcctcaggtagggatcaccttcaagaatgtcc 5541



to top

>gb|AY349319.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349318.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349317.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349315.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349314.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349313.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349309.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349307.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349305.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349301.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349299.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 78/92 (84%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            |||||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>emb|AJ312626.1|VPL312626 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 3
          Length = 1092

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                        
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            |||||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 1091 gcggcgatacccttcatggtgaggatgagggtgtcctccagccc 1048



to top

>emb|AJ252929.1|VPAJ2929 Vanilla pompona partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 42/44 (95%)
 Strand = Plus / Minus

                                                        
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            ||||||||||| ||||||||||||||||| ||||||||||||||
Sbjct: 1091 gcggcgatgcctttcatggtgaggatgagggtgtcctccagccc 1048



to top

>emb|AJ312663.1|MEX312663 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 4
          Length = 1095

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||||||||||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1094 gcggcgatgcccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ312632.1|KDA312632 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 1
          Length = 1092

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 53/59 (89%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||||||||||||||| |||||||| ||||||||||| || || || ||||||||
Sbjct: 1091 gcggcgatgcccttcatggtcaggatgagggtgtcctccaggccaggggcatattcgct 1033



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||| | |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtacgagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ252946.1|KGAJ2946 Kalanchoe gracilipes partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1116

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||| |||||| ||||||||||||| |||||||| |||||||||||
Sbjct: 1103 tgcatgccagcggcgttgcccttcatggtcaggatgagggtgtcctccag 1054



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ252923.1|KSAJ2923 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1116

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||| ||||| |||||||||||||| |||||||| |||||||||||
Sbjct: 1103 tgcatgccagcggcaatgcccttcatggtcaggatgagggtgtcctccag 1054



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ231303.1|KSAJ1303 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1116

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||| ||||| |||||||||||||| |||||||| |||||||||||
Sbjct: 1103 tgcatgccagcggcaatgcccttcatggtcaggatgagggtgtcctccag 1054



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ231288.1|KGAJ1288 Kalanchoe gracilipes partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1116

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 46/50 (92%)
 Strand = Plus / Minus

                                                              
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||| |||||| ||||||||||||| |||||||| |||||||||||
Sbjct: 1103 tgcatgccagcggcgttgcccttcatggtcaggatgagggtgtcctccag 1054



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>ref|NM_191306.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2901

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            ||||||||||| || || ||||||||||||||||| |||||||| ||||||||
Sbjct: 2894 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 2842



to top

>gb|DQ320104.1| Clusia hilariana phosphoenolpyruvate carboxylase isoform 3 (pepc)
           mRNA, partial cds
          Length = 1092

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 105/129 (81%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           ||||||| || || ||||| |||||||||||||| ||||| || || |||||||||||||
Sbjct: 946 agctgggatctcgaatccgtttcagcgtgtaggcttggcaaacattaagggtggtgatgt 887

                                                                       
Query: 503 aggggtcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctat 562
           |||  ||||| || || || |  ||||||||||  |||||  |||||||||  ||||| |
Sbjct: 886 aggaatcacgaagacgaagtctttgcttcaggtgggggtctccttcaagaagatccctgt 827

                    
Query: 563 ggccagcaa 571
           | |||||||
Sbjct: 826 gtccagcaa 818



to top

>emb|AJ312680.1|KFE312680 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 3
          Length = 1095

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||||||||||||||| |||||||| |||||||||||
Sbjct: 1094 gcggcgatgcccttcatggtcaggatgagggtgtcctccag 1054



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



to top

>emb|AJ312674.1|ABA312674 Aloe vera partial mRNA for phosphoenolpyruvate carboxylase (pepc
           gene), isoform 2
          Length = 1092

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                       
Query: 463 ttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccgcagc 522
           ||||| ||||| || ||||||||||||||||| || ||||||| || |||||| || || 
Sbjct: 926 ttcagagtgtatgcttggcacacgttcagggttgttatgtaggcgttacgcaggcgaagt 867

                                        
Query: 523 cgctgcttcaggtacgggtcgtcttcaag 551
           | ||||||||| ||||||||  |||||||
Sbjct: 866 ctctgcttcagatacgggtccccttcaag 838



to top

>emb|AJ312624.1|VPL312624 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 1
          Length = 1092

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            ||||| |||||||||||||||||||| ||||||||||||||
Sbjct: 1088 gcgatacccttcatggtgaggatgagggtgtcctccagccc 1048



to top

>emb|AJ252928.1|VAAJ2928 Vanilla aphylla partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            ||||||||||||||||| |||||||| ||||||||||||||
Sbjct: 1088 gcgatgcccttcatggttaggatgagggtgtcctccagccc 1048



to top

>emb|AJ252924.1|KSAJ2924 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1095

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 39/41 (95%)
 Strand = Plus / Minus

                                                     
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||||||||||||||| |||||||| |||||||||||
Sbjct: 1094 gcggcgatgcccttcatggtcaggatgagggtgtcctccag 1054



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>dbj|AP003409.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1131G08
          Length = 158241

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                  
Query: 286   gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
             ||||||||||| || || ||||||||||||||||| |||||||| ||||||||
Sbjct: 38881 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 38933



to top

>dbj|AK101274.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033033B07, full
            insert sequence
          Length = 3056

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            ||||||||||| || || ||||||||||||||||| |||||||| ||||||||
Sbjct: 2845 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 2793



to top

>dbj|AK070480.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023049F03, full
            insert sequence
          Length = 2668

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                 
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            ||||||||||| || || ||||||||||||||||| |||||||| ||||||||
Sbjct: 2456 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 2404



to top

>gb|AY210895.1| Arabidopsis thaliana phosphoenolpyruvate carboxylase mRNA, complete
            cds
          Length = 3178

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 72/85 (84%)
 Strand = Plus / Minus

                                                                        
Query: 439  tggaagctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtg 498
            |||||||| ||||| |||||| |||| || || ||||| |||||||||||||  || |||
Sbjct: 2901 tggaagcttgggtcacggatctgcttgagtgtataggcttggcacacgttcaatgtcgtg 2842

                                     
Query: 499  atgtaggggtcacgcagccgcagcc 523
            ||||| |||||||| ||| ||||||
Sbjct: 2841 atgtatgggtcacgaagctgcagcc 2817



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || |||
Sbjct: 3054 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 2995

                       
Query: 346  ggcgcgtattc 356
            || ||||||||
Sbjct: 2994 ggtgcgtattc 2984



to top

>dbj|AB055075.1| Oryza sativa (japonica cultivar-group) mRNA for phosphoenolpyruvate
           carboxylase, partial cds, clone:OsppcAUC-2
          Length = 991

 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                
Query: 286 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
           ||||||||||| || || ||||||||||||||||| |||||||| ||||||||
Sbjct: 791 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 739



to top

>gb|AY349320.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            || ||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggtgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>gb|AY349300.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 phosphoenolpyruvate
            carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds
          Length = 1154

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 77/92 (83%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||  ||||| || || ||||||||||| | |||||| || ||||||||||||
Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082

                                            
Query: 346  ggcgcgtattcgctcgccgcgttgagcttcac 377
            || ||||| || ||||||| ||| ||| ||||
Sbjct: 1081 ggtgcgtactcactcgccgggttcagcgtcac 1050



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 448 gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
           ||||| ||||||| |||||  ||||| || ||||| ||||||| |||||||||||| |  
Sbjct: 976 gggtcacggatcctcttcaatgtgtatgcttggcagacgttcatggtggtgatgtatgca 917

                                                                       
Query: 508 tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
           ||||| || || || |||||||||||||| || ||  |||||||||  ||| | || |||
Sbjct: 916 tcacggaggcggagacgctgcttcaggtagggatcaccttcaagaagatccttgtgccca 857

                   
Query: 568 gcaacctg 575
           ||||||||
Sbjct: 856 gcaacctg 849



to top

>emb|AJ312644.1|MCR312644 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 5
          Length = 1098

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            ||||||||||||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1094 gcgatgcccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1039



to top

>emb|AJ252947.1|KPAJ2947 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1116

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcg 351
            |||||||| ||||||||||| ||||| || |||||||| ||||||||||| || || |||
Sbjct: 1103 tgcatgccagcggcgatgcctttcattgtcaggatgagggtgtcctccagaccaggagcg 1044

                    
Query: 352  tattcgct 359
            || |||||
Sbjct: 1043 tactcgct 1036



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgat 500
           ||||| || ||||| ||||||||||||||||| ||||| || |||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgat 889



to top

>emb|AJ231295.1|KPAJ1295 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1116

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 59/68 (86%)
 Strand = Plus / Minus

                                                                        
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcg 351
            |||||||| ||||||||||| ||||| || |||||||| ||||||||||| || || |||
Sbjct: 1103 tgcatgccagcggcgatgcctttcattgtcaggatgagggtgtcctccagaccaggagcg 1044

                    
Query: 352  tattcgct 359
            || |||||
Sbjct: 1043 tactcgct 1036



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgat 500
           ||||| || ||||| ||||||||||||||||| ||||| || |||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgat 889



to top

>gb|AF236126.1| Vitis vinifera PEP carboxylase (GPEPC) mRNA, partial cds
          Length = 1170

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 107/132 (81%)
 Strand = Plus / Minus

                                                                       
Query: 446 tggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagg 505
           ||||||| |||||||||||||| ||||| || |||||||| || ||||| || ||||| |
Sbjct: 850 tggggtctcggatccgcttcagtgtgtatgcttggcacacattaagggtcgttatgtatg 791

                                                                       
Query: 506 ggtcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggc 565
             ||||| ||||| || | ||| |||| ||| |||||| |||| ||||  || ||||| |
Sbjct: 790 catcacgaagccggagtctctgtttcaagtatgggtcgccttccagaagatctctatgcc 731

                       
Query: 566 cagcaacctgga 577
           |||||| |||||
Sbjct: 730 cagcaatctgga 719



to top

>gb|AY517644.1| Chlamydomonas reinhardtii phosphoenolpyruvate carboxylase (Ppc1)
            mRNA, complete cds
          Length = 3902

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 38/40 (95%)
 Strand = Plus / Minus

                                                    
Query: 283  cccgtgttctgcatgccggcggcgatgcccttcatggtga 322
            ||||||||||||||||| |||||||||||||| |||||||
Sbjct: 2921 cccgtgttctgcatgcccgcggcgatgcccttgatggtga 2882



to top

>emb|Z71976.1|FTPPCC F.trinervia ppcC gene (partial)
          Length = 692

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                       
Query: 286 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
           ||||||||||| || || ||||| ||||||||||| | |||||| ||||| ||||| |||
Sbjct: 107 gtgttctgcattcctgcagcgatacccttcatggtcaagatgagggtgtcttccagaccc 48

                          
Query: 346 ggcgcgtattcgctc 360
           || ||||| ||||||
Sbjct: 47  ggggcgtactcgctc 33



to top

>emb|AJ312681.1|KFE312681 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 4
          Length = 714

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                      
Query: 301 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
           ||||||||||| |||||||| |||||||| ||||||||||| || || || ||||||||
Sbjct: 713 gcggcgatgcctttcatggtcaggatgagggtgtcctccaggccaggggcatattcgct 655



to top

>emb|AJ312661.1|MEX312661 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 2
          Length = 1095

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| ||||||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1094 gcggcgatacccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ400987.1|EST400987 Epidendrum stamfordianum partial mRNA for phosphoenolpyruvate
            carboxylase (ppc gene)
          Length = 1113

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| || || |||||||| |||||||||||||||||||| |  || || ||||| ||
Sbjct: 1113 ctagccggtattttgcatgcctgcggcgatgcccttcatggtcaaaatcagggtgtcttc 1054

                           
Query: 339  cagccccggcgcgta 353
            |||||| ||||||||
Sbjct: 1053 cagcccgggcgcgta 1039



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                               
Query: 457 atccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggt 508
           ||||||||||||||||| || ||||| || ||||| || || ||||| ||||
Sbjct: 932 atccgcttcagcgtgtacgcttggcagacattcagagttgttatgtaagggt 881



to top

>emb|AJ300742.1|PAM300742 Phalaenopsis amabilis partial ppc gene for phosphoenolpyruvate
            carboxylase
          Length = 2898

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                        
Query: 473  aggcctggcacacgttcagggtggtgatgtaggggtcacgcagccgcagccgctgcttca 532
            |||| |||||||| ||||| ||||||||||||| ||| || || ||||  | ||| ||||
Sbjct: 2701 aggcttggcacacattcagagtggtgatgtaggcgtcgcggaggcgcaatctctgtttca 2642

                                                       
Query: 533  ggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
             ||| |||||| |||||||||  || ||||| |||||||||||
Sbjct: 2641 agtaggggtcgccttcaagaagatctctatgtccagcaacctg 2599



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 56/66 (84%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||||||| || || || || |||||||  |||||||| || |||||
Sbjct: 2898 ctagccggtgttctgcatgccagcagcaatacctttcatggccaggatgagggtatcctc 2839

                  
Query: 339  cagccc 344
            ||||||
Sbjct: 2838 cagccc 2833



to top

>emb|AJ300741.1|PEQ300741 Phalaenopsis equestris partial ppc gene for phosphoenolpyruvate
            carboxylase
          Length = 2898

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 85/103 (82%)
 Strand = Plus / Minus

                                                                        
Query: 473  aggcctggcacacgttcagggtggtgatgtaggggtcacgcagccgcagccgctgcttca 532
            |||| |||||||| ||||| ||||||||||||| ||| || || ||||  | ||| ||||
Sbjct: 2701 aggcttggcacacattcagagtggtgatgtaggcgtcgcggaggcgcaatctctgtttca 2642

                                                       
Query: 533  ggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
             ||| |||||| |||||||||  || ||||| |||||||||||
Sbjct: 2641 agtaggggtcgccttcaagaagatctctatgtccagcaacctg 2599



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 55/66 (83%)
 Strand = Plus / Minus

                                                                        
Query: 279  ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||| |||||||||| ||| || || || || |||||||  |||||||| || |||||
Sbjct: 2898 ctagccggtgttctgcaggccagcagcaatacctttcatggccaggatgagggtatcctc 2839

                  
Query: 339  cagccc 344
            ||||||
Sbjct: 2838 cagccc 2833



to top

>emb|AJ252921.1|KPAJ2921 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 52/59 (88%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| ||||||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1094 gcggcgatacccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ231294.1|PCAJ1294 Polytrichum commune partial mRNA for phosphoenolpyruvate carboxylase,
            clone pPC21.1
          Length = 1110

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                           
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||||| || ||||||||||||||||| |||||||| ||||||||
Sbjct: 1097 tgcatgccagcagcgatgcccttcatggtaaggatgagagtgtcctc 1051



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 496 gtgatgtaggggtcacgcagccgcagccgctgcttcagg 534
           ||||||||||| || ||||| ||||| ||||||||||||
Sbjct: 893 gtgatgtagggctctcgcagtcgcagacgctgcttcagg 855



to top

>emb|AJ231280.1|BRAJ1280 Bucegia romanica partial mRNA for phosphoenolpyruvate carboxylase,
            clone pBR12.3
          Length = 1104

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 43/47 (91%)
 Strand = Plus / Minus

                                                           
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||||| ||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 1091 tgcatgccagcggcgatgcctttcatggtgagaatgagagtgtcctc 1045



to top

>gb|AF248080.1|AF248080 Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA,
            complete cds
          Length = 3372

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||||||||| || || ||||| ||||||||||| | |||||| ||||| ||||| |||
Sbjct: 3064 gtgttctgcattcctgcagcgatacccttcatggtcaagatgagggtgtcttccagaccc 3005

                           
Query: 346  ggcgcgtattcgctc 360
            || ||||| ||||||
Sbjct: 3004 ggggcgtactcgctc 2990



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                        
Query: 454  cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
            |||||||| ||||| ||||| || || |||||||||||||| |||||||| | |||||||
Sbjct: 2890 cggatccgtttcagagtgtacgcttgacacacgttcagggtcgtgatgtatgagtcacgc 2831

              
Query: 514  ag 515
            ||
Sbjct: 2830 ag 2829



to top

>emb|X87820.1|KBRNAPPC3 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase  (Kb3)
          Length = 1092

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaaccgttcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||||||||| || || ||||| ||||||||||| || || || ||||||||
Sbjct: 1088 gcgatgcccttcattgtcagaatgagggtgtcctccaggccaggggcatattcgct 1033



to top

>emb|AJ231284.1|DSAJ1284 Dicranum scoparium partial mRNA for phosphoenolpyruvate carboxylase,
            clone pDS23.3
          Length = 1107

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                              
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||| || || ||||| ||||||||||||||||| |||||||||||
Sbjct: 1094 tgcatgccagcagctatgcctttcatggtgaggatgagagtgtcctccag 1045



to top

>emb|AJ312682.1|KFE312682 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 5
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 1094 gcggcgatgcctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ312679.1|KFE312679 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 2
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||| || |||||||| |||||||| |||||||||||
Sbjct: 1091 gcgatacctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ312678.1|KFE312678 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 1
          Length = 723

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 36/38 (94%)
 Strand = Plus / Minus

                                                 
Query: 304 gcgatgcccttcatggtgaggatgagcgtgtcctccag 341
           ||||||||||||||||| |||||||| |||||||||||
Sbjct: 719 gcgatgcccttcatggtcaggatgagggtgtcctccag 682



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 563 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 514



to top

>emb|AJ312673.1|ABA312673 Aloe vera partial mRNA for phosphoenolpyruvate carboxylase (pepc
           gene), isoform 1
          Length = 1017

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 78/94 (82%)
 Strand = Plus / Minus

                                                                       
Query: 460 cgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagccgc 519
           |||||||| ||||| || ||||||||||||| ||| || ||||||| || |||||| || 
Sbjct: 854 cgcttcagagtgtatgcttggcacacgttcaaggttgttatgtaggcgttacgcaggcga 795

                                             
Query: 520 agccgctgcttcaggtacgggtcgtcttcaagaa 553
           || | ||| ||||| ||||||||  |||||||||
Sbjct: 794 agtctctgtttcagatacgggtccccttcaagaa 761



to top

>emb|AJ312668.1|LBI312668 Leptotes bicolor partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 1
          Length = 870

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||||| |||||||
Sbjct: 710 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtaggagtcacgc 651

             
Query: 514 ag 515
           ||
Sbjct: 650 ag 649



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                   
Query: 304 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
           |||||||| |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 866 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 811



to top

>emb|AJ312665.1|SAP312665 Solenangis aphylla partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 3
          Length = 705

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||||| |||||||
Sbjct: 545 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtaggagtcacgc 486

             
Query: 514 ag 515
           ||
Sbjct: 485 ag 484



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                
Query: 307 atgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
           |||||||||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 698 atgcccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 646



to top

>emb|AJ312662.1|MEX312662 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 3
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



to top

>emb|AJ312660.1|ETI312660 Euphorbia tirucalli partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 4
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Minus

                                                     
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||| ||||| |||||||| |||||||| |||||||||||
Sbjct: 1094 gcggcaatgcctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ312649.1|KPI312649 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform D
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||| || |||||||| |||||||| |||||||||||
Sbjct: 1091 gcgatccctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ312646.1|KPI312646 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform A
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 1094 gcggcgatgcctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ312634.1|KDA312634 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 3
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggattcgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 1094 gcggcgatgcctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ344055.1|KPI344055 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
           (ppc gene), isogene 4
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||| || |||||||| |||||||| |||||||||||
Sbjct: 1091 gcgatccctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ344052.1|KPI344052 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
           (ppc gene), isogene 1
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 886



 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||||||||| |||||||| |||||||| |||||||||||
Sbjct: 1094 gcggcgatgcctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|AJ252925.1|KSAJ2925 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate
           carboxylase
          Length = 1092

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ252922.1|KPAJ2922 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



to top

>gb|AF008939.1|AF008939 Gossypium hirsutum phosphoenolpyruvate carboxylase 1 (PEPC1) mRNA,
            complete cds
          Length = 3405

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 105/130 (80%)
 Strand = Plus / Minus

                                                                        
Query: 448  gggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtagggg 507
            ||||| |||||||  ||||  ||||| || |||||||| || ||||| |||||||| |  
Sbjct: 3014 gggtcacggatccttttcaaagtgtacgcttggcacacattaagggttgtgatgtaagca 2955

                                                                        
Query: 508  tcacgcagccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggcca 567
            ||||| || || |||| |||||||||||| |||||  |||||||||  || || || |||
Sbjct: 2954 tcacgaagtcggagcctctgcttcaggtaagggtcaccttcaagaagatctctgtgtcca 2895

                      
Query: 568  gcaacctgga 577
            ||||||||||
Sbjct: 2894 gcaacctgga 2885



to top

>emb|AJ312655.1|TUS312655 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 3
          Length = 1089

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 48/54 (88%)
 Strand = Plus / Minus

                                                                  
Query: 300  ggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 353
            |||||||||||| |||||||| |||||||| ||||||||||  || ||||||||
Sbjct: 1089 ggcggcgatgcctttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1036



to top

>emb|AJ001028.1|KFPEPC458 Kalanchoe fedtschenkoi mRNA for phosphoenolpyruvate carboxylase
           (458bp)
          Length = 458

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||||||||| || ||||||||
Sbjct: 160 cggatacgtttcagggtgtaggcctggcacacgttcagtgtcgtgatgta 209



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                    
Query: 301 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
           |||||||| || |||||||| |||||||| |||||||||||
Sbjct: 1   gcggcgatacctttcatggtcaggatgagggtgtcctccag 41



to top

>emb|X91406.1|TUPPC T.usneoides mRNA for phosphoenolpyruvate decarboxylase
          Length = 2028

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 353
            ||||| |||||||||||||| |||||||| ||||||||||  || ||||||||
Sbjct: 2027 gcggcaatgcccttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1975



to top

>emb|AJ252948.1|VPAJ2948 Vanilla phalaenopsis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 47/53 (88%)
 Strand = Plus / Minus

                                                                 
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            |||||||| ||||||||||||||||| |||||||| | |||||| || |||||
Sbjct: 1079 tgcatgccagcggcgatgcccttcattgtgaggatcaccgtgtcttcaagccc 1027



to top

>emb|AJ252932.1|VPAJ2932 Vanilla phalaenopsis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            |||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 1088 gcgatgcctttcatggttaggatgagggtgtcctccagccc 1048



to top

>emb|AJ252930.1|VPAJ2930 Vanilla phalaenopsis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1092

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            |||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 1088 gcgatgcctttcatggttaggatgagggtgtcctccagccc 1048



to top

>emb|AJ252927.1|VAAJ2927 Vanilla aphylla partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1086

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                     
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 344
            ||||||||||||||||| |||||||| ||||| ||||||||
Sbjct: 1082 gcgatgcccttcatggttaggatgagggtgtcttccagccc 1042



to top

>gb|AF271161.2| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 1 mRNA,
            complete cds
          Length = 3368

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||||||||| || || || ||||||||||| | |||||| |||||||||||
Sbjct: 2965 gtgttctgcatgccagcagcaatacccttcatggtcaagatgagagtgtcctccag 2910



to top

>emb|AJ312670.1|LBI312670 Leptotes bicolor partial mRNA for phosphoenolpyruvate carboxylase
           (pepc gene), isoform 3
          Length = 1092

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 97/120 (80%)
 Strand = Plus / Minus

                                                                       
Query: 456 gatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcag 515
           |||||| ||||| ||||||||||||||||| ||||| || |||||||| |  ||||| ||
Sbjct: 933 gatccgtttcagggtgtaggcctggcacacattcagagttgtgatgtaagaatcacggag 874

                                                                       
Query: 516 ccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacctg 575
            | ||| | ||| |||||||| || ||  |||||||||  || || || |||||||||||
Sbjct: 873 gcacagtctctgtttcaggtagggatctccttcaagaagatctctgtgaccagcaacctg 814



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 62/74 (83%)
 Strand = Plus / Minus

                                                                        
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgcc 363
            |||||||| ||||| || |||||||| |||||||||||||| || || || ||||| |  
Sbjct: 1088 gcgatgcctttcattgtcaggatgagggtgtcctccagcccaggagcatactcgcttgtg 1029

                          
Query: 364  gcgttgagcttcac 377
            | ||||||||||||
Sbjct: 1028 gggttgagcttcac 1015



to top

>emb|AJ312647.1|KPI312647 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform B
          Length = 1092

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| ||||||||||| ||||| ||||||||||| || || || ||||||||
Sbjct: 1088 gcgatgcctttcatggtgagaatgagggtgtcctccaggccaggggcatattcgct 1033



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  | ||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcattcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ312635.1|KDA312635 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 4
          Length = 1092

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                    
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||||||||||||||||||||| |  ||||||||||
Sbjct: 1091 gcggcgatgcccttcatggtgaggatcaaggtgtcctcca 1052



to top

>emb|AJ312630.1|ACO312630 Ananas comosus partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 3
          Length = 1089

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctc 360
            |||||||| ||||||||||| | |||||| ||||||||||| || || ||||| || || 
Sbjct: 1088 gcggcgatacccttcatggtcaagatgagggtgtcctccagtccgggggcgtactcactt 1029

                                
Query: 361  gccgcgttgagcttcaccag 380
            || | ||| |||||||||||
Sbjct: 1028 gcggggttcagcttcaccag 1009



to top

>emb|AJ312628.1|ACO312628 Ananas comosus partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 2
          Length = 1089

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 67/80 (83%)
 Strand = Plus / Minus

                                                                        
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctc 360
            |||||||| ||||||||||| | |||||| ||||||||||| || || ||||| || || 
Sbjct: 1088 gcggcgatccccttcatggtcaagatgagggtgtcctccagtccgggggcgtactcactt 1029

                                
Query: 361  gccgcgttgagcttcaccag 380
            || | ||| |||||||||||
Sbjct: 1028 gcggggttcagcttcaccag 1009



to top

>emb|AJ312617.1|CRE312617 Cycas revoluta partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 2
          Length = 1095

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||| ||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcgcacattcagtgtcgtgatgta 886



to top

>emb|AJ344053.1|KPI344053 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (ppc gene), isogene 2
          Length = 1092

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| ||||||||||| ||||| ||||||||||| || || || ||||||||
Sbjct: 1088 gcgatgcctttcatggtgagaatgagggtgtcctccaggccaggggcatattcgct 1033



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  | ||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcattcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ252920.1|KPAJ2920 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ252919.1|KPAJ2919 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ252915.1|KKAJ2915 Kalanchoe kewensis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgat 500
           ||||| || ||||| ||||||||||||||||| ||||| || |||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgat 889



to top

>emb|AJ231293.1|MHAJ1293 Mnium hornum partial mRNA for phosphoenolpyruvate carboxylase, clone
            pMH19.1
          Length = 1116

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                        
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            |||||||| |||||||| |||||||||||||| || ||||||||
Sbjct: 1103 tgcatgccagcggcgatacccttcatggtgagaataagcgtgtc 1060



to top

>emb|AJ312683.1|KFE312683 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 6
          Length = 1092

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            ||||| ||||| |||||||| |||||||| ||||||||||| || || || ||||||||
Sbjct: 1091 gcggctatgcctttcatggtcaggatgagggtgtcctccaggccaggggcatattcgct 1033



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||| | |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtacgagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ312648.1|KPI312648 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform C
          Length = 1092

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| || ||||||||||| ||||| ||||||||||| || || || ||||||||
Sbjct: 1091 gcggcgatacctttcatggtgagaatgagggtgtcctccaggccaggggcatattcgct 1033



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  | ||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcattcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ312641.1|MCR312641 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate
            carboxylase (pepc gene), isoform 2
          Length = 1098

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccgg 347
            |||||||| || ||||||||||||||||| |||||||| || |||||
Sbjct: 1097 gcggcgatacctttcatggtgaggatgagtgtgtcctcaagacccgg 1051



to top

>emb|AJ344054.1|KPI344054 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase
            (ppc gene), isogene 3
          Length = 1092

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| || ||||||||||| ||||| ||||||||||| || || || ||||||||
Sbjct: 1091 gcggcgatacctttcatggtgagaatgagggtgtcctccaggccaggggcatattcgct 1033



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  | ||||| || |||||||||| |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcattcagagttgtgatgtaggagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



to top

>emb|AJ252918.1|KGAJ2918 Kalanchoe grandiflora partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1095

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||| || |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1094 gcggcgatacctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcag 491
           ||||| || ||||| ||||||||||||||||| |||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcag 898



to top

>emb|AJ231296.1|PFAJ1296 Polytrichum formosum partial mRNA for phosphoenolpyruvate
            carboxylase, clone pPF20.1
          Length = 1110

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||||| || |||||||||||||| || |||||||| ||||||||
Sbjct: 1097 tgcatgccagcagcgatgcccttcattgtaaggatgagagtgtcctc 1051



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 496 gtgatgtaggggtcacgcagccgcagccgctgcttcagg 534
           ||||||||||| || ||||| ||||| ||||||||||||
Sbjct: 893 gtgatgtagggctctcgcagtcgcagacgctgcttcagg 855



to top

>emb|AJ231289.1|LCAJ1289 Lunularia cruciata partial mRNA for phosphoenolpyruvate carboxylase,
            clone pLC13.8
          Length = 1107

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||||| || ||||| ||||||||||| |||||||| ||||||||
Sbjct: 1094 tgcatgccagcagcgatacccttcatggtcaggatgagagtgtcctc 1048



to top

>dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT31E21, TM0340,
              complete sequence
          Length = 120480

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Plus

                                                                     
Query: 286    gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
              ||||| ||||||||||| || || |||||||||||||| ||||| ||||| ||||
Sbjct: 103616 gtgttttgcatgccggcagcaatacccttcatggtgagaatgagggtgtcttcca 103670



to top

>dbj|AB092821.1| Lotus japonicus LjPEPC2 mRNA for phosphoenolpyruvate carboxylase,
            complete cds
          Length = 3158

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 48/55 (87%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||| ||||||||||| || || |||||||||||||| ||||| ||||| ||||
Sbjct: 2914 gtgttttgcatgccggcagcaatacccttcatggtgagaatgagggtgtcttcca 2860



to top

>emb|X95856.1|NAPPC1 Neoregelia ampullacea mRNA for phosphoenolpyruvate carboxylase
          Length = 1104

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||| || |||||||| |||||||| | |||||| |||||||||||
Sbjct: 1091 tgcatgccagccgcgatgcctttcatggtcaagatgagggtgtcctccag 1042



to top

>emb|X87819.1|KBRNAPPC2 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase  (Kb2)
          Length = 1095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||| || |||||||| |||||||| |||||||||||
Sbjct: 1091 gcgatacctttcatggtcaggatgagggtgtcctccag 1054



to top

>emb|X87818.1|KBRNAPPC1 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase  (Kb1)
          Length = 1095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|X87149.1|VPPPCGE1 V.planifolia mRNA for phosphoenolpyruvate carboxylase, air roots
          Length = 3111

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                        
Query: 283  cccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagc 342
            |||||||| ||||| || || || || |||||||| || |||||||| ||||||||||||
Sbjct: 2867 cccgtgttttgcattccagctgctatccccttcattgtaaggatgagggtgtcctccagc 2808

              
Query: 343  cc 344
            ||
Sbjct: 2807 cc 2806



to top

>emb|X14588.1|MCPPCB Mesembryanthemum crystallinum ppc2 gene for phosphoenolpyruvate
            carboxylase (EC 4.1.1.31)
          Length = 8050

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            ||||||||||| || || || || |||||||||||||||||||| |||||
Sbjct: 7582 gtgttctgcattccagctgcaatacccttcatggtgaggatgagtgtgtc 7533



to top

>emb|AJ312654.1|TUS312654 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 2
          Length = 1089

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 353
            ||||| ||||||||||| |||||||| ||||||||||  || ||||||||
Sbjct: 1085 gcgatacccttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1036



to top

>emb|AJ312653.1|TUS312653 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 1
          Length = 1089

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 353
            ||||| ||||||||||| |||||||| ||||||||||  || ||||||||
Sbjct: 1085 gcgatacccttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1036



to top

>emb|AJ312633.1|KDA312633 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate
           carboxylase (pepc gene), isoform 2
          Length = 1092

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
           |||||||||||||| || || ||||||||  ||||||| || |||||||| | |||||||
Sbjct: 935 cggatccgcttcagtgtatatgcctggcaagcgttcagagttgtgatgtacgagtcacgc 876

             
Query: 514 ag 515
           ||
Sbjct: 875 ag 874



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 50/59 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            ||||| ||||| ||||| || |||||||| ||||||||||| || || || ||||||||
Sbjct: 1091 gcggctatgcctttcattgtcaggatgagggtgtcctccaggccaggggcatattcgct 1033



to top

>emb|AJ252926.1|KPAJ2926 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 35/38 (92%)
 Strand = Plus / Minus

                                                  
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||| |||||||| |||||||| |||||||||||
Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccag 1054



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                             
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgta 503
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgatgta 886



to top

>emb|AJ252914.1|KKAJ2914 Kalanchoe kewensis partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                              
Query: 310  cccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            ||||||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1085 cccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgat 500
           ||||| || ||||| ||||||||||||||||| ||||| || |||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcagtgtcgtgat 889



to top

>emb|AJ243416.1|LES243416 Lycopersicon esculentum mRNA for phosphoenolpyruvate carboxylase 1
            (ppc1 gene)
          Length = 3192

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                      
Query: 460  cgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgcagcc 517
            ||||| || |||||||| || ||||||||||  || |||||||||| |||||||||||
Sbjct: 2730 cgctttagggtgtaggcttgacacacgttcaatgttgtgatgtaggagtcacgcagcc 2673



to top

>emb|AJ231290.1|LJAJ1290 Leucobryum juniperoideum partial mRNA for phosphoenolpyruvate
            carboxylase, clone pLU24.2
          Length = 1119

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 50/58 (86%)
 Strand = Plus / Minus

                                                                      
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcg 349
            |||||||| || || ||||||||||| || |||||||| |||||||| ||||| ||||
Sbjct: 1106 tgcatgccagcagctatgcccttcattgtaaggatgagggtgtcctcgagcccgggcg 1049



to top

>dbj|D10717.1|SOYGMPPC Glycine max mRNA for phosphoenolpyruvate carboxylase, complete cds
          Length = 3211

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                        
Query: 454  cggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgc 513
            ||||| || |||| ||||||||| ||||||||||| ||||| || || || |  ||||||
Sbjct: 2842 cggatacgtttcaacgtgtaggcttggcacacgtttagggtagtaatataagaatcacgc 2783

                                                                        
Query: 514  agccgcagccgctgcttcaggtacgggtcgtcttcaagaacgtccctatggccagcaacc 573
            |  ||||| |  ||||||| ||| || ||  |||||||||  |||||||||||||| |||
Sbjct: 2782 aagcgcagtctttgcttcaagtatggatctccttcaagaagatccctatggccagccacc 2723

              
Query: 574  tg 575
            ||
Sbjct: 2722 tg 2721



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                        
Query: 280  tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 339
            ||||| ||||| |||| ||| || || || |||||||||||||| ||||| ||||| |||
Sbjct: 3019 tagccagtgttttgcaagccagcagcaatacccttcatggtgagaatgagggtgtcttcc 2960

             
Query: 340  a 340
            |
Sbjct: 2959 a 2959



to top

>emb|Z48966.1|FPPPCAMR F.pringlei ppcA mRNA for phosphoenolpyruvate carboxylase
          Length = 3256

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            |||||| || ||||||||||| || || || || || |||||||| | ||||||||||||
Sbjct: 3039 aatctaaccggtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtc 2980

                 
Query: 336  ctcca 340
            |||||
Sbjct: 2979 ctcca 2975



to top

>emb|X64144.2|FPPPCA Flaveria pringlei ppcA1 gene for phosphoenolpyruvate carboxylase
          Length = 10108

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            |||||| || ||||||||||| || || || || || |||||||| | ||||||||||||
Sbjct: 9625 aatctaaccggtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtc 9566

                 
Query: 336  ctcca 340
            |||||
Sbjct: 9565 ctcca 9561



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                        
Query: 276  aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 335
            |||||| || ||||||||||| || || || || || |||||||| | ||||||||||||
Sbjct: 8561 aatctaaccggtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtc 8502

                 
Query: 336  ctcca 340
            |||||
Sbjct: 8501 ctcca 8497



to top

>gb|DQ320106.1| Clusia multiflora phosphoenolpyruvate carboxylase (pepc) mRNA,
           partial cds
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           ||||||| || |||||||| |||||||||||||| ||||| || || ||||| || ||||
Sbjct: 946 agctgggatcacggatccgtttcagcgtgtaggcttggcaaacattaagggttgtaatgt 887

            
Query: 503 a 503
           |
Sbjct: 886 a 886



to top

>gb|DQ320102.1| Clusia hilariana phosphoenolpyruvate carboxylase isoform 1 (pepc)
           mRNA, partial cds
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                       
Query: 443 agctggggtcccggatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgt 502
           ||||||| || |||||||| |||||||||||||| ||||| || || ||||| || ||||
Sbjct: 946 agctgggatcacggatccgtttcagcgtgtaggcttggcaaacattaagggttgtaatgt 887

            
Query: 503 a 503
           |
Sbjct: 886 a 886



to top

>emb|AJ312656.1|TUS312656 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 4
          Length = 1089

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 353
            ||||| || ||||||||||| |||||||| ||||||||||  || ||||||||
Sbjct: 1088 gcggcaatccccttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1036



to top

>emb|AJ312638.1|CUV312638 Clusia uvitana partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 3
          Length = 1092

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Minus

                                                 
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||||||||| | |||||| ||||||||||
Sbjct: 1088 gcgatgcccttcatggtcaagatgagggtgtcctcca 1052



to top

>emb|AJ252945.1|KGAJ2945 Kalanchoe grandiflora partial mRNA for phosphoenolpyruvate
            carboxylase
          Length = 1095

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 46/53 (86%)
 Strand = Plus / Minus

                                                                 
Query: 307  atgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            ||||| |||||||| |||||||| ||||||||||| || || ||||| |||||
Sbjct: 1088 atgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036



 Score = 44.1 bits (22), Expect = 0.57
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 454 cggatccgcttcagcgtgtaggcctggcacacgttcag 491
           ||||| || ||||| ||||||||||||||||| |||||
Sbjct: 935 cggatacgtttcagggtgtaggcctggcacacattcag 898



to top

>emb|AJ231291.1|LPAJ1291 Leptobryum pyriforme partial mRNA for phosphoenolpyruvate
            carboxylase, clone pLP1.1
          Length = 1101

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||| || ||||| || ||||||||||||||||  ||||||||||
Sbjct: 1088 tgcatgccagcagcgatccctttcatggtgaggatgacggtgtcctcca 1040



to top

>emb|AJ231283.1|DHAJ1283 Dicranella heteromalla partial mRNA for phosphoenolpyruvate
            carboxylase, clone pDH18.3
          Length = 1206

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                             
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||| |||||||| || |||||||||||||| |  ||||||||||
Sbjct: 1193 tgcatgccagcggcgatacctttcatggtgaggatcacggtgtcctcca 1145



to top

>dbj|AB078718.1| Nicotiana sylvestris Nsppc1 gene for phosphoenolpyruvate carboxylase,
            partial cds
          Length = 4589

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                        
Query: 289  ttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggc 348
            |||||||| || || || || ||||||||||| | |||||| ||||||||||  || || 
Sbjct: 4055 ttctgcattccagcagcaatacccttcatggtcaagatgagtgtgtcctccaagccaggg 3996

                                         
Query: 349  gcgtattcgctcgccgcgttgagcttcac 377
            ||||||||||| | || ||| ||||||||
Sbjct: 3995 gcgtattcgctagtcgggttcagcttcac 3967



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 460  cgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggggtcacgca 514
            ||||| || |||||||| |||||||||||||  || ||||| |||| ||||||||
Sbjct: 3884 cgctttagggtgtaggcttggcacacgttcaaagttgtgatataggagtcacgca 3830



to top

>gb|AF271163.1| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 3 mRNA,
            complete cds
          Length = 3218

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            ||||| |||||||| || || || ||||||||||| | |||||| |||||||||||
Sbjct: 2956 gtgttttgcatgccagcagcaatacccttcatggtcaagatgagagtgtcctccag 2901



to top

>gb|AF271162.1| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 2 mRNA,
            complete cds
          Length = 3212

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 341
            |||||||||||||| || || || |||||||| || | |||||| |||||||||||
Sbjct: 2961 gtgttctgcatgccagcagcaatacccttcatagtcaagatgagggtgtcctccag 2906



to top

>emb|X87821.1|KBRNAPCC4 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase  (Kb4)
          Length = 1092

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 304  gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 359
            |||||||||||||| || || ||||| ||||||||||| || || || ||||||||
Sbjct: 1088 gcgatgcccttcattgtcagaatgagggtgtcctccaggccaggggcatattcgct 1033



to top

>gb|DQ320105.1| Clusia minor phosphoenolpyruvate carboxylase (pepc) mRNA, partial cds
          Length = 1092

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||| |||||||| | |||||| ||||||||||
Sbjct: 1091 gcggcgatgcctttcatggtcaagatgagggtgtcctcca 1052



to top

>emb|AJ312637.1|CUV312637 Clusia uvitana partial mRNA for phosphoenolpyruvate carboxylase (pepc
            gene), isoform 2
          Length = 1092

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||| |||||||| | |||||| ||||||||||
Sbjct: 1091 gcggcgatgcctttcatggtcaagatgagggtgtcctcca 1052



to top

>emb|AJ252917.1|KTAJ2917 Kalanchoe tomentosa partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||| ||||||||||| || ||||| ||||||||||
Sbjct: 1094 gcggcgatacccttcatggtcagtatgagggtgtcctcca 1055



to top

>emb|AJ252916.1|KTAJ2916 Kalanchoe tomentosa partial mRNA for phosphoenolpyruvate carboxylase
          Length = 1095

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 36/40 (90%)
 Strand = Plus / Minus

                                                    
Query: 301  gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||| ||||||||||| || ||||| ||||||||||
Sbjct: 1094 gcggcgatccccttcatggtcagtatgagggtgtcctcca 1055



to top

>emb|AJ231292.1|MCAJ1292 Marchantia calcarata partial mRNA for phosphoenolpyruvate
            carboxylase, clone pMC14.1
          Length = 1107

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                    
Query: 283  cccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            ||||| || |||||||| || || ||||| ||||| ||||||||||| ||||||||
Sbjct: 1103 cccgtattttgcatgccagctgctatgcctttcattgtgaggatgagagtgtcctc 1048



to top

>emb|BX511072.8| Zebrafish DNA sequence from clone CH211-63A11 in linkage group 12,
             complete sequence
          Length = 165932

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   attttatttttatttctcaaaaca 155
             ||||||||||||||||||||||||
Sbjct: 48267 attttatttttatttctcaaaaca 48290



to top

>gb|AF512995.1| Citrus junos phosphoenolpyruvate carboxylase (pepc) mRNA, partial cds
          Length = 1490

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 454  cggatccgcttcagcgtgtaggcctggcacac 485
            |||||||| ||||| |||||||||||||||||
Sbjct: 1049 cggatccgtttcagtgtgtaggcctggcacac 1018



to top

>emb|BX682557.11| Zebrafish DNA sequence from clone DKEY-288D17 in linkage group 3,
             complete sequence
          Length = 103591

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 132   attttatttttatttctcaaaaca 155
             ||||||||||||||||||||||||
Sbjct: 44865 attttatttttatttctcaaaaca 44888



to top

>gb|AY663388.1| Lupinus albus phosphoenolpyruvate carboxylase 4 mRNA, complete cds
          Length = 3288

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgag 329
            |||||||||||||| || || || |||||||||||||| |||||
Sbjct: 3033 gtgttctgcatgccagcagcaatacccttcatggtgagaatgag 2990



to top

>emb|AM237200.1| Lupinus luteus mRNA for phosphoenolpyrovate carboxylase (pepc2 gene)
          Length = 2907

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgag 329
            |||||||||||||| || || || |||||||||||||| |||||
Sbjct: 2900 gtgttctgcatgccagcagcaatacccttcatggtgagaatgag 2857



to top

>ref|NM_180042.1| Arabidopsis thaliana ATPPC2 (PHOSPHOENOLPYRUVATE CARBOXYLASE 2);
            phosphoenolpyruvate carboxylase AT2G42600 (ATPPC2)
            transcript variant AT2G42600.2 mRNA, complete cds
          Length = 3309

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || |||
Sbjct: 3085 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 3026

                       
Query: 346  ggcgcgtattc 356
            || ||||||||
Sbjct: 3025 ggtgcgtattc 3015



to top

>ref|NM_180041.1| Arabidopsis thaliana ATPPC2 (PHOSPHOENOLPYRUVATE CARBOXYLASE 2);
            phosphoenolpyruvate carboxylase AT2G42600 (ATPPC2)
            transcript variant AT2G42600.1 mRNA, complete cds
          Length = 3414

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || |||
Sbjct: 3190 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 3131

                       
Query: 346  ggcgcgtattc 356
            || ||||||||
Sbjct: 3130 ggtgcgtattc 3120



to top

>emb|CR356245.25| Zebrafish DNA sequence from clone CH211-257I15 in linkage group 8,
              complete sequence
          Length = 153042

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 132    attttatttttatttctcaaaac 154
              |||||||||||||||||||||||
Sbjct: 111235 attttatttttatttctcaaaac 111213



to top

>emb|CR759774.13| Zebrafish DNA sequence from clone CH211-147P17 in linkage group 18,
             complete sequence
          Length = 149156

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 132   attttatttttatttctcaaaac 154
             |||||||||||||||||||||||
Sbjct: 92298 attttatttttatttctcaaaac 92320



to top

>gb|AC125474.16| Medicago truncatula clone mth2-16l11, complete sequence
          Length = 127369

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                    
Query: 286   gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
             |||||||||||||| || || || ||||||||||| || ||||| ||||| ||||
Sbjct: 47576 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 47522



to top

>emb|CR405713.7| Zebrafish DNA sequence from clone DKEY-12D5 in linkage group 8,
             complete sequence
          Length = 99181

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 132   attttatttttatttctcaaaac 154
             |||||||||||||||||||||||
Sbjct: 84135 attttatttttatttctcaaaac 84113



to top

>gb|AY074346.2| Arabidopsis thaliana At2g42600 mRNA sequence
          Length = 3342

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || |||
Sbjct: 3191 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 3132

                       
Query: 346  ggcgcgtattc 356
            || ||||||||
Sbjct: 3131 ggtgcgtattc 3121



to top

>emb|Z71974.1|FTPPCB F.trinervia ppcB gene (partial)
          Length = 814

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 286 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
           ||||||||||| || || || || ||||||||||| | |||||| ||||||||||
Sbjct: 196 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 142



to top

>emb|Z71973.1|FPPPCB F.pringlei ppcB gene (partial)
          Length = 714

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                  
Query: 286 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
           ||||||||||| || || || || ||||||||||| | |||||| ||||||||||
Sbjct: 196 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 142



to top

>emb|Z25853.1|FAPHOCAR F.australasica mRNA for phosphoenolpyruvate carboxylase
          Length = 3169

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||| || || || || || |||||||| | |||||||||||||||||
Sbjct: 2928 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 2874



to top

>emb|X95861.1|VPPPC1 Vanilla planifolia mRNA for phosphoenolpyruvate carboxylase
          Length = 1089

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 310  cccttcatggtgaggatgagcgtgtcctccagccc 344
            |||||||| || |||||||| ||||||||||||||
Sbjct: 1079 cccttcattgtaaggatgagggtgtcctccagccc 1045



to top

>emb|X91631.1|AEPPCGENE A.eburneum mRNA for phosphoenolpyruvate carboxylase (aerial root)
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                              
Query: 456 gatccgcttcagcgtgtaggcctggcacacgttcagggtggtgatgtaggg 506
           |||||||||||| |||||||| ||||| || ||||| || || ||||||||
Sbjct: 930 gatccgcttcagtgtgtaggcttggcaaacattcagagttgttatgtaggg 880



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 300  ggcggcgatgcccttcatggt 320
            |||||||||||||||||||||
Sbjct: 1068 ggcggcgatgcccttcatggt 1048



to top

>emb|X64143.2|FTPPCA Flaveria trinervia ppcA1 gene for phosphoenolpyruvate carboxylase
          Length = 9015

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||| || || || || || |||||||| | |||||||||||||||||
Sbjct: 8291 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 8237



to top

>emb|X61304.1|FTPEPC F.trinervia mRNA for phosphoenolpyruvate carboxylase
          Length = 3174

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||| || || || || || |||||||| | |||||||||||||||||
Sbjct: 2938 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 2884



to top

>emb|AJ312675.1|PLO312675 Pyrrosia longifolia partial mRNA for phosphoenolpyruvate carboxylase
            (pepc gene), isoform 1
          Length = 1071

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 307  atgcccttcatggtgaggatgag 329
            |||||||||||||||||||||||
Sbjct: 1064 atgcccttcatggtgaggatgag 1042



to top

>emb|AJ532902.1|ATH532902 Arabidopsis thaliana mRNA for phosphoenolpyruvate carboxylase (ppc2
            gene)
          Length = 2892

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
            ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || |||
Sbjct: 2885 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 2826

                       
Query: 346  ggcgcgtattc 356
            || ||||||||
Sbjct: 2825 ggtgcgtattc 2815



to top

>emb|AJ417435.1|CSA417435 Cucumis sativus partial mRNA for phosphoenolpyruvate carboxylase
           (pepc1 gene)
          Length = 932

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 286 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
           ||||||||||| || || || || ||||||||||| | ||| || |||||||| ||||| 
Sbjct: 590 gtgttctgcattccagcagcaatacccttcatggtcaagatcagggtgtcctctagccca 531

                      
Query: 346 ggcgcgtattc 356
           || ||||||||
Sbjct: 530 ggtgcgtattc 520



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                              
Query: 469 gtgtaggcctggcacacgttcagggtggtgatgta 503
           |||||||| |||||||||||||| || ||||||||
Sbjct: 404 gtgtaggcttggcacacgttcagagttgtgatgta 370



to top

>emb|AJ286750.1|SRO286750 Sesbania rostrata mRNA for phosphoenolpyruvate carboxylase (pepc
            gene)
          Length = 3344

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||||||||| || || || |||||||| ||||| ||||| ||||| ||||
Sbjct: 3012 gtgttctgcatgccagctgcaatacccttcatagtgagaatgagggtgtcttcca 2958



to top

>emb|AJ231297.1|PQAJ1297 Preissia quadrata partial mRNA for phosphoenolpyruvate carboxylase,
            clone pPQ29.2
          Length = 1104

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 338
            |||||||| || ||||| |||||||||||||  ||||| ||||||||
Sbjct: 1091 tgcatgccagcagcgatacccttcatggtgataatgagagtgtcctc 1045



to top

>emb|AJ231281.1|BSAJ1281 Brachythecium salebrosum partial mRNA for phosphoenolpyruvate
            carboxylase, clone pBS26.3
          Length = 1116

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                               
Query: 292  tgcatgccggcggcgatgcccttcatggtgaggat 326
            |||||||| || ||||||||||||||||| |||||
Sbjct: 1103 tgcatgcccgcagcgatgcccttcatggtaaggat 1069



to top

>emb|AJ011302.1|VFA011302 Vicia faba mRNA for phosphoenolpyruvate-carboxylase, pepc1 isoform
          Length = 3152

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||||||||| || || || ||||||||||| || ||||| ||||| ||||
Sbjct: 2911 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 2857



to top

>emb|BX908769.7| Zebrafish DNA sequence from clone DKEY-78I1 in linkage group 13,
            complete sequence
          Length = 68094

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                       
Query: 115  tatacattattttcacgattttatttt 141
            ||||||||||||||| |||||||||||
Sbjct: 5178 tatacattattttcaagattttatttt 5152



to top

>emb|BX324226.16| Zebrafish DNA sequence from clone DKEY-202B10 in linkage group 5,
             complete sequence
          Length = 121419

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 115   tatacattattttcacgattttatttt 141
             ||||||||||||||| |||||||||||
Sbjct: 30366 tatacattattttcaagattttatttt 30392



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 115  tatacattattttcacgattttatttt 141
            ||||||||||||||| |||||||||||
Sbjct: 8953 tatacattattttcaagattttatttt 8979



to top

>emb|BX510990.32| Zebrafish DNA sequence from clone CH211-67F13 in linkage group 13,
              complete sequence
          Length = 210138

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 132    attttatttttatttctcaaaac 154
              |||||||||||||||||||||||
Sbjct: 128511 attttatttttatttctcaaaac 128489



to top

>gb|AC007087.7| Arabidopsis thaliana chromosome 2 clone F14N22 map mi551, complete
             sequence
          Length = 96685

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                         
Query: 286   gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
             ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || |||
Sbjct: 51278 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 51219

                        
Query: 346   ggcgcgtattc 356
             || ||||||||
Sbjct: 51218 ggtgcgtattc 51208



to top

>gb|AC104533.3| Homo sapiens chromosome 19 clone LLNLR-276C7, complete sequence
          Length = 32074

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 131   gattttatttttatttctcaaaa 153
             |||||||||||||||||||||||
Sbjct: 24079 gattttatttttatttctcaaaa 24057



to top

>emb|BX001025.23| Zebrafish DNA sequence from clone CH211-240D20, complete sequence
          Length = 179475

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 115   tatacattattttcacgattttatttt 141
             ||||||||||||||| |||||||||||
Sbjct: 38237 tatacattattttcaagattttatttt 38263



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 118   acattattttcacgattttatttt 141
             |||||||||||| |||||||||||
Sbjct: 20591 acattattttcaagattttatttt 20614



to top

>emb|BX511164.11| Zebrafish DNA sequence from clone DKEY-63J1 in linkage group 19, complete
              sequence
          Length = 214001

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 115    tatacattattttcacgattttatttt 141
              ||||||||||||||| |||||||||||
Sbjct: 174758 tatacattattttcaagattttatttt 174732



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                         
Query: 115    tatacattattttcacgattttatttt 141
              ||||||||||||||| |||||||||||
Sbjct: 163265 tatacattattttcaagattttatttt 163239



to top

>gb|AC004597.1|AC004597 Homo sapiens chromosome 19, cosmid F20722, complete sequence
          Length = 43310

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 131  gattttatttttatttctcaaaa 153
            |||||||||||||||||||||||
Sbjct: 7233 gattttatttttatttctcaaaa 7211



to top

>emb|BX248115.12| Zebrafish DNA sequence from clone CH211-208K15 in linkage group 16,
              complete sequence
          Length = 211852

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 132    attttatttttatttctcaaaac 154
              |||||||||||||||||||||||
Sbjct: 127950 attttatttttatttctcaaaac 127972



to top

>gb|AF288382.1|AF288382 Phaseolus vulgaris phosphoenolpyruvate carboxylase mRNA, complete cds
          Length = 3289

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||||||||| || || || |||||||| ||||| ||||| ||||| ||||
Sbjct: 2974 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagggtgtcttcca 2920



to top

>emb|BX821882.1|CNS0A9A6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL81ZG02 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 582

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 286 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
           ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || |||
Sbjct: 444 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 385

                      
Query: 346 ggcgcgtattc 356
           || ||||||||
Sbjct: 384 ggtgcgtattc 374



to top

>gb|AF248079.1|AF248079 Flaveria trinervia phosphoenolpyruvate carboxylase (ppcB) mRNA,
            complete cds
          Length = 3266

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            ||||||||||| || || || || ||||||||||| | |||||| ||||||||||
Sbjct: 2991 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 2937



to top

>emb|BX255962.9| Zebrafish DNA sequence from clone CH211-269C21 in linkage group 25,
             complete sequence
          Length = 151830

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 132   attttatttttatttctcaaaac 154
             |||||||||||||||||||||||
Sbjct: 27895 attttatttttatttctcaaaac 27873



to top

>emb|BX510916.7| Zebrafish DNA sequence from clone DKEY-208B17 in linkage group 5,
              complete sequence
          Length = 174866

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 115    tatacattattttcacgattttatttt 141
              ||||||||||||||| |||||||||||
Sbjct: 171266 tatacattattttcaagattttatttt 171292



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 115    tatacattattttcacgattttatttt 141
              ||||||||||||||| |||||||||||
Sbjct: 160716 tatacattattttcaagattttatttt 160742



to top

>emb|BX005129.6| Zebrafish DNA sequence from clone CH211-241D24 in linkage group 6,
             complete sequence
          Length = 166885

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 115   tatacattattttcacgattttatttt 141
             ||||||||||||||| |||||||||||
Sbjct: 70950 tatacattattttcaagattttatttt 70976



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 115   tatacattattttcacgattttatttt 141
             ||||||||||||||| |||||||||||
Sbjct: 59578 tatacattattttcaagattttatttt 59604



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 115   tatacattattttcacgattttatttt 141
             ||||||||||||||| |||||||||||
Sbjct: 39197 tatacattattttcaagattttatttt 39223



 Score = 46.1 bits (23), Expect = 0.14
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                        
Query: 115   tatacattattttcacgattttatttt 141
             ||||||||||||||| |||||||||||
Sbjct: 28805 tatacattattttcaagattttatttt 28831



to top

>dbj|AB097087.1| Glycine max GmPEPC15 gene for phosphoenolpyruvate carboxylase,
            complete cds
          Length = 7205

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||||||||| || || || |||||||| ||||| ||||| ||||| ||||
Sbjct: 7083 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagtgtgtcttcca 7029



to top

>emb|BX957233.8| Zebrafish DNA sequence from clone DKEY-224H10 in linkage group 18,
             complete sequence
          Length = 68884

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 132   attttatttttatttctcaaaac 154
             |||||||||||||||||||||||
Sbjct: 56889 attttatttttatttctcaaaac 56867



to top

>gb|AF145301.1|AF145301 Arabidopsis thaliana 14-3-3 protein GF14 mu (GRF9) gene, complete
           cds
          Length = 3604

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                       
Query: 286 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 345
           ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || |||
Sbjct: 235 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 176

                      
Query: 346 ggcgcgtattc 356
           || ||||||||
Sbjct: 175 ggtgcgtattc 165



to top

>gb|AF135371.1|AF135371 Lotus corniculatus phosphoenol pyruvate carboxylase mRNA, complete
            cds
          Length = 3184

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||||||||| || || || |||||||||||||| || || ||||| ||||
Sbjct: 2936 gtgttctgcatgccagcagcaattcccttcatggtgagaatcagggtgtcttcca 2882



to top

>emb|AM235211.1| Lupinus luteus mRNA for phosphoenolpyruvate carboxylase (PEPC1 gene),
            clone LUP1
          Length = 2904

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 310  cccttcatggtgaggatgagcgtgtcctcca 340
            |||||||||||||||||||| ||||| ||||
Sbjct: 2873 cccttcatggtgaggatgagggtgtcttcca 2843



to top

>dbj|D13998.1|SOYPEPC Glycine max gmppc1 mRNA for phosphoenolpyruvate carboxylase, complete
            cds
          Length = 3048

 Score = 46.1 bits (23), Expect = 0.14
 Identities = 47/55 (85%)
 Strand = Plus / Minus

                                                                   
Query: 286  gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 340
            |||||||||||||| || || || |||||||| ||||| ||||| ||||| ||||
Sbjct: 2924 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagtgtgtcttcca 2870


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,336,015
Number of Sequences: 3902068
Number of extensions: 7336015
Number of successful extensions: 368390
Number of sequences better than 10.0: 505
Number of HSP's better than 10.0 without gapping: 506
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 365042
Number of HSP's gapped (non-prelim): 3320
length of query: 654
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 631
effective length of database: 17,143,297,704
effective search space: 10817420851224
effective search space used: 10817420851224
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top