>dbj|AB193551.1| Triticum aestivum WP5CS mRNA for delta1-pyrroline-5-carboxylate
            synthetase, complete cds
          Length = 2405

 Score = 46.1 bits (23), Expect = 0.064
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                           
Query: 186  attataaccctggaaatccggagcctccaagctcatacaaactgatc 232
            |||||||| | ||| | ||| |||||||||||||||||||| |||||
Sbjct: 2404 attataacaccggagagccgaagcctccaagctcatacaaattgatc 2358

>gb|AC090437.62| Mus musculus strain C57BL/6J clone rp23-11f20 map 6, complete sequence
          Length = 227127

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 27     attagatactctggccacca 46
              ||||||||||||||||||||
Sbjct: 102898 attagatactctggccacca 102879

>gb|AC124968.36| Medicago truncatula clone mth2-15e21, complete sequence
          Length = 106968

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    agcaattgcagatgctgctg 105
             ||||||||||||||||||||
Sbjct: 72316 agcaattgcagatgctgctg 72297

>gb|AC146753.1| Gallus gallus BAC clone CH261-4N19 from chromosome unknown, complete
              sequence
          Length = 231376

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 54     taaagtataaaagcaaccgttaca 77
              |||||||||||||||||| |||||
Sbjct: 126148 taaagtataaaagcaaccattaca 126171

>emb|AL589876.11| Mouse DNA sequence from clone RP23-117O11 on chromosome 2, complete
              sequence
          Length = 221782

 Score = 40.1 bits (20), Expect = 3.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 27     attagatactctggccacca 46
              ||||||||||||||||||||
Sbjct: 178495 attagatactctggccacca 178514


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,242,394
Number of Sequences: 3902068
Number of extensions: 2242394
Number of successful extensions: 157195
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 157190
Number of HSP's gapped (non-prelim): 5
length of query: 300
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 278
effective length of database: 17,147,199,772
effective search space: 4766921536616
effective search space used: 4766921536616
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)