ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah62f01
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_474131.1| Oryza sativa (japonica cultivar-group), predic... 141 2e-30
2dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
3dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
4dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 2e-30
5dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA ... 141 2e-30
6dbj|AB020961.1| Zea mays mRNA for cysteine protease component of... 135 2e-28
7gb|AY103676.1| Zea mays PCO102242 mRNA sequence 125 1e-25
8gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) ... 109 9e-21
9dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 98 3e-17
10emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clon... 98 3e-17
11emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4,... 98 3e-17
12gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence 94 5e-16
13gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4... 94 5e-16
14gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4... 94 5e-16
15gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4... 94 5e-16
16gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4... 94 5e-16
17gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4... 94 5e-16
18gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4... 94 5e-16
19gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.... 94 5e-16
20gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.... 94 5e-16
21gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.... 94 5e-16
22gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.... 94 5e-16
23gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4... 94 5e-16
24gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4... 94 5e-16
25gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4... 94 5e-16
26gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4... 94 5e-16
27gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4... 94 5e-16
28gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4... 94 5e-16
29gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4... 94 5e-16
30gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4... 94 5e-16
31gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 g... 94 5e-16
32gb|AY973616.1| Manihot esculenta cysteine protease CP1 mRNA, com... 94 5e-16
33emb|Z99954.1|PVZ99954 Phaseolus vulgaris Moldavian encoding cyst... 88 3e-14
34emb|AJ007579.1|RNI7579 Ribes nigrum mRNA for putative cysteine p... 66 1e-07
35gb|AF133838.1| Sandersonia aurantiaca papain-like cysteine prote... 58 3e-05
36gb|U41902.1|PMU41902 Pseudosuga menziesii cysteine protease pseu... 58 3e-05
37ref|XM_474291.1| Oryza sativa (japonica cultivar-group), predic... 56 1e-04
38emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4,... 56 1e-04
39gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete se... 56 1e-04
40gb|AF366556.1| Oryza sativa saline responsive OSSRIII protein mR... 56 1e-04
41gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-2... 56 1e-04
42dbj|AB098627.1| Daucus carota DcCysP4 mRNA for cysteine protease... 56 1e-04
43dbj|AB098624.1| Daucus carota DcCysP1 mRNA for cysteine protease... 56 1e-04
44dbj|AK109371.2| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
45dbj|AK073373.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
46emb|AL732346.2| Oryza sativa genomic DNA, chromosome 4, BAC clon... 56 1e-04
47dbj|D90407.1|RICOZB Oryza sativa (japonica cultivar-group) mRNA ... 56 1e-04
48dbj|AB252653.1| Platycodon grandiflorus PgCP1 mRNA for cysteine ... 54 5e-04
49dbj|AK099358.1| Oryza sativa (japonica cultivar-group) cDNA clon... 52 0.002
50emb|AJ003137.1|LEAJ3137 Lycopersicon esculentum mRNA for cystein... 48 0.028
51emb|AJ844007.1| Plantago major partial mRNA for cysteine proteas... 48 0.028
52gb|AF172856.1|AF172856 Lycopersicon esculentum cysteine protease... 48 0.028
53gb|M21444.1|TOMLTITP Lycopersicon esculentum low-temperature-ind... 48 0.028
54dbj|AB098628.1| Daucus carota DcCysP5 mRNA for cysteine protease... 46 0.11
55gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome... 46 0.11
56emb|X66061.1|PSTHIOL P.sativum mRNA for thiolprotease 44 0.43
57gb|AY700588.1| Zingiber officinale cysteine protease gp3b mRNA, ... 42 1.7
58gb|AY700587.1| Zingiber officinale cysteine protease gp3a mRNA, ... 42 1.7
59emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in... 42 1.7
60emb|AL596164.1| Listeria innocua Clip11262 complete genome, segm... 42 1.7
61gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosom... 40 6.8
62ref|XM_424550.1| PREDICTED: Gallus gallus similar to Ig V-region... 40 6.8
63ref|XM_422997.1| PREDICTED: Gallus gallus similar to Ig V-region... 40 6.8
64gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds 40 6.8
65gb|AC123071.3| Mus musculus BAC clone RP23-70P8 from chromosome ... 40 6.8
66gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, com... 40 6.8
67gb|AC113999.3| Mus musculus BAC clone RP23-148D9 from 16, comple... 40 6.8
68emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitoc... 40 6.8
69emb|Z98036.1|HS187N21 Human DNA sequence from clone RP1-187N21 o... 40 6.8
70gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1... 40 6.8
71emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on ch... 40 6.8
72emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chro... 40 6.8
73emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for... 40 6.8
74gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion ori... 40 6.8
75gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, com... 40 6.8
76gb|AC154339.2| Mus musculus BAC clone RP23-248O15 from chromosom... 40 6.8
77gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome... 40 6.8
78gb|AF493427.1| Gallus gallus Ig V-region-like antigen precursor,... 40 6.8
79gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, com... 40 6.8
80gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:663983... 40 6.8
81gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete... 40 6.8
82gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complet... 40 6.8
83gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, compl... 40 6.8
84gb|AY106278.1| Zea mays PCO137999 mRNA sequence 40 6.8
85gb|AC147250.4| Mus musculus BAC clone RP24-109P17 from 13, compl... 40 6.8
86gb|M61861.1|CHKBGB Chicken B-G mRNA, complete cds 40 6.8
87gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene... 40 6.8 
>ref|XM_474131.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1377

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1331 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1272

                                                                        
Query: 403  cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
            || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 1271 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1212

                                                   
Query: 463  tcgcagcaggtagcaccctcaagtgggcaacagccccag 501
            ||||||||||| || ||||| |||||||| |||||||||
Sbjct: 1211 tcgcagcaggtggcgccctcgagtgggcagcagccccag 1173
to top
>dbj|AK098910.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002H09, full
            insert sequence
          Length = 1753

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337

                                                                        
Query: 403  cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
            || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 1336 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1277

                                                   
Query: 463  tcgcagcaggtagcaccctcaagtgggcaacagccccag 501
            ||||||||||| || ||||| |||||||| |||||||||
Sbjct: 1276 tcgcagcaggtggcgccctcgagtgggcagcagccccag 1238



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                        
Query: 73   agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
            |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 1667 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1610

                    
Query: 133  ccgatttt 140
            ||| ||||
Sbjct: 1609 ccgttttt 1602
to top
>dbj|AK071913.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013065M08, full
            insert sequence
          Length = 1774

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1396 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1337

                                                                        
Query: 403  cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
            || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 1336 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1277

                                                   
Query: 463  tcgcagcaggtagcaccctcaagtgggcaacagccccag 501
            ||||||||||| || ||||| |||||||| |||||||||
Sbjct: 1276 tcgcagcaggtggcgccctcgagtgggcagcagccccag 1238
to top
>dbj|AK061729.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-B12, full
           insert sequence
          Length = 976

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                       
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
           ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 598 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 539

                                                                       
Query: 403 cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
           || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 538 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 479

                                                  
Query: 463 tcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||||||||||| || ||||| |||||||| |||||||||
Sbjct: 478 tcgcagcaggtggcgccctcgagtgggcagcagccccag 440



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                       
Query: 73  agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
           |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 869 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 812

                   
Query: 133 ccgatttt 140
           ||| ||||
Sbjct: 811 ccgttttt 804
to top
>dbj|D90406.1|RICOZA Oryza sativa (japonica cultivar-group) mRNA for oryzain alpha,
            complete cds
          Length = 1929

 Score =  141 bits (71), Expect = 2e-30
 Identities = 137/159 (86%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttggccgcgagg 402
            ||||| |||||||||||| || |||||||||||| |||||| |||||||| |||  ||||
Sbjct: 1376 ggctttgccagggtacgcttcagagccttcactgccagtggactgtccttagccatgagg 1317

                                                                        
Query: 403  cacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatca 462
            || ||||||||||     ||||||||||| || |  ||||||||||||||||||||||||
Sbjct: 1316 caggttccctgctgaacattgcagatggggtactcgtgagggcagcagctgtagtgatca 1257

                                                   
Query: 463  tcgcagcaggtagcaccctcaagtgggcaacagccccag 501
            ||||||||||| || ||||| |||||||| |||||||||
Sbjct: 1256 tcgcagcaggtggcgccctcgagtgggcagcagccccag 1218



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Minus

                                                                        
Query: 73   agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
            |||||| ||||||||||||  || || ||||||||||||  ||||||||| | || ||||
Sbjct: 1647 agctgaattttacatatac--attcagaagcaaatttggcagttctgtaaccaactgaac 1590

                    
Query: 133  ccgatttt 140
            ||| ||||
Sbjct: 1589 ccgttttt 1582
to top
>dbj|AB020961.1| Zea mays mRNA for cysteine protease component of protease-inhibitor
            complex, complete cds
          Length = 1828

 Score =  135 bits (68), Expect = 2e-28
 Identities = 139/162 (85%), Gaps = 3/162 (1%)
 Strand = Plus / Minus

                                                                        
Query: 343  ggcttggccagggtacgcctctgagccttcactga---cagtgggctgtccttggccgcg 399
            |||||||||||||| ||| ||  ||||||||||||   |||||||||||||||| ||  |
Sbjct: 1452 ggcttggccagggttcgcttcgtagccttcactgaaagcagtgggctgtccttgcccatg 1393

                                                                        
Query: 400  aggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtga 459
            ||||| ||||||||| ||  |||||||||||| |||| ||| ||||||||||||||||||
Sbjct: 1392 aggcaggttccctgcctgacgttgcagatggggtagtcatgggggcagcagctgtagtga 1333

                                                      
Query: 460  tcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
            || ||||||||||| || ||||| || ||||| |||||||||
Sbjct: 1332 tcgtcgcagcaggtggcgccctcgagcgggcagcagccccag 1291
to top
>gb|AY103676.1| Zea mays PCO102242 mRNA sequence
          Length = 1878

 Score =  125 bits (63), Expect = 1e-25
 Identities = 111/127 (87%)
 Strand = Plus / Minus

                                                                        
Query: 375  tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatgggata 434
            ||||||||||||||||||| ||  |||||| ||||||||| ||  |||||||||||| ||
Sbjct: 1453 tgacagtgggctgtccttgcccatgaggcaggttccctgcctgacgttgcagatggggta 1394

                                                                        
Query: 435  gttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaaca 494
            || ||| |||||||||||||||||||| ||||||||||| || ||||| || ||||| ||
Sbjct: 1393 gtcatgggggcagcagctgtagtgatcgtcgcagcaggtggcgccctcgagcgggcagca 1334

                   
Query: 495  gccccag 501
            |||||||
Sbjct: 1333 gccccag 1327
to top
>gb|AF019147.1|AF019147 Zea mays cysteine proteinase Mir3 (mir3) mRNA, complete cds
          Length = 1830

 Score =  109 bits (55), Expect = 9e-21
 Identities = 109/127 (85%)
 Strand = Plus / Minus

                                                                        
Query: 375  tgacagtgggctgtccttggccgcgaggcacgttccctgcttggtgttgcagatgggata 434
            ||||||||||||||||||| ||  |||  | ||||||||| ||  |||||||||||| ||
Sbjct: 1418 tgacagtgggctgtccttgcccatgagcgaggttccctgcctgacgttgcagatggggta 1359

                                                                        
Query: 435  gttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaaca 494
            || ||| |||||||||||||||||||| ||||||||||| || ||||| || ||||| ||
Sbjct: 1358 gtcatgggggcagcagctgtagtgatcgtcgcagcaggtggcgccctcgagcgggcagca 1299

                   
Query: 495  gccccag 501
            |||||||
Sbjct: 1298 gccccag 1292
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 73/81 (90%)
 Strand = Plus / Plus

                                                                            
Query: 421      ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 480
                ||||||||||| || |  ||||||||||||||||||||||||||||||||||| || |||
Sbjct: 33157777 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 33157836

                                     
Query: 481      tcaagtgggcaacagccccag 501
                || |||||||| |||||||||
Sbjct: 33157837 tcgagtgggcagcagccccag 33157857



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 343      ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 392
                ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 33157603 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 33157652



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                            
Query: 417      ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
                |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 34207822 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 34207881

                                        
Query: 477      accctcaagtgggcaacagcccca 500
                ||| |||| |||||||||||||||
Sbjct: 34207882 accttcaactgggcaacagcccca 34207905



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                            
Query: 73       agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
                |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 33157332 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 33157389

                        
Query: 133      ccgatttt 140
                ||| ||||
Sbjct: 33157390 ccgttttt 33157397
to top
>emb|AL442007.3| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0212B02, complete
             sequence
          Length = 118971

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 73/81 (90%)
 Strand = Plus / Plus

                                                                         
Query: 421   ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 480
             ||||||||||| || |  ||||||||||||||||||||||||||||||||||| || |||
Sbjct: 48170 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 48229

                                  
Query: 481   tcaagtgggcaacagccccag 501
             || |||||||| |||||||||
Sbjct: 48230 tcgagtgggcagcagccccag 48250



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 343   ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 392
             ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 47996 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 48045



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                         
Query: 73    agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
             |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 47725 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 47782

                     
Query: 133   ccgatttt 140
             ||| ||||
Sbjct: 47783 ccgttttt 47790
to top
>emb|AL606692.3|OSJN00105 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0059K02,
             complete sequence
          Length = 165745

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 73/81 (90%)
 Strand = Plus / Plus

                                                                         
Query: 421   ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 480
             ||||||||||| || |  ||||||||||||||||||||||||||||||||||| || |||
Sbjct: 40427 ttgcagatggggtactcgtgagggcagcagctgtagtgatcatcgcagcaggtggcgccc 40486

                                  
Query: 481   tcaagtgggcaacagccccag 501
             || |||||||| |||||||||
Sbjct: 40487 tcgagtgggcagcagccccag 40507



 Score = 60.0 bits (30), Expect = 7e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 343   ggcttggccagggtacgcctctgagccttcactgacagtgggctgtcctt 392
             ||||| |||||||||||| || |||||||||||| |||||| ||||||||
Sbjct: 40253 ggctttgccagggtacgcttcagagccttcactgccagtggactgtcctt 40302



 Score = 42.1 bits (21), Expect = 1.7
 Identities = 57/68 (83%), Gaps = 2/68 (2%)
 Strand = Plus / Plus

                                                                         
Query: 73    agctgagttttacatatacatatgcaaaagcaaatttggtggttctgtaaacgaccgaac 132
             |||||| ||||||||||||||   || ||||||||||||  ||||||||| | || ||||
Sbjct: 39982 agctgaattttacatatacatt--cagaagcaaatttggcagttctgtaaccaactgaac 40039

                     
Query: 133   ccgatttt 140
             ||| ||||
Sbjct: 40040 ccgttttt 40047
to top
>gb|DQ430402.1| Sorghum propinquum locus pSHR0111.4 genomic sequence
          Length = 718

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 46.1 bits (23), Expect = 0.11
 Identities = 36/39 (92%), Gaps = 1/39 (2%)
 Strand = Plus / Minus

                                                  
Query: 73  agctgagttttacatatacatatgcaaaagcaaatttgg 111
           |||||| |||||||| || ||||||||||||||||||||
Sbjct: 561 agctgaattttacat-tatatatgcaaaagcaaatttgg 524
to top
>gb|DQ430401.1| Sorghum bicolor voucher PI585454 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430400.1| Sorghum bicolor voucher PI267539 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430399.1| Sorghum bicolor voucher PI267408 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430398.1| Sorghum bicolor voucher PI221607 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430397.1| Sorghum bicolor voucher PI152702 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430396.1| Sorghum bicolor voucher NSL92371 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430395.1| Sorghum bicolor voucher NSL87902b locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430394.1| Sorghum bicolor voucher NSL87902a locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430393.1| Sorghum bicolor voucher NSL87666b locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430392.1| Sorghum bicolor voucher NSL87666a locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430391.1| Sorghum bicolor voucher NSL77217 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430390.1| Sorghum bicolor voucher NSL77034 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430389.1| Sorghum bicolor voucher NSL56174 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430388.1| Sorghum bicolor voucher NSL56003 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430387.1| Sorghum bicolor voucher NSL55243 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430386.1| Sorghum bicolor voucher NSL51365 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430385.1| Sorghum bicolor voucher NSL51030 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430384.1| Sorghum bicolor voucher NSL50875 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|DQ430383.1| Sorghum bicolor voucher BTx623 locus pSHR0111.4 genomic sequence
          Length = 715

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 89/103 (86%)
 Strand = Plus / Minus

                                                                       
Query: 399 gaggcacgttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtg 458
           |||||| |||||||||| |  |||||||||||| |||| ||| |||||||||||||||||
Sbjct: 124 gaggcaggttccctgctggacgttgcagatggggtagtcatgggggcagcagctgtagtg 65

                                                      
Query: 459 atcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
           ||| || |||||||| || ||||| || ||||| |||||||||
Sbjct: 64  atcgtcacagcaggtggcgccctcgagcgggcagcagccccag 22



 Score = 69.9 bits (35), Expect = 8e-09
 Identities = 47/51 (92%)
 Strand = Plus / Minus

                                                              
Query: 343 ggcttggccagggtacgcctctgagccttcactgacagtgggctgtccttg 393
           |||||||||||||| ||| ||  ||||||||||||||||||||||||||||
Sbjct: 285 ggcttggccagggtgcgcttcgtagccttcactgacagtgggctgtccttg 235



 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 92  atatgcaaaagcaaatttgg 111
           ||||||||||||||||||||
Sbjct: 543 atatgcaaaagcaaatttgg 524
to top
>gb|AY973616.1| Manihot esculenta cysteine protease CP1 mRNA, complete cds
          Length = 1831

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Minus

                                                                        
Query: 406  gttccctgcttggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcg 465
            |||||||| ||  |||||||||||||||||| ||| ||||||||||| || || || || 
Sbjct: 1336 gttccctggttaatgttgcagatgggatagtcatgtgggcagcagctataatggtcttca 1277

                                               
Query: 466  cagcaggtagcaccctcaagtgggcaacagcccca 500
            |||||||||||||||||||||||||| || |||||
Sbjct: 1276 cagcaggtagcaccctcaagtgggcagcatcccca 1242
to top
>emb|Z99954.1|PVZ99954 Phaseolus vulgaris Moldavian encoding cysteine proteinase precursor
            (clone cp71)
          Length = 1680

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                        
Query: 418  gtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagca 477
            ||||||||||||||||||| ||| |||||||| |||||||| ||||| ||||||||||||
Sbjct: 1260 gtgttgcagatgggatagtcatgggggcagcaactgtagtggtcatcacagcaggtagca 1201

                    
Query: 478  ccctcaag 485
            || |||||
Sbjct: 1200 ccttcaag 1193
to top
>emb|AJ007579.1|RNI7579 Ribes nigrum mRNA for putative cysteine proteinase, partial
          Length = 995

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 69/81 (85%)
 Strand = Plus / Minus

                                                                       
Query: 420 gttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcacc 479
           ||||||||||||||| | ||| |||||||| ||||| || ||||| ||||| || ||| |
Sbjct: 599 gttgcagatgggatactcatgtgggcagcaactgtaatggtcatcacagcaagtggcagc 540

                                
Query: 480 ctcaagtgggcaacagcccca 500
           ||| ||||||||||| |||||
Sbjct: 539 ctcgagtgggcaacatcccca 519
to top
>gb|AF133838.1| Sandersonia aurantiaca papain-like cysteine protease (PRT15) mRNA,
           partial cds
          Length = 1456

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 421 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 480
           |||||||| ||| ||| ||| |||||||||||  |||||||||| |||||||| ||||| 
Sbjct: 989 ttgcagataggaaagtcatgggggcagcagctagagtgatcatcacagcaggtggcacct 930

                
Query: 481 tcaag 485
           |||||
Sbjct: 929 tcaag 925
to top
>gb|U41902.1|PMU41902 Pseudosuga menziesii cysteine protease pseudotzain (PM33cysP) mRNA,
            complete cds
          Length = 1882

 Score = 58.0 bits (29), Expect = 3e-05
 Identities = 32/33 (96%)
 Strand = Plus / Minus

                                             
Query: 441  agggcagcagctgtagtgatcatcgcagcaggt 473
            ||||||||||||||||||||| |||||||||||
Sbjct: 1398 agggcagcagctgtagtgatcgtcgcagcaggt 1366
to top
>ref|XM_474291.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1401

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 417  ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
            |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 1314 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1255

                                    
Query: 477  accctcaagtgggcaacagcccca 500
            ||| |||| |||||||||||||||
Sbjct: 1254 accttcaactgggcaacagcccca 1231
to top
>emb|AL606619.3|OSJN00032 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0043A12,
              complete sequence
          Length = 190432

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                          
Query: 417    ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
              |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 119204 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 119263

                                      
Query: 477    accctcaagtgggcaacagcccca 500
              ||| |||| |||||||||||||||
Sbjct: 119264 accttcaactgggcaacagcccca 119287
to top
>gb|AC148098.3| Medicago truncatula clone mth2-15b16, complete sequence
          Length = 97953

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 438   atgagggcagcagctgtagtgatcatcgcagcaggtagca 477
             |||||||||||| |||||||||||||| ||||| ||||||
Sbjct: 70783 atgagggcagcaactgtagtgatcatcacagcaagtagca 70822
to top
>gb|AF366556.1| Oryza sativa saline responsive OSSRIII protein mRNA, partial cds
          Length = 368

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                       
Query: 417 ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
           |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 287 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 228

                                   
Query: 477 accctcaagtgggcaacagcccca 500
           ||| |||| |||||||||||||||
Sbjct: 227 accttcaactgggcaacagcccca 204
to top
>gb|AC150207.2| Medicago truncatula chromosome 2 BAC clone mte1-29a5, complete sequence
          Length = 124676

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 438   atgagggcagcagctgtagtgatcatcgcagcaggtagca 477
             |||||||||||| |||||||||||||| ||||| ||||||
Sbjct: 82072 atgagggcagcaactgtagtgatcatcacagcaagtagca 82111
to top
>dbj|AB098627.1| Daucus carota DcCysP4 mRNA for cysteine protease, complete cds
          Length = 1668

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 442  gggcagcagctgtagtgatcatcgcagcaggt 473
            |||||||||||| |||||||||||||||||||
Sbjct: 1252 gggcagcagctggagtgatcatcgcagcaggt 1221
to top
>dbj|AB098624.1| Daucus carota DcCysP1 mRNA for cysteine protease, complete cds
          Length = 1768

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 31/32 (96%)
 Strand = Plus / Minus

                                            
Query: 442  gggcagcagctgtagtgatcatcgcagcaggt 473
            ||||||||||||||||||||||| ||||||||
Sbjct: 1395 gggcagcagctgtagtgatcatcacagcaggt 1364
to top
>dbj|AK109371.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-207-E09, full
            insert sequence
          Length = 1766

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 417  ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
            |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 1418 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1359

                                    
Query: 477  accctcaagtgggcaacagcccca 500
            ||| |||| |||||||||||||||
Sbjct: 1358 accttcaactgggcaacagcccca 1335
to top
>dbj|AK073373.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033027D09, full
            insert sequence
          Length = 1753

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 417  ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
            |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 1419 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1360

                                    
Query: 477  accctcaagtgggcaacagcccca 500
            ||| |||| |||||||||||||||
Sbjct: 1359 accttcaactgggcaacagcccca 1336
to top
>emb|AL732346.2| Oryza sativa genomic DNA, chromosome 4, BAC clone: H0818H01, complete
             sequence
          Length = 101125

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Plus

                                                                         
Query: 417   ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
             |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 58524 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 58583

                                     
Query: 477   accctcaagtgggcaacagcccca 500
             ||| |||| |||||||||||||||
Sbjct: 58584 accttcaactgggcaacagcccca 58607
to top
>dbj|D90407.1|RICOZB Oryza sativa (japonica cultivar-group) mRNA for oryzain beta,
            complete cds
          Length = 1675

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 70/84 (83%)
 Strand = Plus / Minus

                                                                        
Query: 417  ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
            |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 1330 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1271

                                    
Query: 477  accctcaagtgggcaacagcccca 500
            ||| |||| |||||||||||||||
Sbjct: 1270 accttcaactgggcaacagcccca 1247
to top
>dbj|AB252653.1| Platycodon grandiflorus PgCP1 mRNA for cysteine proteinase, complete
            cds
          Length = 1676

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                       
Query: 442  gggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagcccca 500
            |||||||| || || |||||||| |||||||| ||||| ||||||||||| || |||||
Sbjct: 1273 gggcagcaactataatgatcatcacagcaggtggcaccgtcaagtgggcagcatcccca 1215
to top
>dbj|AK099358.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044I21, full
            insert sequence
          Length = 1742

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                        
Query: 417  ggtgttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagc 476
            |||||||||||  || |||| | | ||||||||||||   ||||| | ||||||||| ||
Sbjct: 1394 ggtgttgcagacagggtagtcaggcgggcagcagctggcatgatccttgcagcaggttgc 1335

                                  
Query: 477  accctcaagtgggcaacagccc 498
            ||| |||| |||||||||||||
Sbjct: 1334 accttcaactgggcaacagccc 1313
to top
>emb|AJ003137.1|LEAJ3137 Lycopersicon esculentum mRNA for cysteine protease CYP1, complete CDS
          Length = 1756

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 421  ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 480
            |||||||| |||||||  || |||||||| |||||||| || || ||||| || || || 
Sbjct: 1308 ttgcagataggatagtcgtgtgggcagcaactgtagtggtcttcacagcaagtggctcct 1249

                                
Query: 481  tcaagtgggcaacagcccca 500
            ||||||||||| || |||||
Sbjct: 1248 tcaagtgggcagcatcccca 1229
to top
>emb|AJ844007.1| Plantago major partial mRNA for cysteine protease 3 (cpr3 gene)
          Length = 648

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 48/56 (85%)
 Strand = Plus / Minus

                                                                   
Query: 445 cagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagcccca 500
           ||||| ||||| || || || |||||||| |||||||||||||| ||||| |||||
Sbjct: 153 cagcaactgtaatggtcctcacagcaggtggcaccctcaagtggacaacatcccca 98
to top
>gb|AF172856.1|AF172856 Lycopersicon esculentum cysteine protease TDI-65 (tdi-65) mRNA,
            complete cds
          Length = 1779

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                        
Query: 421  ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 480
            |||||||| |||||||  || |||||||| |||||||| || || ||||| || || || 
Sbjct: 1327 ttgcagataggatagtcgtgtgggcagcaactgtagtggtcttcacagcaagtggctcct 1268

                                
Query: 481  tcaagtgggcaacagcccca 500
            ||||||||||| || |||||
Sbjct: 1267 tcaagtgggcagcatcccca 1248
to top
>gb|M21444.1|TOMLTITP Lycopersicon esculentum low-temperature-induced thiol protease
           mRNA, complete cds
          Length = 1353

 Score = 48.1 bits (24), Expect = 0.028
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 421 ttgcagatgggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccc 480
           |||||||| |||||||  || |||||||| |||||||| || || ||||| || || || 
Sbjct: 920 ttgcagataggatagtcgtgtgggcagcaactgtagtggtcttcacagcaagtggctcct 861

                               
Query: 481 tcaagtgggcaacagcccca 500
           ||||||||||| || |||||
Sbjct: 860 tcaagtgggcagcatcccca 841
to top
>dbj|AB098628.1| Daucus carota DcCysP5 mRNA for cysteine protease, complete cds
          Length = 1928

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 59/71 (83%)
 Strand = Plus / Minus

                                                                        
Query: 430  ggatagttatgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtggg 489
            ||||||| ||| || ||||| || |||  |||||||||||||| |||| ||||||| |||
Sbjct: 1454 ggatagtcatgtggacagcaactatagccatcatcgcagcaggaagcagcctcaagcggg 1395

                       
Query: 490  caacagcccca 500
            || || |||||
Sbjct: 1394 cagcaacccca 1384
to top
>gb|AC160120.2| Mus musculus BAC clone RP23-407B7 from chromosome 14, complete sequence
          Length = 202981

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 130   aacccgattttaggattatgtacaggagcat 160
             |||||||||||||||||| | ||||||||||
Sbjct: 65968 aacccgattttaggattaggaacaggagcat 65998
to top
>emb|X66061.1|PSTHIOL P.sativum mRNA for thiolprotease
          Length = 1820

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                        
Query: 439  tgagggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagccc 498
            ||||||||||| ||||| ||||| || ||||| ||||||  ||| || |||||||| |||
Sbjct: 1264 tgagggcagcaactgtaatgatcgtcacagcaagtagcagactctagagggcaacatccc 1205

              
Query: 499  ca 500
            ||
Sbjct: 1204 ca 1203
to top
>gb|AY700588.1| Zingiber officinale cysteine protease gp3b mRNA, complete cds
          Length = 1575

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 442  gggcagcagctgtagtgatcatcgcagcaggtagcaccctc 482
            ||||||||||||||||| || | ||||||||| || |||||
Sbjct: 1286 gggcagcagctgtagtggtccttgcagcaggtcgccccctc 1246
to top
>gb|AY700587.1| Zingiber officinale cysteine protease gp3a mRNA, complete cds
          Length = 1597

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                     
Query: 442  gggcagcagctgtagtgatcatcgcagcaggtagcaccctc 482
            ||||||||||||||||| || | ||||||||| || |||||
Sbjct: 1315 gggcagcagctgtagtggtctttgcagcaggtcgccccctc 1275
to top
>emb|CR391971.7| Zebrafish DNA sequence from clone CH211-260O6 in linkage group 21,
              complete sequence
          Length = 129478

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 80     ttttacatatacatatgcaaaagca 104
              |||||||| ||||||||||||||||
Sbjct: 119390 ttttacatttacatatgcaaaagca 119414
to top
>emb|AL596164.1| Listeria innocua Clip11262 complete genome, segment 2/12
          Length = 224650

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                               
Query: 439    tgagggcagcagctgtagtgatcatcgcagcag 471
              |||| ||||||| |||||| |||||||||||||
Sbjct: 200315 tgagcgcagcagatgtagttatcatcgcagcag 200347
to top
>gb|AC165441.3| Mus musculus BAC clone RP24-548F24 from chromosome 8, complete sequence
          Length = 235813

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 155    gagcatctattataaagaagatac 178
              ||||||||||||||||| ||||||
Sbjct: 211168 gagcatctattataaaggagatac 211191
to top
>ref|XM_424550.1| PREDICTED: Gallus gallus similar to Ig V-region-like B-G antigen
           11/4 precursor - chicken (LOC426939), mRNA
          Length = 1599

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 437 tatgagggcagcagctgtag 456
           ||||||||||||||||||||
Sbjct: 159 tatgagggcagcagctgtag 140
to top
>ref|XM_422997.1| PREDICTED: Gallus gallus similar to Ig V-region-like B-G antigen
           11/4 precursor - chicken (LOC425214), partial mRNA
          Length = 1648

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 437 tatgagggcagcagctgtag 456
           ||||||||||||||||||||
Sbjct: 706 tatgagggcagcagctgtag 687
to top
>gb|AY371484.1| Schistosoma mansoni Smad4 (Smad4) mRNA, complete cds
          Length = 3146

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 144  attatgtacaggagcatctattat 167
            |||| |||||||||||||||||||
Sbjct: 1972 attaggtacaggagcatctattat 1995
to top
>gb|AC123071.3| Mus musculus BAC clone RP23-70P8 from chromosome 13, complete sequence
          Length = 252384

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    atgaattcctaataacaatg 48
             ||||||||||||||||||||
Sbjct: 43030 atgaattcctaataacaatg 43011
to top
>gb|AC162789.4| Mus musculus chromosome 1, clone RP24-323I23, complete sequence
          Length = 170236

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 84    acatatacatatgcaaaagcaaat 107
             ||||||||||||||||||| ||||
Sbjct: 96777 acatatacatatgcaaaagtaaat 96754
to top
>gb|AC113999.3| Mus musculus BAC clone RP23-148D9 from 16, complete sequence
          Length = 209083

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 32    aattcctaataacaatggca 51
             ||||||||||||||||||||
Sbjct: 10431 aattcctaataacaatggca 10412
to top
>emb|AJ011856.1|SCE011856 Saccharomyces cerevisiae complete mitochondrial genome
          Length = 85779

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 104   aaatttggtggttctgtaaa 123
             ||||||||||||||||||||
Sbjct: 41670 aaatttggtggttctgtaaa 41689
to top
>emb|Z98036.1|HS187N21 Human DNA sequence from clone RP1-187N21 on chromosome 6p21.2-21.33
             Contains part of a novel gene and the 3' end of the NUDT3
             gene for nudix (nucleoside diphosphate linked moiety
             X)-type motif 3, complete sequence
          Length = 103146

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    atgaattcctaataacaatg 48
             ||||||||||||||||||||
Sbjct: 43598 atgaattcctaataacaatg 43579
to top
>gb|AE014836.1| Plasmodium falciparum 3D7 chromosome 11 section 1 of 8 of the complete
              sequence
          Length = 250743

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 88     atacatatgcaaaagcaaat 107
              ||||||||||||||||||||
Sbjct: 171275 atacatatgcaaaagcaaat 171294
to top
>emb|AL355674.10| Human DNA sequence from clone RP11-171A24 on chromosome 9 Contains the
             5' end of the RORB gene for RAR-related orphan receptor B
             protein (RZRB, ROR-BETA), two novel genes and two CpG
             islands, complete sequence
          Length = 174874

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 228   gtgatcatttgcagaagttaatca 251
             |||||||||| |||||||||||||
Sbjct: 81873 gtgatcattttcagaagttaatca 81896
to top
>emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chromosome 9 Contains
             pseudogene similar to part of a novel gene (KIAA1688), a
             solute carrier family 25 (mitochondrial carrier; adenine
             nucleotide translocator), member 6 (SLC25A6) (ANT3)
             pseudogene and a CpG island, complete sequence
          Length = 169550

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 80    ttttacatatacatatgcaa 99
             ||||||||||||||||||||
Sbjct: 22532 ttttacatatacatatgcaa 22513
to top
>emb|V00696.1|MISC16 Yeast (S. cerevisiae) mitochondrial gene for cytochrome B extending
            from map position 71.3 to 80.2. (Strain D273-10B.)
          Length = 6264

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 104  aaatttggtggttctgtaaa 123
            ||||||||||||||||||||
Sbjct: 1475 aaatttggtggttctgtaaa 1494
to top
>gb|L36899.1|YSCMTCG15 Saccharomyces cerevisiae mitochondrion origin of replication (ori6)
            and oli1 gene, complete cds
          Length = 8316

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 104  aaatttggtggttctgtaaa 123
            ||||||||||||||||||||
Sbjct: 2631 aaatttggtggttctgtaaa 2650
to top
>gb|S76640.1| Saccharomyces cerevisiae bI4 RNA maturase gene, complete cds
          Length = 765

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 104 aaatttggtggttctgtaaa 123
           ||||||||||||||||||||
Sbjct: 184 aaatttggtggttctgtaaa 203
to top
>gb|AC154339.2| Mus musculus BAC clone RP23-248O15 from chromosome 13, complete sequence
          Length = 174982

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 22     tttcttgatgaattcctaat 41
              ||||||||||||||||||||
Sbjct: 121672 tttcttgatgaattcctaat 121653
to top
>gb|AC127321.4| Mus musculus BAC clone RP23-231A8 from chromosome 8, complete sequence
          Length = 220673

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 155   gagcatctattataaagaagatac 178
             ||||||||||||||||| ||||||
Sbjct: 75779 gagcatctattataaaggagatac 75802
to top
>gb|AF493427.1| Gallus gallus Ig V-region-like antigen precursor, precursor RNA,
           complete cds
          Length = 1940

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 437 tatgagggcagcagctgtag 456
           ||||||||||||||||||||
Sbjct: 41  tatgagggcagcagctgtag 22
to top
>gb|AC116374.10| Mus musculus chromosome 1, clone RP23-294I9, complete sequence
          Length = 179835

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     acatatacatatgcaaaagcaaat 107
              ||||||||||||||||||| ||||
Sbjct: 171309 acatatacatatgcaaaagtaaat 171286
to top
>gb|BC094153.1| Xenopus laevis cDNA clone MGC:115258 IMAGE:6639837, complete cds
          Length = 5263

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 81   tttacatatacatatgcaaa 100
            ||||||||||||||||||||
Sbjct: 3028 tttacatatacatatgcaaa 3009
to top
>gb|AC007556.3| Homo sapiens BAC clone RP11-18C9 from 2, complete sequence
          Length = 167358

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 82    ttacatatacatatgcaaaa 101
             ||||||||||||||||||||
Sbjct: 66744 ttacatatacatatgcaaaa 66763
to top
>gb|AC012445.6| Homo sapiens BAC clone RP11-86A21 from 2, complete sequence
          Length = 203428

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 84     acatatacatatgcaaaagcaaat 107
              |||||||||||| |||||||||||
Sbjct: 152020 acatatacatattcaaaagcaaat 151997
to top
>gb|AC091888.3| Homo sapiens chromosome 5 clone RP11-11K15, complete sequence
          Length = 151453

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ccctgcttggtgttgcagat 428
             ||||||||||||||||||||
Sbjct: 20107 ccctgcttggtgttgcagat 20126
to top
>gb|AY106278.1| Zea mays PCO137999 mRNA sequence
          Length = 1382

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 50/60 (83%)
 Strand = Plus / Minus

                                                                        
Query: 442  gggcagcagctgtagtgatcatcgcagcaggtagcaccctcaagtgggcaacagccccag 501
            ||||||||||||  |||||| | ||||||||| || ||||| |  ||||| |||||||||
Sbjct: 1043 gggcagcagctggcgtgatccttgcagcaggtggcgccctcgaccgggcagcagccccag 984
to top
>gb|AC147250.4| Mus musculus BAC clone RP24-109P17 from 13, complete sequence
          Length = 196150

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    atgaattcctaataacaatg 48
             ||||||||||||||||||||
Sbjct: 37155 atgaattcctaataacaatg 37174
to top
>gb|M61861.1|CHKBGB Chicken B-G mRNA, complete cds
          Length = 2080

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 437 tatgagggcagcagctgtag 456
           ||||||||||||||||||||
Sbjct: 41  tatgagggcagcagctgtag 22
to top
>gb|J01469.1|YSCMTCOB Yeast (S.cerevisiae) mitochondrial cob gene, intron 4
          Length = 1453

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 104 aaatttggtggttctgtaaa 123
           ||||||||||||||||||||
Sbjct: 598 aaatttggtggttctgtaaa 617


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,350,077
Number of Sequences: 3902068
Number of extensions: 4350077
Number of successful extensions: 83404
Number of sequences better than 10.0: 87
Number of HSP's better than 10.0 without gapping: 87
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 83165
Number of HSP's gapped (non-prelim): 226
length of query: 501
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 479
effective length of database: 17,147,199,772
effective search space: 8213508690788
effective search space used: 8213508690788
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top