ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah62d07
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_472987.1| Oryza sativa (japonica cultivar-group), predic... 222 6e-55
2dbj|AK105071.1| Oryza sativa (japonica cultivar-group) cDNA clon... 222 6e-55
3dbj|AK104854.1| Oryza sativa (japonica cultivar-group) cDNA clon... 222 6e-55
4dbj|AK066522.1| Oryza sativa (japonica cultivar-group) cDNA clon... 222 6e-55
5emb|AL731617.3|OSJN00261 Oryza sativa genomic DNA, chromosome 4,... 153 4e-34
6dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 153 4e-34
7emb|AL606613.3|OSJN00051 Oryza sativa genomic DNA, chromosome 4,... 153 4e-34
8gb|AY484589.1| Musa acuminata clone MuH9, genomic sequence 60 5e-06
9gb|AC147179.15| Medicago truncatula clone mth2-142n19, complete ... 46 0.072
10emb|CR450824.9| Zebrafish DNA sequence from clone CH211-147F12 i... 44 0.29
11gb|AC124761.4| Mus musculus BAC clone RP23-142G18 from 6, comple... 44 0.29
12gb|AC122353.5| Mus musculus BAC clone RP23-391E17 from chromosom... 42 1.1
13gb|AC068762.15| Homo sapiens 3 BAC RP11-215N17 (Roswell Park Can... 42 1.1
14dbj|BS000238.1| Pan troglodytes chromosome 22 clone:PTB-016O01, ... 42 1.1
15emb|AL954242.1|PTB109N16 Pan troglodytes chromosome 22 BAC PTB-1... 42 1.1
16dbj|AP001752.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 42 1.1
17dbj|AP001052.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 42 1.1
18ref|NM_124150.2| Arabidopsis thaliana ATPK5; phosphoglycolate ph... 40 4.5
19gb|AF019413.1|HSMHCT8S22 Homo sapiens HLA class III region conta... 40 4.5
20gb|AC004236.1| Homo sapiens chromosome 1, BAC clone 174p12 (LBNL... 40 4.5
21gb|AC110177.19| Mus musculus chromosome 1, clone RP24-245K23, co... 40 4.5
22emb|AJ868436.1| Sodalis glossinidius pSG2 plasmid from Glossina ... 40 4.5
23emb|AJ868435.1| Sodalis glossinidius pSG2 plasmid from Glossina ... 40 4.5
24emb|CR385066.13| Zebrafish DNA sequence from clone DKEY-220L23 i... 40 4.5
25gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, co... 40 4.5
26ref|XM_808839.1| Trypanosoma cruzi strain CL Brener lectin (Tc00... 40 4.5
27gb|AC107959.8| Homo sapiens chromosome 8, clone RP11-875O11, com... 40 4.5
28gb|AY224378.1| Homo sapiens Tosi C4 gene, exon 9 and partial cds... 40 4.5
29gb|AY224377.1| Trachypithecus cristatus DJ.1 C4 gene, exon 9 and... 40 4.5
30gb|AY224376.1| Presbytis melalophos DJ.36 C4 gene, exon 9 and pa... 40 4.5
31gb|AY224375.1| Mandrillus sphinx Mandrill.1119 C4 gene, exon 9 a... 40 4.5
32gb|AY224374.1| Theropithecus gelada 891096 C4 gene, exon 9 and p... 40 4.5
33gb|AY224373.1| Papio hamadryas 73-347 C4 gene, exon 9 and partia... 40 4.5
34gb|AY224372.1| Macaca tonkeana PM604.H.clade C4 gene, exon 9 and... 40 4.5
35gb|AY224371.1| Macaca tonkeana PM558.N.clade C4 gene, exon 9 and... 40 4.5
36gb|AY224370.1| Macaca thibetana Sich.KIZ C4 gene, exon 9 and par... 40 4.5
37gb|AY224369.1| Macaca thibetana 587041 C4 gene, exon 9 and parti... 40 4.5
38gb|AY224368.1| Macaca sylvanus 1076 C4 gene, exon 9 and partial ... 40 4.5
39gb|AY224367.1| Macaca sylvanus 201 C4 gene, exon 9 and partial c... 40 4.5
40gb|AY224366.1| Macaca sinica 985 C4 gene, exon 9 and partial cds... 40 4.5
41gb|AY224365.1| Macaca sinica 716 C4 gene, exon 9 and partial cds... 40 4.5
42gb|AY224364.1| Macaca silenus 20382 C4 gene, exon 9 and partial ... 40 4.5
43gb|AY224363.1| Macaca silenus 108806 C4 gene, exon 9 and partial... 40 4.5
44gb|AY224362.1| Macaca radiata 3033 C4 gene, exon 9 and partial c... 40 4.5
45gb|AY224361.1| Macaca radiata 3028 C4 gene, exon 9 and partial c... 40 4.5
46gb|AY224360.1| Macaca ochreata Greyarm C4 gene, exon 9 and parti... 40 4.5
47gb|AY224359.1| Macaca nigrescens 101 C4 gene, exon 9 and partial... 40 4.5
48gb|AY224358.1| Macaca nigra PM661 C4 gene, exon 9 and partial cd... 40 4.5
49gb|AY224357.1| Macaca nemestrina pagensis.955 C4 gene, exon 9 an... 40 4.5
50gb|AY224356.1| Macaca nemestrina pagensis.820 C4 gene, exon 9 an... 40 4.5
51gb|AY224355.1| Macaca nemestrina PM665.E.Borneo C4 gene, exon 9 ... 40 4.5
52gb|AY224354.1| Macaca nemestrina SUKA.NE.Borneo C4 gene, exon 9 ... 40 4.5
53gb|AY224353.1| Macaca nemestrina Thai.1A C4 gene, exon 9 and par... 40 4.5
54gb|AY224352.1| Macaca nemestrina #12.KIZ.17 C4 gene, exon 9 and ... 40 4.5
55gb|AY224351.1| Macaca nemestrina #1.KIZ.2 C4 gene, exon 9 and pa... 40 4.5
56gb|AY224350.1| Macaca mulatta China.20156 C4 gene, exon 9 and pa... 40 4.5
57gb|AY224349.1| Macaca mulatta Burma.23269 C4 gene, exon 9 and pa... 40 4.5
58gb|AY224348.1| Macaca mulatta 16805 C4 gene, exon 9 and partial ... 40 4.5
59gb|AY224347.1| Macaca mulatta India.92B.560 C4 gene, exon 9 and ... 40 4.5
60gb|AY224346.1| Macaca maura PM616 C4 gene, exon 9 and partial cd... 40 4.5
61gb|AY224345.1| Macaca hecki 1 C4 gene, exon 9 and partial cds; a... 40 4.5
62gb|AY224344.1| Macaca fuscata 22086 C4 gene, exon 9 and partial ... 40 4.5
63gb|AY224343.1| Macaca fuscata 22082 C4 gene, exon 9 and partial ... 40 4.5
64gb|AY224342.1| Macaca fuscata 13751 C4 gene, exon 9 and partial ... 40 4.5
65gb|AY224341.1| Macaca fascicularis C4 gene, exon 9 and partial c... 40 4.5
66gb|AY224340.1| Macaca fascicularis Java.34 C4 gene, exon 9 and p... 40 4.5
67gb|AY224339.1| Macaca fascicularis Borneo.PM.666 C4 gene, exon 9... 40 4.5
68gb|AY224338.1| Macaca fascicularis Sepilok C4 gene, exon 9 and p... 40 4.5
69gb|AY224337.1| Macaca fascicularis Sarawak C4 gene, exon 9 and p... 40 4.5
70gb|AY224336.1| Macaca fascicularis DM2687 C4 gene, exon 9 and pa... 40 4.5
71gb|AY224335.1| Macaca fascicularis UKM.004 C4 gene, exon 9 and p... 40 4.5
72gb|AY224334.1| Macaca fascicularis Johor.DJ.95 C4 gene, exon 9 a... 40 4.5
73gb|AY224333.1| Macaca fascicularis #3 C4 gene, exon 9 and partia... 40 4.5
74gb|AY224332.1| Macaca fascicularis Vietnam.290.WB C4 gene, exon ... 40 4.5
75gb|AY224331.1| Macaca cyclopis #1 C4 gene, exon 9 and partial cd... 40 4.5
76gb|AY224330.1| Macaca cyclopis 2682 C4 gene, exon 9 and partial ... 40 4.5
77gb|AY224329.1| Macaca brunnescens #3 C4 gene, exon 9 and partial... 40 4.5
78gb|AY224328.1| Macaca assamensis 89019 C4 gene, exon 9 and parti... 40 4.5
79gb|AY224327.1| Macaca assamensis 1.KIZ.B C4 gene, exon 9 and par... 40 4.5
80gb|AY224326.1| Macaca arctoides St0316 C4 gene, exon 9 and parti... 40 4.5
81gb|AY224325.1| Macaca arctoides Hanoi.05.02 C4 gene, exon 9 and ... 40 4.5
82gb|AY224324.1| Macaca arctoides Thai.2A C4 gene, exon 9 and part... 40 4.5
83gb|AY224323.1| Macaca arctoides 101.Malaya C4 gene, exon 9 and p... 40 4.5
84gb|AC073424.8| Homo sapiens BAC clone RP11-653O17 from 7, comple... 40 4.5
85emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on ch... 40 4.5
86ref|NG_000013.2| Homo sapiens MHC class III complement gene clus... 40 4.5
87emb|BX247883.11| Human DNA sequence from clone DASS-360P21 on ch... 40 4.5
88emb|AL662886.6| Human DNA sequence from clone RP13-339K12 on chr... 40 4.5
89emb|AL645860.5| Human DNA sequence from clone RP11-15O15 on chro... 40 4.5
90emb|AL671879.2| Human DNA sequence from clone XXbac-254L4 on chr... 40 4.5
91emb|AL357500.17| Human DNA sequence from clone RP11-242O24 on ch... 40 4.5
92emb|AL358253.16| Human DNA sequence from clone RP11-460G22 on ch... 40 4.5
93emb|AL358875.13| Human DNA sequence from clone RP11-312H18 on ch... 40 4.5
94emb|AL162734.15| Human DNA sequence from clone RP11-243J18 on ch... 40 4.5
95emb|AL160270.19| Human DNA sequence from clone RP11-296L22 on ch... 40 4.5
96emb|AL158151.16| Human DNA sequence from clone RP11-247A12 on ch... 40 4.5
97emb|AL161734.12| Human DNA sequence from clone RP11-33M22 on chr... 40 4.5
98emb|AL157932.21| Human DNA sequence from clone RP11-187A9 on chr... 40 4.5
99emb|AL121932.19|HSA373N24 Human DNA sequence from clone RP11-373... 40 4.5
100emb|AL121934.18|HSBA209A2 Human DNA sequence from clone RP11-209... 40 4.5
101emb|AL117327.5|HSJ421I20 Human DNA sequence from clone RP3-421I2... 40 4.5
102emb|CR753845.11| Human DNA sequence from clone DADB-112B14 on ch... 40 4.5
103emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete ... 40 4.5
104emb|BX640433.1| Bordetella parapertussis strain 12822, complete ... 40 4.5
105emb|BX640421.1| Bordetella pertussis strain Tohama I, complete g... 40 4.5
106emb|AL929358.1|PFA929358 Plasmodium falciparum strain 3D7, chrom... 40 4.5
107emb|AL645922.11| Human DNA sequence from clone XXbac-116M5 on ch... 40 4.5
108emb|CR936924.2| Human DNA sequence from clone DAMC-258G8 on chro... 40 4.5
109gb|AC107913.7| Homo sapiens chromosome 17, clone CTD-3051C7, com... 40 4.5
110gb|AC104762.7| Homo sapiens chromosome 17, clone RP11-769H22, co... 40 4.5
111gb|AC119424.2| Homo sapiens chromosome 3 clone RP11-475O23, comp... 40 4.5
112dbj|AP008234.1| Sodalis glossinidius str. 'morsitans' plasmid pS... 40 4.5
113gb|DQ438980.1| Trypanosoma cruzi antigenic lectin-2 gene, comple... 40 4.5
114gb|AC105751.2| Homo sapiens chromosome 3 clone RP11-908O9, compl... 40 4.5
115gb|AC024288.9| Homo sapiens, clone RP11-23B5, complete sequence 40 4.5
116ref|NG_004658.1| Homo sapiens MHC class III complement gene clus... 40 4.5
117gb|S80811.1| C4A=fourth component of complement {ancient retrovi... 40 4.5
118gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex B... 40 4.5
119gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex B... 40 4.5
120gb|AC008383.8|AC008383 Homo sapiens chromosome 5 clone CTC-222O2... 40 4.5
121emb|BX679671.7| Human DNA sequence from clone DASS-307J8 on chro... 40 4.5
122emb|BX936373.1| Human DNA sequence from clone DASS-307J8 on chro... 40 4.5
123emb|BX826485.1|CNS0A467 Arabidopsis thaliana Full-length cDNA Co... 40 4.5
124gb|AC161476.3| Pan troglodytes BAC clone CH251-284F7 from chromo... 40 4.5
125gb|AC007215.49| Homo sapiens 12 BAC RP11-59H1 (Roswell Park Canc... 40 4.5
126gb|AC092646.2| Homo sapiens BAC clone RP11-415D20 from 2, comple... 40 4.5
127gb|BT005294.1| Arabidopsis thaliana At5g47760 mRNA, complete cds 40 4.5
128gb|AC009408.4| Homo sapiens BAC clone RP11-227I18 from 2, comple... 40 4.5
129gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, c... 40 4.5
130gb|AC006565.4|AC006565 Homo sapiens chromosome Y, clone CTC-484O... 40 4.5
131gb|AC010251.3|AC010251 Homo sapiens chromosome 5 clone CTC-426D1... 40 4.5
132dbj|AB016886.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 4.5
133dbj|D10909.1|ATHPK5 Arabidopsis thaliana gene for serine/threoni... 40 4.5
134dbj|AK118640.1| Arabidopsis thaliana At5g47760 mRNA for putative... 40 4.5
135emb|X80240.1|HSERVKC4 Homo sapiens endogenous retrovirus HERV-KC... 40 4.5
136gb|AF223391.1|AF239258S3 Homo sapiens calcium channel alpha1E su... 40 4.5
137gb|AC007868.2|AC007868 Genomic Sequence for Homo sapiens clone 3... 40 4.5
138gb|U07856.1|HSU07856 Human endogenous retrovirus in complement C... 40 4.5
139emb|AJ305027.1|HSA305027 Homo sapiens partial ALOX12B gene for a... 40 4.5
140gb|AF012327.1|AF012327 Human Endogenous Retrovirus K1,2-1 5' ret... 40 4.5
141gb|AC005204.1|AC005204 Homo sapiens chromosome 19, cosmid F24083... 40 4.5
142gb|AE015925.1| Chlamydophila caviae GPIC, complete genome 40 4.5
143gb|L38804.1|ORAGAG Pongo pygmaeus gag protein (gag) gene, long t... 40 4.5
144gb|L38803.1|ORAENVE Pongo pygmaeus envelope protein (env) gene, ... 40 4.5
145gb|L38796.1|AGMENV Cercopithecus aethiops envelope protein (env)... 40 4.5
146gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome... 40 4.5
147gb|M28671.1|RATIGG2B Rattus norvegicus rearranged IgG-2b gene, l... 40 4.5
148gb|M59816.1|HUMC4AA1 Human complement component C4A gene, exons ... 40 4.5
149gb|M13802.1|RATIGCG2 Rat Ig germline gamma-2b H-chain C-region g... 40 4.5
150emb|AJ005342.1|ALAJ5342 Alternaria linicola mRNA for nitrophenyl... 40 4.5 
>ref|XM_472987.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1098

 Score =  222 bits (112), Expect = 6e-55
 Identities = 165/183 (90%)
 Strand = Plus / Minus

                                                                        
Query: 155  tgctgttttaagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcgt 214
            ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1089 tgctgctttgagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcga 1030

                                                                        
Query: 215  gttgtcggggctctgaagcatctgcacagaagtcacacctgaaagaaccaggagagtttt 274
            |||||| ||||||||||||||||| |||||||| ||||||||||| ||||| ||||||||
Sbjct: 1029 gttgtcagggctctgaagcatctgtacagaagtgacacctgaaaggaccagaagagtttt 970

                                                                        
Query: 275  gcagcctccattttgcccaaatagaacgtcagtatccaaacggncacctaccatgcatat 334
            ||| ||||| ||||| ||||| |  | ||| |||||||||||| |||| |||||||||||
Sbjct: 969  gcaacctccgttttggccaaacaagatgtcggtatccaaacggtcaccaaccatgcatat 910

               
Query: 335  ctg 337
            |||
Sbjct: 909  ctg 907
to top
>dbj|AK105071.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-C11, full
            insert sequence
          Length = 2822

 Score =  222 bits (112), Expect = 6e-55
 Identities = 165/183 (90%)
 Strand = Plus / Minus

                                                                        
Query: 155  tgctgttttaagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcgt 214
            ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1096 tgctgctttgagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcga 1037

                                                                        
Query: 215  gttgtcggggctctgaagcatctgcacagaagtcacacctgaaagaaccaggagagtttt 274
            |||||| ||||||||||||||||| |||||||| ||||||||||| ||||| ||||||||
Sbjct: 1036 gttgtcagggctctgaagcatctgtacagaagtgacacctgaaaggaccagaagagtttt 977

                                                                        
Query: 275  gcagcctccattttgcccaaatagaacgtcagtatccaaacggncacctaccatgcatat 334
            ||| ||||| ||||| ||||| |  | ||| |||||||||||| |||| |||||||||||
Sbjct: 976  gcaacctccgttttggccaaacaagatgtcggtatccaaacggtcaccaaccatgcatat 917

               
Query: 335  ctg 337
            |||
Sbjct: 916  ctg 914
to top
>dbj|AK104854.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-B10, full
            insert sequence
          Length = 1353

 Score =  222 bits (112), Expect = 6e-55
 Identities = 165/183 (90%)
 Strand = Plus / Minus

                                                                        
Query: 155  tgctgttttaagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcgt 214
            ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1172 tgctgctttgagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcga 1113

                                                                        
Query: 215  gttgtcggggctctgaagcatctgcacagaagtcacacctgaaagaaccaggagagtttt 274
            |||||| ||||||||||||||||| |||||||| ||||||||||| ||||| ||||||||
Sbjct: 1112 gttgtcagggctctgaagcatctgtacagaagtgacacctgaaaggaccagaagagtttt 1053

                                                                        
Query: 275  gcagcctccattttgcccaaatagaacgtcagtatccaaacggncacctaccatgcatat 334
            ||| ||||| ||||| ||||| |  | ||| |||||||||||| |||| |||||||||||
Sbjct: 1052 gcaacctccgttttggccaaacaagatgtcggtatccaaacggtcaccaaccatgcatat 993

               
Query: 335  ctg 337
            |||
Sbjct: 992  ctg 990
to top
>dbj|AK066522.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013072G15, full
            insert sequence
          Length = 1373

 Score =  222 bits (112), Expect = 6e-55
 Identities = 165/183 (90%)
 Strand = Plus / Minus

                                                                        
Query: 155  tgctgttttaagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcgt 214
            ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 1172 tgctgctttgagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcga 1113

                                                                        
Query: 215  gttgtcggggctctgaagcatctgcacagaagtcacacctgaaagaaccaggagagtttt 274
            |||||| ||||||||||||||||| |||||||| ||||||||||| ||||| ||||||||
Sbjct: 1112 gttgtcagggctctgaagcatctgtacagaagtgacacctgaaaggaccagaagagtttt 1053

                                                                        
Query: 275  gcagcctccattttgcccaaatagaacgtcagtatccaaacggncacctaccatgcatat 334
            ||| ||||| ||||| ||||| |  | ||| |||||||||||| |||| |||||||||||
Sbjct: 1052 gcaacctccgttttggccaaacaagatgtcggtatccaaacggtcaccaaccatgcatat 993

               
Query: 335  ctg 337
            |||
Sbjct: 992  ctg 990
to top
>emb|AL731617.3|OSJN00261 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0076N16,
             complete sequence
          Length = 146313

 Score =  153 bits (77), Expect = 4e-34
 Identities = 95/101 (94%)
 Strand = Plus / Plus

                                                                         
Query: 155   tgctgttttaagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcgt 214
             ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 63057 tgctgctttgagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcga 63116

                                                      
Query: 215   gttgtcggggctctgaagcatctgcacagaagtcacacctg 255
             |||||| ||||||||||||||||| |||||||| |||||||
Sbjct: 63117 gttgtcagggctctgaagcatctgtacagaagtgacacctg 63157



 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                         
Query: 251   acctgaaagaaccaggagagttttgcagcctccattttgcccaaatagaacgtcagtatc 310
             ||||||||| ||||| ||||||||||| ||||| ||||| ||||| |  | ||| |||||
Sbjct: 63241 acctgaaaggaccagaagagttttgcaacctccgttttggccaaacaagatgtcggtatc 63300

                                        
Query: 311   caaacggncacctaccatgcatatctg 337
             ||||||| |||| ||||||||||||||
Sbjct: 63301 caaacggtcaccaaccatgcatatctg 63327
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  153 bits (77), Expect = 4e-34
 Identities = 95/101 (94%)
 Strand = Plus / Plus

                                                                            
Query: 155      tgctgttttaagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcgt 214
                ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 24503426 tgctgctttgagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcga 24503485

                                                         
Query: 215      gttgtcggggctctgaagcatctgcacagaagtcacacctg 255
                |||||| ||||||||||||||||| |||||||| |||||||
Sbjct: 24503486 gttgtcagggctctgaagcatctgtacagaagtgacacctg 24503526



 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                            
Query: 251      acctgaaagaaccaggagagttttgcagcctccattttgcccaaatagaacgtcagtatc 310
                ||||||||| ||||| ||||||||||| ||||| ||||| ||||| |  | ||| |||||
Sbjct: 24503610 acctgaaaggaccagaagagttttgcaacctccgttttggccaaacaagatgtcggtatc 24503669

                                           
Query: 311      caaacggncacctaccatgcatatctg 337
                ||||||| |||| ||||||||||||||
Sbjct: 24503670 caaacggtcaccaaccatgcatatctg 24503696
to top
>emb|AL606613.3|OSJN00051 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0084K20,
             complete sequence
          Length = 116983

 Score =  153 bits (77), Expect = 4e-34
 Identities = 95/101 (94%)
 Strand = Plus / Plus

                                                                         
Query: 155   tgctgttttaagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcgt 214
             ||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| 
Sbjct: 96748 tgctgctttgagggtgagaaaatcagaaatttggtttgtgtagaaatctggctggatcga 96807

                                                      
Query: 215   gttgtcggggctctgaagcatctgcacagaagtcacacctg 255
             |||||| ||||||||||||||||| |||||||| |||||||
Sbjct: 96808 gttgtcagggctctgaagcatctgtacagaagtgacacctg 96848



 Score = 79.8 bits (40), Expect = 5e-12
 Identities = 75/87 (86%)
 Strand = Plus / Plus

                                                                         
Query: 251   acctgaaagaaccaggagagttttgcagcctccattttgcccaaatagaacgtcagtatc 310
             ||||||||| ||||| ||||||||||| ||||| ||||| ||||| |  | ||| |||||
Sbjct: 96932 acctgaaaggaccagaagagttttgcaacctccgttttggccaaacaagatgtcggtatc 96991

                                        
Query: 311   caaacggncacctaccatgcatatctg 337
             ||||||| |||| ||||||||||||||
Sbjct: 96992 caaacggtcaccaaccatgcatatctg 97018
to top
>gb|AY484589.1| Musa acuminata clone MuH9, genomic sequence
          Length = 82723

 Score = 60.0 bits (30), Expect = 5e-06
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                        
Query: 270  gttttgcagcctccattttgcccaaatagaacgtcagtatccaaacggncacctaccatg 329
            ||||||||||| ||||||||||||||||| |  || |||||||| ||  | |||||||||
Sbjct: 8435 gttttgcagccaccattttgcccaaatagtatatcggtatccaaccgatctcctaccatg 8494

                 
Query: 330  catat 334
            |||||
Sbjct: 8495 catat 8499



 Score = 46.1 bits (23), Expect = 0.072
 Identities = 56/67 (83%)
 Strand = Plus / Plus

                                                                        
Query: 188  gtttgtgtagaaatctggctggatcgtgttgtcggggctctgaagcatctgcacagaagt 247
            |||||||||||||||||| || || | ||||  |||||| || ||||| |||| ||||||
Sbjct: 8275 gtttgtgtagaaatctggttgtatggagttgctggggctttgcagcatttgcagagaagt 8334

                   
Query: 248  cacacct 254
             ||||||
Sbjct: 8335 aacacct 8341
to top
>gb|AC147179.15| Medicago truncatula clone mth2-142n19, complete sequence
          Length = 113361

 Score = 46.1 bits (23), Expect = 0.072
 Identities = 41/47 (87%)
 Strand = Plus / Plus

                                                            
Query: 249   acacctgaaagaaccaggagagttttgcagcctccattttgcccaaa 295
             |||||||| || || || |||||||||||||| |||||||| |||||
Sbjct: 14462 acacctgagaggacaagtagagttttgcagccaccattttgtccaaa 14508
to top
>emb|CR450824.9| Zebrafish DNA sequence from clone CH211-147F12 in linkage group 23,
              complete sequence
          Length = 170611

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 229    gaagcatctgcacagaagtcacacct 254
              ||||||||||||||||| ||||||||
Sbjct: 139632 gaagcatctgcacagaattcacacct 139657
to top
>gb|AC124761.4| Mus musculus BAC clone RP23-142G18 from 6, complete sequence
          Length = 182921

 Score = 44.1 bits (22), Expect = 0.29
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 7      atgatgtacatacttgcattta 28
              ||||||||||||||||||||||
Sbjct: 131817 atgatgtacatacttgcattta 131838
to top
>gb|AC122353.5| Mus musculus BAC clone RP23-391E17 from chromosome 16, complete sequence
          Length = 200401

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 171    agaaaatcagaaatttggttt 191
              |||||||||||||||||||||
Sbjct: 122759 agaaaatcagaaatttggttt 122779
to top
>gb|AC068762.15| Homo sapiens 3 BAC RP11-215N17 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 152541

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 174   aaatcagaaatttggtttgtg 194
             |||||||||||||||||||||
Sbjct: 27748 aaatcagaaatttggtttgtg 27728
to top
>dbj|BS000238.1| Pan troglodytes chromosome 22 clone:PTB-016O01, map 22, complete
              sequences
          Length = 168017

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 271    ttttgcagcctccattttgcc 291
              |||||||||||||||||||||
Sbjct: 154813 ttttgcagcctccattttgcc 154833
to top
>emb|AL954242.1|PTB109N16 Pan troglodytes chromosome 22 BAC PTB-109N16, complete sequence
          Length = 190477

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 271    ttttgcagcctccattttgcc 291
              |||||||||||||||||||||
Sbjct: 100990 ttttgcagcctccattttgcc 101010



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 271   ttttgcagcctccattttgcc 291
             |||||||||||||||||||||
Sbjct: 59639 ttttgcagcctccattttgcc 59659
to top
>dbj|AP001752.1| Homo sapiens genomic DNA, chromosome 21q, section 96/105
          Length = 340000

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 271    ttttgcagcctccattttgcc 291
              |||||||||||||||||||||
Sbjct: 132491 ttttgcagcctccattttgcc 132511



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 271   ttttgcagcctccattttgcc 291
             |||||||||||||||||||||
Sbjct: 92561 ttttgcagcctccattttgcc 92581
to top
>dbj|AP001052.1| Homo sapiens genomic DNA, chromosome 21, clone:KB22A5, MX1-D21S171
              region, complete sequence
          Length = 145540

 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 271    ttttgcagcctccattttgcc 291
              |||||||||||||||||||||
Sbjct: 110670 ttttgcagcctccattttgcc 110690



 Score = 42.1 bits (21), Expect = 1.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 271   ttttgcagcctccattttgcc 291
             |||||||||||||||||||||
Sbjct: 70740 ttttgcagcctccattttgcc 70760
to top
>ref|NM_124150.2| Arabidopsis thaliana ATPK5; phosphoglycolate phosphatase AT5G47760
           (ATPK5) mRNA, complete cds
          Length = 1155

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 264 aggagagttttgcagcctccattttgcccaaa 295
           |||||||||||||||||  |||| ||||||||
Sbjct: 806 aggagagttttgcagccagcattctgcccaaa 775
to top
>gb|AF019413.1|HSMHCT8S22 Homo sapiens HLA class III region containing tenascin X (tenascin-X)
             gene, partial cds; cytochrome P450 21-hydroxylase
             (CYP21B), complement component C4 (C4B) G11, helicase
             (SKI2W), RD, complement factor B (Bf), and  complement
             component C2 (C2) genes, complete cds
          Length = 109646

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 40730 ttttgcagcctccattttgc 40749



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 34916 ttttgcagcctccattttgc 34935
to top
>gb|AC004236.1| Homo sapiens chromosome 1, BAC clone 174p12 (LBNL H110), complete
             sequence
          Length = 43591

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 39258 ttttgcagcctccattttgc 39277
to top
>gb|AC110177.19| Mus musculus chromosome 1, clone RP24-245K23, complete sequence
          Length = 165052

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 130    acattcacatttctgttcat 149
              ||||||||||||||||||||
Sbjct: 155016 acattcacatttctgttcat 155035
to top
>emb|AJ868436.1| Sodalis glossinidius pSG2 plasmid from Glossina austini
          Length = 27240

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 249   acacctgaaagaaccaggag 268
             ||||||||||||||||||||
Sbjct: 24083 acacctgaaagaaccaggag 24064
to top
>emb|AJ868435.1| Sodalis glossinidius pSG2 plasmid from Glossina palpalis palpalis
          Length = 27240

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 249   acacctgaaagaaccaggag 268
             ||||||||||||||||||||
Sbjct: 24083 acacctgaaagaaccaggag 24064
to top
>emb|CR385066.13| Zebrafish DNA sequence from clone DKEY-220L23 in linkage group 3,
             complete sequence
          Length = 238822

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 8     tgatgtacatacttgcattt 27
             ||||||||||||||||||||
Sbjct: 44623 tgatgtacatacttgcattt 44604
to top
>gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, complete sequence
          Length = 196037

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 77592 ttttgcagcctccattttgc 77611
to top
>ref|XM_808839.1| Trypanosoma cruzi strain CL Brener lectin (Tc00.1047053506177.20)
           partial mRNA
          Length = 1689

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 142 ctgttcatactgctgctgtt 161
           ||||||||||||||||||||
Sbjct: 975 ctgttcatactgctgctgtt 956
to top
>gb|AC107959.8| Homo sapiens chromosome 8, clone RP11-875O11, complete sequence
          Length = 211291

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 47916 ttttgcagcctccattttgc 47897
to top
>gb|AY224378.1| Homo sapiens Tosi C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3010

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 540 ttttgcagcctccattttgc 521
to top
>gb|AY224377.1| Trachypithecus cristatus DJ.1 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3319

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224376.1| Presbytis melalophos DJ.36 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3298

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224375.1| Mandrillus sphinx Mandrill.1119 C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3024

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 545 ttttgcagcctccattttgc 526
to top
>gb|AY224374.1| Theropithecus gelada 891096 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3022

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 545 ttttgcagcctccattttgc 526
to top
>gb|AY224373.1| Papio hamadryas 73-347 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3019

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 545 ttttgcagcctccattttgc 526
to top
>gb|AY224372.1| Macaca tonkeana PM604.H.clade C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224371.1| Macaca tonkeana PM558.N.clade C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224370.1| Macaca thibetana Sich.KIZ C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224369.1| Macaca thibetana 587041 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224368.1| Macaca sylvanus 1076 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3625

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 536 ttttgcagcctccattttgc 517
to top
>gb|AY224367.1| Macaca sylvanus 201 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3589

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 499 ttttgcagcctccattttgc 480
to top
>gb|AY224366.1| Macaca sinica 985 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 539 ttttgcagcctccattttgc 520
to top
>gb|AY224365.1| Macaca sinica 716 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 539 ttttgcagcctccattttgc 520
to top
>gb|AY224364.1| Macaca silenus 20382 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3263

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 472 ttttgcagcctccattttgc 453
to top
>gb|AY224363.1| Macaca silenus 108806 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224362.1| Macaca radiata 3033 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224361.1| Macaca radiata 3028 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224360.1| Macaca ochreata Greyarm C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3287

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 499 ttttgcagcctccattttgc 480
to top
>gb|AY224359.1| Macaca nigrescens 101 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224358.1| Macaca nigra PM661 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3260

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 472 ttttgcagcctccattttgc 453
to top
>gb|AY224357.1| Macaca nemestrina pagensis.955 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224356.1| Macaca nemestrina pagensis.820 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224355.1| Macaca nemestrina PM665.E.Borneo C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3294

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224354.1| Macaca nemestrina SUKA.NE.Borneo C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3281

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224353.1| Macaca nemestrina Thai.1A C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224352.1| Macaca nemestrina #12.KIZ.17 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224351.1| Macaca nemestrina #1.KIZ.2 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224350.1| Macaca mulatta China.20156 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224349.1| Macaca mulatta Burma.23269 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224348.1| Macaca mulatta 16805 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224347.1| Macaca mulatta India.92B.560 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224346.1| Macaca maura PM616 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224345.1| Macaca hecki 1 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3327

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224344.1| Macaca fuscata 22086 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3313

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224343.1| Macaca fuscata 22082 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3314

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224342.1| Macaca fuscata 13751 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3308

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224341.1| Macaca fascicularis C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224340.1| Macaca fascicularis Java.34 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3323

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224339.1| Macaca fascicularis Borneo.PM.666 C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224338.1| Macaca fascicularis Sepilok C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224337.1| Macaca fascicularis Sarawak C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224336.1| Macaca fascicularis DM2687 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3330

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224335.1| Macaca fascicularis UKM.004 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224334.1| Macaca fascicularis Johor.DJ.95 C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224333.1| Macaca fascicularis #3 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224332.1| Macaca fascicularis Vietnam.290.WB C4 gene, exon 9 and partial cds;
           and endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224331.1| Macaca cyclopis #1 C4 gene, exon 9 and partial cds; and endogenous
           retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224330.1| Macaca cyclopis 2682 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224329.1| Macaca brunnescens #3 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3324

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224328.1| Macaca assamensis 89019 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224327.1| Macaca assamensis 1.KIZ.B C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3329

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224326.1| Macaca arctoides St0316 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3328

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224325.1| Macaca arctoides Hanoi.05.02 C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224324.1| Macaca arctoides Thai.2A C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AY224323.1| Macaca arctoides 101.Malaya C4 gene, exon 9 and partial cds; and
           endogenous retrovirus ERV-K(C4), partial sequence
          Length = 3326

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 538 ttttgcagcctccattttgc 519
to top
>gb|AC073424.8| Homo sapiens BAC clone RP11-653O17 from 7, complete sequence
          Length = 191141

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 43   gattacaaatcaatgtgaaa 62
            ||||||||||||||||||||
Sbjct: 7589 gattacaaatcaatgtgaaa 7570
to top
>emb|AL844853.23| Human DNA sequence from clone DAQB-331I12 on chromosome 6 Contains the
              NEU1 gene for sialidase 1 (lysosomal sialidase), the
              C6orf29 gene for chromosome 6 open reading frame 29, the
              BAT8 gene for HLA-B associated transcript 8, a novel
              transcript DAQB-331I12.5, the ZBTB12 gene (previously
              C6orf46) for zinc finger and BTB domain containing 12, the
              C2 gene for complement component 2, the Bf gene for
              B-factor, properdin, the RDBP gene for RD RNA binding
              protein, the SKIV2L gene for superkiller viralicidic
              activity 2-like (S. cerevisiae), the DOM3Z gene for dom-3
              homolog Z (C. elegans), the STK19 gene for serine/threonine
              kinase 19, the 5' end of the C4A gene for complement
              component 4A and 8 CpG isalnds, complete sequence
          Length = 153464

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 144762 ttttgcagcctccattttgc 144743



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 138948 ttttgcagcctccattttgc 138929
to top
>ref|NG_000013.2| Homo sapiens MHC class III complement gene cluster, monomodular haplotype
              (MCGC@) on chromosome 6
          Length = 180017

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 111101 ttttgcagcctccattttgc 111120



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 105287 ttttgcagcctccattttgc 105306
to top
>emb|BX247883.11| Human DNA sequence from clone DASS-360P21 on chromosome 6, complete
             sequence
          Length = 46777

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 16727 ttttgcagcctccattttgc 16708



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 10914 ttttgcagcctccattttgc 10895
to top
>emb|AL662886.6| Human DNA sequence from clone RP13-339K12 on chromosome X Contains a
             pseudogene similar to part of p30 (nuclear protein p30)
             and a CpG island, complete sequence
          Length = 63451

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 59139 ttttgcagcctccattttgc 59120
to top
>emb|AL645860.5| Human DNA sequence from clone RP11-15O15 on chromosome 1 Contains the
            5' end of the RPS6KC1 gene for ribosomal protein S6
            kinase 52kDa polypeptide 1, complete sequence
          Length = 26247

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 4906 ttttgcagcctccattttgc 4887
to top
>emb|AL671879.2| Human DNA sequence from clone XXbac-254L4 on chromosome 6 contains a
             novel SCAN domain and Integrase core domain containing
             protein (FLJ31087, KIAA1925), a putative novel transcript,
             a laminin receptor 1 (ribosomal protein SA, 67kDa) (LAMR1)
             pseudogene and two CpG islands, complete sequence
          Length = 176995

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 34812 ttttgcagcctccattttgc 34831
to top
>emb|AL357500.17| Human DNA sequence from clone RP11-242O24 on chromosome 1 Contains the
             3' end of the EPB41 gene for erythrocyte membrane protein
             band 4.1 (elliptocytosis 1, RH-linked), three novel genes,
             the 3' end of the SFRS4 gene for splicing factor
             arginine/serine-rich 4 and a CpG island, complete sequence
          Length = 112392

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 92663 ttttgcagcctccattttgc 92644
to top
>emb|AL358253.16| Human DNA sequence from clone RP11-460G22 on chromosome 1 Contains the
             3' end of the gene for a novel protein (KIAA0459), the
             PLA2G2E gene for phospholipase A2 group IIE and the
             PLA2G2A gene for phospholipase A2 group IIA (platelets,
             synovial fluid), complete sequence
          Length = 101824

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 25743 ttttgcagcctccattttgc 25724



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 20451 ttttgcagcctccattttgc 20432
to top
>emb|AL358875.13| Human DNA sequence from clone RP11-312H18 on chromosome 1, complete
             sequence
          Length = 171635

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 49    aaatcaatgtgaaagaaaac 68
             ||||||||||||||||||||
Sbjct: 89470 aaatcaatgtgaaagaaaac 89489
to top
>emb|AL162734.15| Human DNA sequence from clone RP11-243J18 on chromosome 1 Contains the
             5' end of the YAP gene for YY1 associated protein, a novel
             gene, the DAP3 gene for death associated protein 3, a
             novel pseudogene, the 3' end of the gene for a novel
             protein (FLJ20203) and a CpG island, complete sequence
          Length = 107661

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 41283 ttttgcagcctccattttgc 41264



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 34134 ttttgcagcctccattttgc 34115
to top
>emb|AL160270.19| Human DNA sequence from clone RP11-296L22 on chromosome 9 Contains the 5'
              end of the C9orf25 gene for chromosome 9 open reading frame
              25 (FLJ39031), the DNAI1 gene for dynein axonemal
              intermediate polypeptide 1, the CNTFR gene for ciliary
              neurotrophic factor receptor, a novel pseudogene, three
              novel genes, the 3' end of the DCTN3 gene for dynactin
              (p22) and five CpG islands, complete sequence
          Length = 199114

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 124601 ttttgcagcctccattttgc 124582
to top
>emb|AL158151.16| Human DNA sequence from clone RP11-247A12 on chromosome 9 Contains
            the CRAT gene for carnitine acetyltransferase (CAT1), the
            PPP2R4 gene for protein phosphatase 2A, regulatory
            subunit B' (PR 53) (PTPA), the IER5L gene for immediate
            early response 5-like, a novel gene and three CpG
            islands, complete sequence
          Length = 162445

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 9185 ttttgcagcctccattttgc 9204
to top
>emb|AL161734.12| Human DNA sequence from clone RP11-33M22 on chromosome 1q25.2-31.2
             Contains the 3' end of the CACNA1E gene for calcium
             channel voltage-dependent alpha 1E subunit, complete
             sequence
          Length = 167099

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 82    ctcttagttgctatacaaaa 101
             ||||||||||||||||||||
Sbjct: 54697 ctcttagttgctatacaaaa 54678
to top
>emb|AL157932.21| Human DNA sequence from clone RP11-187A9 on chromosome 13 Contains part
             of a novel gene, the 5' end of the DGKH gene for
             diacylglycerol kinase eta, a mitogen-activated protein
             kinase 6 (MAPK6) pseudogene and 2 CpG islands, complete
             sequence
          Length = 67309

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 251   acctgaaagaaccaggagag 270
             ||||||||||||||||||||
Sbjct: 18650 acctgaaagaaccaggagag 18669
to top
>emb|AL121932.19|HSA373N24 Human DNA sequence from clone RP11-373N24 on chromosome 6 Contains
            part of a putative novel gene, ESTs, STSs, GSSs and two
            CpG islands, complete sequence
          Length = 85952

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 2810 ttttgcagcctccattttgc 2829
to top
>emb|AL121934.18|HSBA209A2 Human DNA sequence from clone RP11-209A2 on chromosome 6 Contains a 60S
             ribosomal protein L10 (RPL10) pseudogene, STSs and GSSs,
             complete sequence
          Length = 49261

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 30535 ttttgcagcctccattttgc 30554



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 22327 ttttgcagcctccattttgc 22346
to top
>emb|AL117327.5|HSJ421I20 Human DNA sequence from clone RP3-421I20 on chromosome Xq22.1-23,
             complete sequence
          Length = 52597

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 41603 ttttgcagcctccattttgc 41584
to top
>emb|CR753845.11| Human DNA sequence from clone DADB-112B14 on chromosome 6, complete
             sequence
          Length = 96090

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 35763 ttttgcagcctccattttgc 35744



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 29949 ttttgcagcctccattttgc 29930
to top
>emb|BX640448.1| Bordetella bronchiseptica strain RB50, complete genome; segment 12/16
          Length = 347137

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 205    gctggatcgtgttgtcgggg 224
              ||||||||||||||||||||
Sbjct: 207510 gctggatcgtgttgtcgggg 207491
to top
>emb|BX640433.1| Bordetella parapertussis strain 12822, complete genome; segment 11/14
          Length = 349305

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 205    gctggatcgtgttgtcgggg 224
              ||||||||||||||||||||
Sbjct: 143999 gctggatcgtgttgtcgggg 143980
to top
>emb|BX640421.1| Bordetella pertussis strain Tohama I, complete genome; segment 11/12
          Length = 349726

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 205    gctggatcgtgttgtcgggg 224
              ||||||||||||||||||||
Sbjct: 284526 gctggatcgtgttgtcgggg 284545
to top
>emb|AL929358.1|PFA929358 Plasmodium falciparum strain 3D7, chromosome 9; segment 4/5
          Length = 254050

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 2      atttaatgatgtacatacttgcat 25
              |||||||| |||||||||||||||
Sbjct: 130019 atttaatgttgtacatacttgcat 129996
to top
>emb|AL645922.11| Human DNA sequence from clone XXbac-116M5 on chromosome 6 contains the C2
              gene for complement component 2 (C2, CO2), the Bf gene for
              B-factor, properdin (Bf, GBG, CFAB, PBF2), the RDBP gene
              for RD RNA-binding protein (RDBP, RD, RDP, D6S45, NELF-E),
              the SKIV2L gene for superkiller viralicidic activity 2-like
              (S. cerevisiae) (SKIV2L, HLP, SKI2, DDX13, SKI2W, SKIV2),
              the DOM3Z gene for dom-3 homolog Z (C. elegans) (DOM3Z,
              NG6, DOM3L), the STK19 gene for serine/threonine kinase 19
              (STK19, G11, RP1, D6S60, D6S60E, HLA-RP1), the C4A gene for
              complement component 4A (C4A, C4S, CO4), a cytochrome P450,
              subfamily XXIA (steroid 21-hydroxylase), polypeptide 1
              pseudogene (CYP21A1P), a tenascin XA pseudogene (TNXA, XA,
              XB, TNX, HXBL, D6S103E), a serine/threonine kinase 19
              (STK19, G11, RP1, D6S60, D6S60E, HLA-RP1) pseudogene, the
              C4B gene for complement component 4B (C4B, C4F, CO4), the
              CYP21A2 gene for cytochrome P450, subfamily XXIA (steroid
              21-hydroxylase, congenital adrenal hyperplasia),
              polypeptide 2 (CYP21A2, CAH1, CPS1, CA21H, CYP21, CYP21B,
              P450c21B), the 3' end of the TNXB gene for tenascin XB
              (TNXB, XB, TNX, XBS, HXBL, TENX, TNXB1, TNXB2, TNXBS) and
              four CpG islands, complete sequence
          Length = 180559

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 119640 ttttgcagcctccattttgc 119621



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 113827 ttttgcagcctccattttgc 113808



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 86903 ttttgcagcctccattttgc 86884



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 81090 ttttgcagcctccattttgc 81071
to top
>emb|CR936924.2| Human DNA sequence from clone DAMC-258G8 on chromosome 6, complete
             sequence
          Length = 42131

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 15472 ttttgcagcctccattttgc 15453



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 9659 ttttgcagcctccattttgc 9640
to top
>gb|AC107913.7| Homo sapiens chromosome 17, clone CTD-3051C7, complete sequence
          Length = 128953

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 40501 ttttgcagcctccattttgc 40482
to top
>gb|AC104762.7| Homo sapiens chromosome 17, clone RP11-769H22, complete sequence
          Length = 162678

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 77591 ttttgcagcctccattttgc 77610
to top
>gb|AC119424.2| Homo sapiens chromosome 3 clone RP11-475O23, complete sequence
          Length = 208015

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 178251 ttttgcagcctccattttgc 178270
to top
>dbj|AP008234.1| Sodalis glossinidius str. 'morsitans' plasmid pSG2, complete sequence
          Length = 27240

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 249   acacctgaaagaaccaggag 268
             ||||||||||||||||||||
Sbjct: 20824 acacctgaaagaaccaggag 20843
to top
>gb|DQ438980.1| Trypanosoma cruzi antigenic lectin-2 gene, complete cds
          Length = 2253

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 142  ctgttcatactgctgctgtt 161
            ||||||||||||||||||||
Sbjct: 1222 ctgttcatactgctgctgtt 1203
to top
>gb|AC105751.2| Homo sapiens chromosome 3 clone RP11-908O9, complete sequence
          Length = 168835

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 9378 ttttgcagcctccattttgc 9359
to top
>gb|AC024288.9| Homo sapiens, clone RP11-23B5, complete sequence
          Length = 169540

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 242   agaagtcacacctgaaagaa 261
             ||||||||||||||||||||
Sbjct: 89101 agaagtcacacctgaaagaa 89120
to top
>ref|NG_004658.1| Homo sapiens MHC class III complement gene cluster, bimodular haplotype
             (MCGC2@) on chromosome 6
          Length = 201523

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 96158 ttttgcagcctccattttgc 96139



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 90345 ttttgcagcctccattttgc 90326



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 63421 ttttgcagcctccattttgc 63402



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 57608 ttttgcagcctccattttgc 57589
to top
>gb|S80811.1| C4A=fourth component of complement {ancient retroviral insertion
            sequence, intron 9} [human, Genomic, 6787 nt]
          Length = 6787

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 6232 ttttgcagcctccattttgc 6213



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 421 ttttgcagcctccattttgc 402
to top
>gb|AC148692.1| Macaca mulatta Major Histocompatibility Complex BAC MMU235E11, complete
              sequence
          Length = 159875

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 110321 ttttgcagcctccattttgc 110302
to top
>gb|AC148660.1| Macaca mulatta Major Histocompatibility Complex BAC MMU007F01, complete
             sequence
          Length = 176267

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 65603 ttttgcagcctccattttgc 65584
to top
>gb|AC008383.8|AC008383 Homo sapiens chromosome 5 clone CTC-222O22, complete sequence
          Length = 209114

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    caaatcaatgtgaaagaaaa 67
             ||||||||||||||||||||
Sbjct: 39260 caaatcaatgtgaaagaaaa 39279
to top
>emb|BX679671.7| Human DNA sequence from clone DASS-307J8 on chromosome 6, complete
             sequence
          Length = 96335

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 51266 ttttgcagcctccattttgc 51247



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 45453 ttttgcagcctccattttgc 45434



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 18528 ttttgcagcctccattttgc 18509



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 12715 ttttgcagcctccattttgc 12696
to top
>emb|BX936373.1| Human DNA sequence from clone DASS-307J8 on chromosome 6, complete
             sequence
          Length = 36539

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 18528 ttttgcagcctccattttgc 18509



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 12715 ttttgcagcctccattttgc 12696
to top
>emb|BX826485.1|CNS0A467 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB2ZG09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1313

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 264 aggagagttttgcagcctccattttgcccaaa 295
           |||||||||||||||||  |||| ||||||||
Sbjct: 883 aggagagttttgcagccagcattctgcccaaa 852
to top
>gb|AC161476.3| Pan troglodytes BAC clone CH251-284F7 from chromosome unknown, complete
             sequence
          Length = 153003

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 17344 ttttgcagcctccattttgc 17325
to top
>gb|AC007215.49| Homo sapiens 12 BAC RP11-59H1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 122001

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 37425 ttttgcagcctccattttgc 37444
to top
>gb|AC092646.2| Homo sapiens BAC clone RP11-415D20 from 2, complete sequence
          Length = 176982

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 178    cagaaatttggtttgtgtag 197
              ||||||||||||||||||||
Sbjct: 155761 cagaaatttggtttgtgtag 155742
to top
>gb|BT005294.1| Arabidopsis thaliana At5g47760 mRNA, complete cds
          Length = 906

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 264 aggagagttttgcagcctccattttgcccaaa 295
           |||||||||||||||||  |||| ||||||||
Sbjct: 791 aggagagttttgcagccagcattctgcccaaa 760
to top
>gb|AC009408.4| Homo sapiens BAC clone RP11-227I18 from 2, complete sequence
          Length = 169765

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 144515 ttttgcagcctccattttgc 144496
to top
>gb|AC068205.25| Homo sapiens chromosome 11, clone RP11-472I20, complete sequence
          Length = 205069

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 271    ttttgcagcctccattttgc 290
              ||||||||||||||||||||
Sbjct: 173319 ttttgcagcctccattttgc 173338
to top
>gb|AC006565.4|AC006565 Homo sapiens chromosome Y, clone CTC-484O7, complete sequence
          Length = 46879

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 42281 ttttgcagcctccattttgc 42300
to top
>gb|AC010251.3|AC010251 Homo sapiens chromosome 5 clone CTC-426D19, complete sequence
          Length = 175191

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 46     tacaaatcaatgtgaaagaa 65
              ||||||||||||||||||||
Sbjct: 102829 tacaaatcaatgtgaaagaa 102848
to top
>dbj|AB016886.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MCA23
          Length = 82503

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                             
Query: 264   aggagagttttgcagcctccattttgcccaaa 295
             |||||||||||||||||  |||| ||||||||
Sbjct: 20578 aggagagttttgcagccagcattctgcccaaa 20609
to top
>dbj|D10909.1|ATHPK5 Arabidopsis thaliana gene for serine/threonine protein kinase,
           complete cds
          Length = 4059

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 264 aggagagttttgcagcctccattttgcccaaa 295
           |||||||||||||||||  |||| ||||||||
Sbjct: 552 aggagagttttgcagccagcattctgcccaaa 521
to top
>dbj|AK118640.1| Arabidopsis thaliana At5g47760 mRNA for putative
           4-nitrophenylphosphatase, complete cds, clone:
           RAFL19-90-G08
          Length = 1095

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 264 aggagagttttgcagcctccattttgcccaaa 295
           |||||||||||||||||  |||| ||||||||
Sbjct: 806 aggagagttttgcagccagcattctgcccaaa 775
to top
>emb|X80240.1|HSERVKC4 Homo sapiens endogenous retrovirus HERV-KC4 DNA
          Length = 6369

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 6232 ttttgcagcctccattttgc 6251



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 421 ttttgcagcctccattttgc 440
to top
>gb|AF223391.1|AF239258S3 Homo sapiens calcium channel alpha1E subunit (CACNA1E) gene, exons 7-49,
              and partial cds, alternatively spliced
          Length = 316704

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 82     ctcttagttgctatacaaaa 101
              ||||||||||||||||||||
Sbjct: 212448 ctcttagttgctatacaaaa 212429
to top
>gb|AC007868.2|AC007868 Genomic Sequence for Homo sapiens clone 344N5, chromosome 8, complete
             sequence
          Length = 89820

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 54665 ttttgcagcctccattttgc 54646
to top
>gb|U07856.1|HSU07856 Human endogenous retrovirus in complement C4A gene, A3 allele,
            HERV-K(C4) (gag), (pol), reverse transcriptase, integrase
            and (env) genes, complete cds
          Length = 6372

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 6234 ttttgcagcctccattttgc 6253



 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 422 ttttgcagcctccattttgc 441
to top
>emb|AJ305027.1|HSA305027 Homo sapiens partial ALOX12B gene for arachidonate
           12R-lipoxygenase, exons 3 to 14 and partial ALOX15P
           pseudogene for arachidonate 15-lipoxygenase, exons 11 to
           14
          Length = 13652

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 811 ttttgcagcctccattttgc 792
to top
>gb|AF012327.1|AF012327 Human Endogenous Retrovirus K1,2-1 5' retroviral regulatory
           terminal end
          Length = 250

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 115 ttttgcagcctccattttgc 134
to top
>gb|AC005204.1|AC005204 Homo sapiens chromosome 19, cosmid F24083, complete sequence
          Length = 38449

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 271   ttttgcagcctccattttgc 290
             ||||||||||||||||||||
Sbjct: 16661 ttttgcagcctccattttgc 16642
to top
>gb|AE015925.1| Chlamydophila caviae GPIC, complete genome
          Length = 1173390

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 75     gggtgatctcttagttgcta 94
              ||||||||||||||||||||
Sbjct: 146287 gggtgatctcttagttgcta 146306
to top
>gb|L38804.1|ORAGAG Pongo pygmaeus gag protein (gag) gene, long terminal repeat
          Length = 1288

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 416 ttttgcagcctccattttgc 435
to top
>gb|L38803.1|ORAENVE Pongo pygmaeus envelope protein (env) gene, long terminal repeat
          Length = 710

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 578 ttttgcagcctccattttgc 597
to top
>gb|L38796.1|AGMENV Cercopithecus aethiops envelope protein (env) gene, long terminal
           repeat
          Length = 712

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 271 ttttgcagcctccattttgc 290
           ||||||||||||||||||||
Sbjct: 584 ttttgcagcctccattttgc 603
to top
>gb|AC160762.4| Mus musculus BAC clone RP24-330E8 from chromosome 1, complete sequence
          Length = 149232

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 130   acattcacatttctgttcat 149
             ||||||||||||||||||||
Sbjct: 67287 acattcacatttctgttcat 67268
to top
>gb|M28671.1|RATIGG2B Rattus norvegicus rearranged IgG-2b gene, last 4 exons
          Length = 1885

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 255  gaaagaaccaggagagttttgcag 278
            ||||||||||||| ||||||||||
Sbjct: 1779 gaaagaaccaggacagttttgcag 1756
to top
>gb|M59816.1|HUMC4AA1 Human complement component C4A gene, exons 1 through 9
          Length = 2946

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 271  ttttgcagcctccattttgc 290
            ||||||||||||||||||||
Sbjct: 2896 ttttgcagcctccattttgc 2877
to top
>gb|M13802.1|RATIGCG2 Rat Ig germline gamma-2b H-chain C-region gene, exon 3
          Length = 572

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 255 gaaagaaccaggagagttttgcag 278
           ||||||||||||| ||||||||||
Sbjct: 466 gaaagaaccaggacagttttgcag 443
to top
>emb|AJ005342.1|ALAJ5342 Alternaria linicola mRNA for nitrophenylphosphatase-like protein
          Length = 391

 Score = 40.1 bits (20), Expect = 4.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 192 gtgtagaaatctggctggat 211
           ||||||||||||||||||||
Sbjct: 156 gtgtagaaatctggctggat 137


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,548,415
Number of Sequences: 3902068
Number of extensions: 3548415
Number of successful extensions: 66577
Number of sequences better than 10.0: 150
Number of HSP's better than 10.0 without gapping: 150
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 66337
Number of HSP's gapped (non-prelim): 240
length of query: 337
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 315
effective length of database: 17,147,199,772
effective search space: 5401367928180
effective search space used: 5401367928180
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top