ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah62c17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC159093.4| Mus musculus chromosome 15, clone RP23-117F23, co... 40 1.8
2gb|AC144776.2| Mus musculus BAC clone RP23-357B5 from chromosome... 40 1.8
3gb|AC155721.7| Mus musculus 6 BAC RP24-186O21 (Roswell Park Canc... 38 7.1
4emb|CR847783.6| Zebrafish DNA sequence from clone DKEYP-2C8 in l... 38 7.1
5gb|AC137781.2| Homo sapiens chromosome 5 clone RP11-1108I11, com... 38 7.1
6gb|AC138409.1| Homo sapiens chromosome 5 clone RP11-1023L17, com... 38 7.1
7gb|AC153908.2| Mus musculus 6 BAC RP23-190K19 (Roswell Park Canc... 38 7.1

>gb|AC159093.4| Mus musculus chromosome 15, clone RP23-117F23, complete sequence
          Length = 200512

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 72     ccacaaaacattctttatag 91
              ||||||||||||||||||||
Sbjct: 161463 ccacaaaacattctttatag 161482



to top

>gb|AC144776.2| Mus musculus BAC clone RP23-357B5 from chromosome 16, complete sequence
          Length = 190860

 Score = 40.1 bits (20), Expect = 1.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 78    aacattctttatagatacca 97
             ||||||||||||||||||||
Sbjct: 56990 aacattctttatagatacca 57009



to top

>gb|AC155721.7| Mus musculus 6 BAC RP24-186O21 (Roswell Park Cancer Institute
            (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 180652

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 21   agacagactgaacaaccat 39
            |||||||||||||||||||
Sbjct: 4652 agacagactgaacaaccat 4670



to top

>emb|CR847783.6| Zebrafish DNA sequence from clone DKEYP-2C8 in linkage group 5,
             complete sequence
          Length = 184144

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 74    acaaaacattctttataga 92
             |||||||||||||||||||
Sbjct: 55726 acaaaacattctttataga 55744



to top

>gb|AC137781.2| Homo sapiens chromosome 5 clone RP11-1108I11, complete sequence
          Length = 161893

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 77    aaacattctttatagatac 95
             |||||||||||||||||||
Sbjct: 86777 aaacattctttatagatac 86759



to top

>gb|AC138409.1| Homo sapiens chromosome 5 clone RP11-1023L17, complete sequence
          Length = 187740

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 77     aaacattctttatagatac 95
              |||||||||||||||||||
Sbjct: 166441 aaacattctttatagatac 166423



to top

>gb|AC153908.2| Mus musculus 6 BAC RP23-190K19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 201588

 Score = 38.2 bits (19), Expect = 7.1
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 21    agacagactgaacaaccat 39
             |||||||||||||||||||
Sbjct: 60616 agacagactgaacaaccat 60634


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 809,536
Number of Sequences: 3902068
Number of extensions: 809536
Number of successful extensions: 50903
Number of sequences better than 10.0: 7
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 50891
Number of HSP's gapped (non-prelim): 12
length of query: 148
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 127
effective length of database: 17,151,101,840
effective search space: 2178189933680
effective search space used: 2178189933680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top