>gb|CP000108.1| Chlorobium chlorochromatii CaD3, complete genome
          Length = 2572079

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 314    atagcatccttaaatagcagt 334
              |||||||||||||||||||||
Sbjct: 562242 atagcatccttaaatagcagt 562262

>gb|AC110719.7| Homo sapiens 3 BAC RP11-709N4 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 153748

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 317    gcatccttaaatagcagtagc 337
              |||||||||||||||||||||
Sbjct: 103017 gcatccttaaatagcagtagc 102997

>gb|AC022724.8| Homo sapiens chromosome 18, clone RP11-275K5, complete sequence
          Length = 163978

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 317   gcatccttaaatagcagtagc 337
             |||||||||||||||||||||
Sbjct: 39059 gcatccttaaatagcagtagc 39039

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 285      gcggtgtgcagtgtgccatgg 305
                |||||||||||||||||||||
Sbjct: 20912881 gcggtgtgcagtgtgccatgg 20912901

>gb|AC153877.5| Mus musculus 6 BAC RP23-258E21 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 232977

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 136   tgaaccaccagttttacctgg 156
             |||||||||||||||||||||
Sbjct: 15794 tgaaccaccagttttacctgg 15774

>gb|AC154011.3| Mus musculus 6 BAC RP24-261O15 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 146781

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 136    tgaaccaccagttttacctgg 156
              |||||||||||||||||||||
Sbjct: 119717 tgaaccaccagttttacctgg 119697

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 285      gcggtgtgcagtgtgccatgg 305
                |||||||||||||||||||||
Sbjct: 20839095 gcggtgtgcagtgtgccatgg 20839115

>emb|AL731880.3|CNS08C8J Oryza sativa chromosome 12, . BAC OSJNBa0035E02 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 107819

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 285   gcggtgtgcagtgtgccatgg 305
             |||||||||||||||||||||
Sbjct: 46114 gcggtgtgcagtgtgccatgg 46094

>gb|AC113438.17| Mus musculus chromosome 6, clone RP23-191I2, complete sequence
          Length = 221969

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 6      tccctttgaattgtctttgtggcg 29
              ||||||||||||||||| ||||||
Sbjct: 164189 tccctttgaattgtcttggtggcg 164166

>gb|AC105749.2| Homo sapiens chromosome 3 clone RP11-640L9, complete sequence
          Length = 200450

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 287    ggtgtgcagtgtgccatggcacaa 310
              |||||||||||||||||| |||||
Sbjct: 122954 ggtgtgcagtgtgccatgccacaa 122931

>gb|AC097360.2| Homo sapiens chromosome 3 clone RP11-344C13, complete sequence
          Length = 166349

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 287   ggtgtgcagtgtgccatggcacaa 310
             |||||||||||||||||| |||||
Sbjct: 65367 ggtgtgcagtgtgccatgccacaa 65344

>gb|AC007849.24| Homo sapiens 3 BAC RP11-3K16 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 199835

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 9     ctttgaattgtctttgtggc 28
             ||||||||||||||||||||
Sbjct: 59910 ctttgaattgtctttgtggc 59929

>gb|AC015449.3|AC015449 Arabidopsis thaliana chromosome I BAC T3F24 genomic sequence, complete
             sequence
          Length = 77424

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 73    aacaaactcaacaacaactc 92
             ||||||||||||||||||||
Sbjct: 46160 aacaaactcaacaacaactc 46179

>gb|AC117792.6| Mus musculus chromosome 8, clone RP24-549A13, complete sequence
          Length = 174210

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 150    tacctgggcagttctaccat 169
              ||||||||||||||||||||
Sbjct: 100742 tacctgggcagttctaccat 100761

>gb|AC153432.9| Mus musculus 6 BAC RP23-110F19 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 189225

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 6      tccctttgaattgtctttgtggcg 29
              ||||||||||||||||| ||||||
Sbjct: 186543 tccctttgaattgtcttggtggcg 186566


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,318,147
Number of Sequences: 3902068
Number of extensions: 3318147
Number of successful extensions: 53054
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 52990
Number of HSP's gapped (non-prelim): 64
length of query: 431
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 409
effective length of database: 17,147,199,772
effective search space: 7013204706748
effective search space used: 7013204706748
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)