ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah62b04
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BC108770.1| Xenopus laevis cDNA clone IMAGE:6859100, partial cds 42 1.5
2gb|AC149669.2| Bos taurus BAC CH240-57J21 (Children's Hospital ... 40 6.0
3ref|NG_000017.2| Homo sapiens protocadherin beta cluster (PCDHB@... 40 6.0
4gb|AC087420.4| Mus musculus strain C57BL6/J chromosome 5 clone R... 40 6.0
5gb|AC006404.25| Mus musculus strain 129/Sv clone ct7-141k23 map ... 40 6.0
6gb|AC006447.24| Mus musculus strain 129/Sv clone ct7-67d14 map 6... 40 6.0
7gb|AC163208.2| Mus musculus chromosome 18, clone RP24-340O19, co... 40 6.0
8emb|AL513285.10| Human DNA sequence from clone RP11-99H8 on chro... 40 6.0
9emb|AL354820.18| Human DNA sequence from clone RP11-550E22 on ch... 40 6.0
10gb|AC112722.4| Homo sapiens BAC clone RP11-714G18 from 4, comple... 40 6.0
11gb|DP000032.1| Felis catus target 116 genomic scaffold 40 6.0
12gb|AC009117.8| Homo sapiens chromosome 16 clone RP11-481E4, comp... 40 6.0
13gb|AC017088.8| Homo sapiens BAC clone RP11-496P1 from 2, complet... 40 6.0
14gb|AC008688.7|AC008688 Homo sapiens chromosome 5 clone CTB-60P23... 40 6.0
15gb|AC025436.2|AC025436 Homo sapiens chromosome 5 clone CTC-429E1... 40 6.0
16emb|BX901908.8| Zebrafish DNA sequence from clone DKEY-268B12 in... 40 6.0
17emb|AL954657.14| Zebrafish DNA sequence from clone CH211-223E21 ... 40 6.0
18gb|AC103351.11| Mus musculus chromosome 18, clone RP23-406A11, c... 40 6.0
19gb|AC005754.1|AC005754 Homo sapiens chromosome 5, BAC clone 34j1... 40 6.0
20emb|AL929120.7| Mouse DNA sequence from clone RP23-457H10 on chr... 40 6.0
21gb|AC083894.21| Mus musculus strain C57BL/6J chromosome 6 clone ... 40 6.0

>gb|BC108770.1| Xenopus laevis cDNA clone IMAGE:6859100, partial cds
          Length = 2479

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 199  tctttgtcaatgtttatatct 219
            |||||||||||||||||||||
Sbjct: 2393 tctttgtcaatgtttatatct 2413



to top

>gb|AC149669.2| Bos taurus  BAC CH240-57J21 (Children's Hospital Oakland Research
              Institute Bovine BAC Library (male)) complete sequence
          Length = 227069

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 158    tttgacctcagttaccacaacaaa 181
              |||||| |||||||||||||||||
Sbjct: 126784 tttgacatcagttaccacaacaaa 126807



to top

>ref|NG_000017.2| Homo sapiens protocadherin beta cluster (PCDHB@) on chromosome 5
          Length = 257923

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 95    ggtggaaaaaagggttcctccata 118
             |||||||||||| |||||||||||
Sbjct: 34626 ggtggaaaaaagtgttcctccata 34649



to top

>gb|AC087420.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-314O1, complete
            sequence
          Length = 232462

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 428  ttgcagagcccctgagctca 447
            ||||||||||||||||||||
Sbjct: 4647 ttgcagagcccctgagctca 4666



to top

>gb|AC006404.25| Mus musculus strain 129/Sv clone ct7-141k23 map 6, complete sequence
          Length = 142777

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 321   tttgcaatgctgctgactga 340
             ||||||||||||||||||||
Sbjct: 69536 tttgcaatgctgctgactga 69517



to top

>gb|AC006447.24| Mus musculus strain 129/Sv clone ct7-67d14 map 6, complete sequence
          Length = 140454

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 321    tttgcaatgctgctgactga 340
              ||||||||||||||||||||
Sbjct: 128833 tttgcaatgctgctgactga 128814



to top

>gb|AC163208.2| Mus musculus chromosome 18, clone RP24-340O19, complete sequence
          Length = 203011

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 151    aaactaatttgacctcagtt 170
              ||||||||||||||||||||
Sbjct: 187294 aaactaatttgacctcagtt 187313



to top

>emb|AL513285.10| Human DNA sequence from clone RP11-99H8 on chromosome 1 Contains a
             novel gene and the 5' end of a novel gene, complete
             sequence
          Length = 97978

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   acaacaaacaagaaagcagt 193
             ||||||||||||||||||||
Sbjct: 47643 acaacaaacaagaaagcagt 47662



to top

>emb|AL354820.18| Human DNA sequence from clone RP11-550E22 on chromosome 13 Contains
             part of a novel gene, the 5' end of the DDX26 gene for
             DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26 (HDB,
             DBI-1, DICE1, NOTCHL2,Notchl2, DKFZP434B105), part of a
             novel gene, a ribosomal protein S4, X-linked (RPS4X)
             pseudogene, a small nuclear ribonucleoprotein polypeptide
             G pseudogene and a CpG island, complete sequence
          Length = 165987

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 201   tttgtcaatgtttatatctg 220
             ||||||||||||||||||||
Sbjct: 30145 tttgtcaatgtttatatctg 30164



to top

>gb|AC112722.4| Homo sapiens BAC clone RP11-714G18 from 4, complete sequence
          Length = 13996

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 410  tacattgttattcacttgtt 429
            ||||||||||||||||||||
Sbjct: 9570 tacattgttattcacttgtt 9551



to top

>gb|DP000032.1| Felis catus target 116 genomic scaffold
          Length = 376810

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 138   ataacttgcagggaaactaa 157
             ||||||||||||||||||||
Sbjct: 13203 ataacttgcagggaaactaa 13184



to top

>gb|AC009117.8| Homo sapiens chromosome 16 clone RP11-481E4, complete sequence
          Length = 172868

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 167    agttaccacaacaaacaaga 186
              ||||||||||||||||||||
Sbjct: 168070 agttaccacaacaaacaaga 168089



to top

>gb|AC017088.8| Homo sapiens BAC clone RP11-496P1 from 2, complete sequence
          Length = 200440

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 152    aactaatttgacctcagtta 171
              ||||||||||||||||||||
Sbjct: 186224 aactaatttgacctcagtta 186243



to top

>gb|AC008688.7|AC008688 Homo sapiens chromosome 5 clone CTB-60P23, complete sequence
          Length = 147172

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 95    ggtggaaaaaagggttcctccata 118
             |||||||||||| |||||||||||
Sbjct: 82937 ggtggaaaaaagtgttcctccata 82960



to top

>gb|AC025436.2|AC025436 Homo sapiens chromosome 5 clone CTC-429E15, complete sequence
          Length = 184662

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 95    ggtggaaaaaagggttcctccata 118
             |||||||||||| |||||||||||
Sbjct: 80424 ggtggaaaaaagtgttcctccata 80447



to top

>emb|BX901908.8| Zebrafish DNA sequence from clone DKEY-268B12 in linkage group 4,
             complete sequence
          Length = 210697

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   ccatattggcactttgcagc 305
             ||||||||||||||||||||
Sbjct: 16865 ccatattggcactttgcagc 16846



to top

>emb|AL954657.14| Zebrafish DNA sequence from clone CH211-223E21 in linkage group 4,
             complete sequence
          Length = 200352

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   ccatattggcactttgcagc 305
             ||||||||||||||||||||
Sbjct: 56593 ccatattggcactttgcagc 56574



to top

>gb|AC103351.11| Mus musculus chromosome 18, clone RP23-406A11, complete sequence
          Length = 174352

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 151   aaactaatttgacctcagtt 170
             ||||||||||||||||||||
Sbjct: 42812 aaactaatttgacctcagtt 42793



to top

>gb|AC005754.1|AC005754 Homo sapiens chromosome 5, BAC clone 34j15 (LBNL H169), complete sequence
          Length = 125927

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 95     ggtggaaaaaagggttcctccata 118
              |||||||||||| |||||||||||
Sbjct: 112315 ggtggaaaaaagtgttcctccata 112292



to top

>emb|AL929120.7| Mouse DNA sequence from clone RP23-457H10 on chromosome 2, complete
             sequence
          Length = 178517

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 348   gtctgtgagtgtgagcttag 367
             ||||||||||||||||||||
Sbjct: 18448 gtctgtgagtgtgagcttag 18467



to top

>gb|AC083894.21| Mus musculus strain C57BL/6J chromosome 6 clone rp23-259j8, complete
              sequence
          Length = 167273

 Score = 40.1 bits (20), Expect = 6.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 321    tttgcaatgctgctgactga 340
              ||||||||||||||||||||
Sbjct: 126269 tttgcaatgctgctgactga 126288


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,539,428
Number of Sequences: 3902068
Number of extensions: 3539428
Number of successful extensions: 63193
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63156
Number of HSP's gapped (non-prelim): 37
length of query: 448
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 426
effective length of database: 17,147,199,772
effective search space: 7304707102872
effective search space used: 7304707102872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top