Clone Name | rbah62b04 |
---|---|
Clone Library Name | barley_pub |
>gb|BC108770.1| Xenopus laevis cDNA clone IMAGE:6859100, partial cds Length = 2479 Score = 42.1 bits (21), Expect = 1.5 Identities = 21/21 (100%) Strand = Plus / Plus Query: 199 tctttgtcaatgtttatatct 219 ||||||||||||||||||||| Sbjct: 2393 tctttgtcaatgtttatatct 2413
>gb|AC149669.2| Bos taurus BAC CH240-57J21 (Children's Hospital Oakland Research Institute Bovine BAC Library (male)) complete sequence Length = 227069 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 158 tttgacctcagttaccacaacaaa 181 |||||| ||||||||||||||||| Sbjct: 126784 tttgacatcagttaccacaacaaa 126807
>ref|NG_000017.2| Homo sapiens protocadherin beta cluster (PCDHB@) on chromosome 5 Length = 257923 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 95 ggtggaaaaaagggttcctccata 118 |||||||||||| ||||||||||| Sbjct: 34626 ggtggaaaaaagtgttcctccata 34649
>gb|AC087420.4| Mus musculus strain C57BL6/J chromosome 5 clone RP23-314O1, complete sequence Length = 232462 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 428 ttgcagagcccctgagctca 447 |||||||||||||||||||| Sbjct: 4647 ttgcagagcccctgagctca 4666
>gb|AC006404.25| Mus musculus strain 129/Sv clone ct7-141k23 map 6, complete sequence Length = 142777 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 tttgcaatgctgctgactga 340 |||||||||||||||||||| Sbjct: 69536 tttgcaatgctgctgactga 69517
>gb|AC006447.24| Mus musculus strain 129/Sv clone ct7-67d14 map 6, complete sequence Length = 140454 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 321 tttgcaatgctgctgactga 340 |||||||||||||||||||| Sbjct: 128833 tttgcaatgctgctgactga 128814
>gb|AC163208.2| Mus musculus chromosome 18, clone RP24-340O19, complete sequence Length = 203011 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 151 aaactaatttgacctcagtt 170 |||||||||||||||||||| Sbjct: 187294 aaactaatttgacctcagtt 187313
>emb|AL513285.10| Human DNA sequence from clone RP11-99H8 on chromosome 1 Contains a novel gene and the 5' end of a novel gene, complete sequence Length = 97978 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 174 acaacaaacaagaaagcagt 193 |||||||||||||||||||| Sbjct: 47643 acaacaaacaagaaagcagt 47662
>emb|AL354820.18| Human DNA sequence from clone RP11-550E22 on chromosome 13 Contains part of a novel gene, the 5' end of the DDX26 gene for DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26 (HDB, DBI-1, DICE1, NOTCHL2,Notchl2, DKFZP434B105), part of a novel gene, a ribosomal protein S4, X-linked (RPS4X) pseudogene, a small nuclear ribonucleoprotein polypeptide G pseudogene and a CpG island, complete sequence Length = 165987 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 201 tttgtcaatgtttatatctg 220 |||||||||||||||||||| Sbjct: 30145 tttgtcaatgtttatatctg 30164
>gb|AC112722.4| Homo sapiens BAC clone RP11-714G18 from 4, complete sequence Length = 13996 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 410 tacattgttattcacttgtt 429 |||||||||||||||||||| Sbjct: 9570 tacattgttattcacttgtt 9551
>gb|DP000032.1| Felis catus target 116 genomic scaffold Length = 376810 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 138 ataacttgcagggaaactaa 157 |||||||||||||||||||| Sbjct: 13203 ataacttgcagggaaactaa 13184
>gb|AC009117.8| Homo sapiens chromosome 16 clone RP11-481E4, complete sequence Length = 172868 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 167 agttaccacaacaaacaaga 186 |||||||||||||||||||| Sbjct: 168070 agttaccacaacaaacaaga 168089
>gb|AC017088.8| Homo sapiens BAC clone RP11-496P1 from 2, complete sequence Length = 200440 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 152 aactaatttgacctcagtta 171 |||||||||||||||||||| Sbjct: 186224 aactaatttgacctcagtta 186243
>gb|AC008688.7|AC008688 Homo sapiens chromosome 5 clone CTB-60P23, complete sequence Length = 147172 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 95 ggtggaaaaaagggttcctccata 118 |||||||||||| ||||||||||| Sbjct: 82937 ggtggaaaaaagtgttcctccata 82960
>gb|AC025436.2|AC025436 Homo sapiens chromosome 5 clone CTC-429E15, complete sequence Length = 184662 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 95 ggtggaaaaaagggttcctccata 118 |||||||||||| ||||||||||| Sbjct: 80424 ggtggaaaaaagtgttcctccata 80447
>emb|BX901908.8| Zebrafish DNA sequence from clone DKEY-268B12 in linkage group 4, complete sequence Length = 210697 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 286 ccatattggcactttgcagc 305 |||||||||||||||||||| Sbjct: 16865 ccatattggcactttgcagc 16846
>emb|AL954657.14| Zebrafish DNA sequence from clone CH211-223E21 in linkage group 4, complete sequence Length = 200352 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 286 ccatattggcactttgcagc 305 |||||||||||||||||||| Sbjct: 56593 ccatattggcactttgcagc 56574
>gb|AC103351.11| Mus musculus chromosome 18, clone RP23-406A11, complete sequence Length = 174352 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 aaactaatttgacctcagtt 170 |||||||||||||||||||| Sbjct: 42812 aaactaatttgacctcagtt 42793
>gb|AC005754.1|AC005754 Homo sapiens chromosome 5, BAC clone 34j15 (LBNL H169), complete sequence Length = 125927 Score = 40.1 bits (20), Expect = 6.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 95 ggtggaaaaaagggttcctccata 118 |||||||||||| ||||||||||| Sbjct: 112315 ggtggaaaaaagtgttcctccata 112292
>emb|AL929120.7| Mouse DNA sequence from clone RP23-457H10 on chromosome 2, complete sequence Length = 178517 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 348 gtctgtgagtgtgagcttag 367 |||||||||||||||||||| Sbjct: 18448 gtctgtgagtgtgagcttag 18467
>gb|AC083894.21| Mus musculus strain C57BL/6J chromosome 6 clone rp23-259j8, complete sequence Length = 167273 Score = 40.1 bits (20), Expect = 6.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 321 tttgcaatgctgctgactga 340 |||||||||||||||||||| Sbjct: 126269 tttgcaatgctgctgactga 126288 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,539,428 Number of Sequences: 3902068 Number of extensions: 3539428 Number of successful extensions: 63193 Number of sequences better than 10.0: 21 Number of HSP's better than 10.0 without gapping: 21 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63156 Number of HSP's gapped (non-prelim): 37 length of query: 448 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 426 effective length of database: 17,147,199,772 effective search space: 7304707102872 effective search space used: 7304707102872 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)