ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah61m02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_193489.1| Oryza sativa (japonica cultivar-group), predic... 135 2e-28
2dbj|AK068120.1| Oryza sativa (japonica cultivar-group) cDNA clon... 135 2e-28
3dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
4dbj|AP003443.4| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
5dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
6ref|NM_119085.2| Arabidopsis thaliana unknown protein AT4G29400 ... 54 6e-04
7gb|AY735656.1| Arabidopsis thaliana hypothetical protein AT4G294... 54 6e-04
8emb|AL161575.2|ATCHRIV71 Arabidopsis thaliana DNA chromosome 4, ... 54 6e-04
9emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, ... 54 6e-04
10gb|AY924824.1| Arabidopsis thaliana hypothetical protein (At4g29... 54 6e-04
11dbj|AK116689.1| Ciona intestinalis cDNA, clone:cieg024g13, full ... 44 0.56
12gb|AC154206.2| Mus musculus BAC clone RP24-104P20 from 14, compl... 42 2.2
13gb|AC154239.3| Mus musculus BAC clone RP24-164C12 from chromosom... 42 2.2
14gb|AC168120.3| Mus musculus BAC clone RP23-49A14 from chromosome... 40 8.8
15gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosom... 40 8.8
16gb|BC059179.1| Mus musculus RIKEN cDNA 6330500D04 gene, mRNA (cD... 40 8.8
17gb|AC138400.12| Mus musculus chromosome 14, clone RP23-260C21, c... 40 8.8
18gb|AC124529.3| Mus musculus BAC clone RP23-411I8 from chromosome... 40 8.8
19gb|AC121865.2| Mus musculus BAC clone RP24-112O1 from 8, complet... 40 8.8
20gb|AC146745.20| Medicago truncatula clone mth2-53p19, complete s... 40 8.8
21gb|AC149637.11| Medicago truncatula clone mth2-181h2, complete s... 40 8.8
22gb|AC152751.22| Medicago truncatula clone mth2-18n7, complete se... 40 8.8
23emb|AL365258.24| Human DNA sequence from clone RP11-448G4 on chr... 40 8.8
24gb|AY218841.1| Danio rerio clone BUSM1-81J4 brahma protein-like ... 40 8.8
25emb|AL589699.4| Mouse DNA sequence from clone RP23-92G13 on chro... 40 8.8
26gb|AC154634.2| Mus musculus BAC clone RP23-298D14 from chromosom... 40 8.8
27gb|AC117507.5| Homo sapiens 3 BAC RP11-137K3 (Roswell Park Cance... 40 8.8
28gb|AC040968.6| Homo sapiens chromosome 11, clone RP11-372B5, com... 40 8.8
29emb|BX322663.8| Zebrafish DNA sequence from clone CH211-224D23 i... 40 8.8
30dbj|AK134538.1| Mus musculus adult male medulla oblongata cDNA, ... 40 8.8
31gb|AC067902.6| Homo sapiens chromosome 11, clone RP11-72C9, comp... 40 8.8
32gb|AC012603.7| Homo sapiens chromosome 5 clone CTC-332L22, compl... 40 8.8
33emb|BX255961.5| Zebrafish DNA sequence from clone DKEY-261N6 in ... 40 8.8
34gb|AC069144.9|AC069144 Arabidopsis thaliana chromosome 1 BAC F14... 40 8.8
35gb|AC019159.8| Homo sapiens BAC clone RP11-56O18 from 2, complet... 40 8.8
36gb|AC064840.2|AC064840 Arabidopsis thaliana chromosome I BAC T24... 40 8.8
37gb|AC008417.3|AC008417 Homo sapiens chromosome 5 clone CTC-287O8... 40 8.8
38emb|AL626767.15| Mouse DNA sequence from clone RP23-421C7 on chr... 40 8.8
39gb|AC090673.5| Homo sapiens 12 BAC RP11-366L20 (Roswell Park Can... 40 8.8
40dbj|AK122269.1| Mus musculus mRNA for mKIAA0386 protein 40 8.8
41emb|CR855318.9| Zebrafish DNA sequence from clone DKEY-239I15 in... 40 8.8
42gb|AC139351.4| Mus musculus BAC clone RP24-156K15 from 8, comple... 40 8.8
43gb|AC145931.4| Gallus gallus BAC clone CH261-32O1 from chromosom... 40 8.8
44gb|BC060202.1| Mus musculus RIKEN cDNA 6330500D04 gene, mRNA (cD... 40 8.8

>ref|NM_193489.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1017

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                       
Query: 509 ctgcatattcatggaattgcacccaccaaggcgtccaagtatatgccatgatcgcagagc 568
           |||||||||||| ||||||||||| || ||||| |||| |||||||||||| ||||||||
Sbjct: 546 ctgcatattcatagaattgcacccgcccaggcgcccaactatatgccatgaccgcagagc 487

                                                                       
Query: 569 atcacaaattaatttcacatcttttggcaatagagcattgtggaactcaaaccatatata 628
           ||| ||||||||  ||||||||||||||| || ||||| || |||||| |||||||| ||
Sbjct: 486 atcgcaaattaaggtcacatcttttggcagtaaagcatggtagaactcgaaccatatgta 427

                       
Query: 629 tgaattggagaa 640
            |||||||||||
Sbjct: 426 cgaattggagaa 415



 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 62/70 (88%)
 Strand = Plus / Minus

                                                                       
Query: 440 gaatttatggtggctaatgaattaagcaggacgtccaaaagcaatggatcttgaatacca 499
           ||||||||||| | ||||| ||||||||||| |||||||||||| || || |||||||||
Sbjct: 740 gaatttatggtcgttaatgcattaagcaggatgtccaaaagcaacggttcgtgaatacca 681

                     
Query: 500 atgtccaccc 509
           ||||| ||||
Sbjct: 680 atgtctaccc 671



to top

>dbj|AK068120.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013135L15, full
           insert sequence
          Length = 1611

 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Minus

                                                                       
Query: 509 ctgcatattcatggaattgcacccaccaaggcgtccaagtatatgccatgatcgcagagc 568
           |||||||||||| ||||||||||| || ||||| |||| |||||||||||| ||||||||
Sbjct: 754 ctgcatattcatagaattgcacccgcccaggcgcccaactatatgccatgaccgcagagc 695

                                                                       
Query: 569 atcacaaattaatttcacatcttttggcaatagagcattgtggaactcaaaccatatata 628
           ||| ||||||||  ||||||||||||||| || ||||| || |||||| |||||||| ||
Sbjct: 694 atcgcaaattaaggtcacatcttttggcagtaaagcatggtagaactcgaaccatatgta 635

                       
Query: 629 tgaattggagaa 640
            |||||||||||
Sbjct: 634 cgaattggagaa 623



 Score =  123 bits (62), Expect = 8e-25
 Identities = 149/178 (83%)
 Strand = Plus / Minus

                                                                        
Query: 332  ttctagatcttgtggacactgtacccagcttcttcagtattcaagctgtcgttccagctc 391
            ||||| || ||||||||||| || ||||||||||| || ||||||   ||| ||||| ||
Sbjct: 1056 ttctaaattttgtggacactatatccagcttcttccgttttcaagtcctcgctccagttc 997

                                                                        
Query: 392  tgaaactctgaccctccgaactgtatttccttaatgcccagatgatccgaatttatggtg 451
            ||||| ||   |||||| ||||| | || ||||||||||| |||||| ||||||||||| 
Sbjct: 996  tgaaattcactccctccaaactgcacttgcttaatgcccacatgatctgaatttatggtc 937

                                                                      
Query: 452  gctaatgaattaagcaggacgtccaaaagcaatggatcttgaataccaatgtccaccc 509
            | ||||| ||||||||||| |||||||||||| || || |||||||||||||| ||||
Sbjct: 936  gttaatgcattaagcaggatgtccaaaagcaacggttcgtgaataccaatgtctaccc 879



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                            
Query: 440      gaatttatggtggctaatgaattaagcaggacgtccaaaagcaatggatcttgaatacca 499
                ||||||||||| | ||||| ||||||||||| |||||||||||| || || |||||||||
Sbjct: 21149629 gaatttatggtcgttaatgcattaagcaggatgtccaaaagcaacggttcgtgaatacca 21149688

                            
Query: 500      atgtccaccctg 511
                ||||| ||||||
Sbjct: 21149689 atgtctaccctg 21149700



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 55/61 (90%)
 Strand = Plus / Plus

                                                                            
Query: 508      cctgcatattcatggaattgcacccaccaaggcgtccaagtatatgccatgatcgcagag 567
                ||||||||||||| ||||||||||| || ||||| |||| |||||||||||| |||||||
Sbjct: 21150624 cctgcatattcatagaattgcacccgcccaggcgcccaactatatgccatgaccgcagag 21150683

                 
Query: 568      c 568
                |
Sbjct: 21150684 c 21150684



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                            
Query: 568      catcacaaattaatttcacatcttttggcaatagagcattgtggaactcaaaccatatat 627
                |||| ||||||||  ||||||||||||||| || ||||| || |||||| |||||||| |
Sbjct: 21150823 catcgcaaattaaggtcacatcttttggcagtaaagcatggtagaactcgaaccatatgt 21150882

                             
Query: 628      atgaattggagaa 640
                | |||||||||||
Sbjct: 21150883 acgaattggagaa 21150895



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 85/105 (80%)
 Strand = Plus / Plus

                                                                            
Query: 332      ttctagatcttgtggacactgtacccagcttcttcagtattcaagctgtcgttccagctc 391
                ||||| || ||||||||||| || ||||||||||| || ||||||   ||| ||||| ||
Sbjct: 21148293 ttctaaattttgtggacactatatccagcttcttccgttttcaagtcctcgctccagttc 21148352

                                                             
Query: 392      tgaaactctgaccctccgaactgtatttccttaatgcccagatga 436
                ||||| ||   |||||| ||||| | || ||||||||||| ||||
Sbjct: 21148353 tgaaattcactccctccaaactgcacttgcttaatgcccacatga 21148397



to top

>dbj|AP003443.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
              clone:B1144D11
          Length = 157943

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                          
Query: 440    gaatttatggtggctaatgaattaagcaggacgtccaaaagcaatggatcttgaatacca 499
              ||||||||||| | ||||| ||||||||||| |||||||||||| || || |||||||||
Sbjct: 117174 gaatttatggtcgttaatgcattaagcaggatgtccaaaagcaacggttcgtgaatacca 117233

                          
Query: 500    atgtccaccctg 511
              ||||| ||||||
Sbjct: 117234 atgtctaccctg 117245



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 55/61 (90%)
 Strand = Plus / Plus

                                                                          
Query: 508    cctgcatattcatggaattgcacccaccaaggcgtccaagtatatgccatgatcgcagag 567
              ||||||||||||| ||||||||||| || ||||| |||| |||||||||||| |||||||
Sbjct: 118169 cctgcatattcatagaattgcacccgcccaggcgcccaactatatgccatgaccgcagag 118228

               
Query: 568    c 568
              |
Sbjct: 118229 c 118229



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                          
Query: 568    catcacaaattaatttcacatcttttggcaatagagcattgtggaactcaaaccatatat 627
              |||| ||||||||  ||||||||||||||| || ||||| || |||||| |||||||| |
Sbjct: 118368 catcgcaaattaaggtcacatcttttggcagtaaagcatggtagaactcgaaccatatgt 118427

                           
Query: 628    atgaattggagaa 640
              | |||||||||||
Sbjct: 118428 acgaattggagaa 118440



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 85/105 (80%)
 Strand = Plus / Plus

                                                                          
Query: 332    ttctagatcttgtggacactgtacccagcttcttcagtattcaagctgtcgttccagctc 391
              ||||| || ||||||||||| || ||||||||||| || ||||||   ||| ||||| ||
Sbjct: 115838 ttctaaattttgtggacactatatccagcttcttccgttttcaagtcctcgctccagttc 115897

                                                           
Query: 392    tgaaactctgaccctccgaactgtatttccttaatgcccagatga 436
              ||||| ||   |||||| ||||| | || ||||||||||| ||||
Sbjct: 115898 tgaaattcactccctccaaactgcacttgcttaatgcccacatga 115942



to top

>dbj|AP003924.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC
             clone:B1064G04
          Length = 186704

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 64/72 (88%)
 Strand = Plus / Plus

                                                                         
Query: 440   gaatttatggtggctaatgaattaagcaggacgtccaaaagcaatggatcttgaatacca 499
             ||||||||||| | ||||| ||||||||||| |||||||||||| || || |||||||||
Sbjct: 47138 gaatttatggtcgttaatgcattaagcaggatgtccaaaagcaacggttcgtgaatacca 47197

                         
Query: 500   atgtccaccctg 511
             ||||| ||||||
Sbjct: 47198 atgtctaccctg 47209



 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 55/61 (90%)
 Strand = Plus / Plus

                                                                         
Query: 508   cctgcatattcatggaattgcacccaccaaggcgtccaagtatatgccatgatcgcagag 567
             ||||||||||||| ||||||||||| || ||||| |||| |||||||||||| |||||||
Sbjct: 48133 cctgcatattcatagaattgcacccgcccaggcgcccaactatatgccatgaccgcagag 48192

              
Query: 568   c 568
             |
Sbjct: 48193 c 48193



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 63/73 (86%)
 Strand = Plus / Plus

                                                                         
Query: 568   catcacaaattaatttcacatcttttggcaatagagcattgtggaactcaaaccatatat 627
             |||| ||||||||  ||||||||||||||| || ||||| || |||||| |||||||| |
Sbjct: 48332 catcgcaaattaaggtcacatcttttggcagtaaagcatggtagaactcgaaccatatgt 48391

                          
Query: 628   atgaattggagaa 640
             | |||||||||||
Sbjct: 48392 acgaattggagaa 48404



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 85/105 (80%)
 Strand = Plus / Plus

                                                                         
Query: 332   ttctagatcttgtggacactgtacccagcttcttcagtattcaagctgtcgttccagctc 391
             ||||| || ||||||||||| || ||||||||||| || ||||||   ||| ||||| ||
Sbjct: 45802 ttctaaattttgtggacactatatccagcttcttccgttttcaagtcctcgctccagttc 45861

                                                          
Query: 392   tgaaactctgaccctccgaactgtatttccttaatgcccagatga 436
             ||||| ||   |||||| ||||| | || ||||||||||| ||||
Sbjct: 45862 tgaaattcactccctccaaactgcacttgcttaatgcccacatga 45906



to top

>ref|NM_119085.2| Arabidopsis thaliana unknown protein AT4G29400 mRNA, complete cds
          Length = 1124

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 510 tgcatattcatggaattgcacccaccaaggcgtccaagtatatgcca 556
           |||||||||||||| ||| | |||||||| |||||||| ||||||||
Sbjct: 663 tgcatattcatggagttgtatccaccaagtcgtccaaggatatgcca 617



to top

>gb|AY735656.1| Arabidopsis thaliana hypothetical protein AT4G29400 mRNA, complete
           cds
          Length = 1124

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 510 tgcatattcatggaattgcacccaccaaggcgtccaagtatatgcca 556
           |||||||||||||| ||| | |||||||| |||||||| ||||||||
Sbjct: 663 tgcatattcatggagttgtatccaccaagtcgtccaaggatatgcca 617



to top

>emb|AL161575.2|ATCHRIV71 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 71
          Length = 200001

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                           
Query: 510  tgcatattcatggaattgcacccaccaaggcgtccaagtatatgcca 556
            |||||||||||||| ||| | |||||||| |||||||| ||||||||
Sbjct: 2030 tgcatattcatggagttgtatccaccaagtcgtccaaggatatgcca 1984



to top

>emb|AL161574.2|ATCHRIV70 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 70
          Length = 198429

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                             
Query: 510    tgcatattcatggaattgcacccaccaaggcgtccaagtatatgcca 556
              |||||||||||||| ||| | |||||||| |||||||| ||||||||
Sbjct: 195459 tgcatattcatggagttgtatccaccaagtcgtccaaggatatgcca 195413



to top

>gb|AY924824.1| Arabidopsis thaliana hypothetical protein (At4g29400) mRNA,
           complete cds
          Length = 909

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 510 tgcatattcatggaattgcacccaccaaggcgtccaagtatatgcca 556
           |||||||||||||| ||| | |||||||| |||||||| ||||||||
Sbjct: 611 tgcatattcatggagttgtatccaccaagtcgtccaaggatatgcca 565



to top

>dbj|AK116689.1| Ciona intestinalis cDNA, clone:cieg024g13, full insert sequence
          Length = 1950

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                          
Query: 574  aaattaatttcacatcttttggcaatagag 603
            ||||||||||||||| |||||||| |||||
Sbjct: 1654 aaattaatttcacatgttttggcagtagag 1625



to top

>gb|AC154206.2| Mus musculus BAC clone RP24-104P20 from 14, complete sequence
          Length = 167116

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 283   ctccctgttaccaaaatggta 303
             |||||||||||||||||||||
Sbjct: 13944 ctccctgttaccaaaatggta 13924



to top

>gb|AC154239.3| Mus musculus BAC clone RP24-164C12 from chromosome 14, complete sequence
          Length = 161815

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 283    ctccctgttaccaaaatggta 303
              |||||||||||||||||||||
Sbjct: 133718 ctccctgttaccaaaatggta 133698



to top

>gb|AC168120.3| Mus musculus BAC clone RP23-49A14 from chromosome 3, complete sequence
          Length = 198651

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 575   aattaatttcacatcttttg 594
             ||||||||||||||||||||
Sbjct: 12890 aattaatttcacatcttttg 12871



to top

>gb|AC161609.6| Mus musculus BAC clone RP23-139D15 from chromosome 14, complete sequence
          Length = 219723

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 376    gctgtcgttccagctctgaaactc 399
              ||||| ||||||||||||||||||
Sbjct: 125834 gctgttgttccagctctgaaactc 125811



to top

>gb|BC059179.1| Mus musculus RIKEN cDNA 6330500D04 gene, mRNA (cDNA clone
            IMAGE:6405108), containing frame-shift errors
          Length = 5489

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 575  aattaatttcacatcttttg 594
            ||||||||||||||||||||
Sbjct: 5336 aattaatttcacatcttttg 5355



to top

>gb|AC138400.12| Mus musculus chromosome 14, clone RP23-260C21, complete sequence
          Length = 213423

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 376   gctgtcgttccagctctgaaactc 399
             ||||| ||||||||||||||||||
Sbjct: 83331 gctgttgttccagctctgaaactc 83354



to top

>gb|AC124529.3| Mus musculus BAC clone RP23-411I8 from chromosome 3, complete sequence
          Length = 192341

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 575   aattaatttcacatcttttg 594
             ||||||||||||||||||||
Sbjct: 45319 aattaatttcacatcttttg 45338



to top

>gb|AC121865.2| Mus musculus BAC clone RP24-112O1 from 8, complete sequence
          Length = 178620

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 428    cccagatgatccgaatttat 447
              ||||||||||||||||||||
Sbjct: 161077 cccagatgatccgaatttat 161096



to top

>gb|AC146745.20| Medicago truncatula clone mth2-53p19, complete sequence
          Length = 121952

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 216    ttttcaattgcaagatagtg 235
              ||||||||||||||||||||
Sbjct: 110623 ttttcaattgcaagatagtg 110604



to top

>gb|AC149637.11| Medicago truncatula clone mth2-181h2, complete sequence
          Length = 116616

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 216   ttttcaattgcaagatagtg 235
             ||||||||||||||||||||
Sbjct: 32125 ttttcaattgcaagatagtg 32106



to top

>gb|AC152751.22| Medicago truncatula clone mth2-18n7, complete sequence
          Length = 117170

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 560   tcgcagagcatcacaaattaattt 583
             ||||||||||| ||||||||||||
Sbjct: 79132 tcgcagagcattacaaattaattt 79109



to top

>emb|AL365258.24| Human DNA sequence from clone RP11-448G4 on chromosome 1 Contains the
             5' end of a novel gene, a eukaryotic translation
             elongation factor 1 alpha (EEF1A) pseudogene, a novel
             pseudogene, a novel gene and a ribosomal protein L24
             (RPL24) pseudogene, complete sequence
          Length = 129343

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 290   ttaccaaaatggtagctgct 309
             ||||||||||||||||||||
Sbjct: 64705 ttaccaaaatggtagctgct 64724



to top

>gb|AY218841.1| Danio rerio clone BUSM1-81J4 brahma protein-like protein 1 (brg1) and
            low density lipoprotein receptor (ldlr) genes, complete
            cds
          Length = 82729

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 622  atatatatgaattggagaaa 641
            ||||||||||||||||||||
Sbjct: 9445 atatatatgaattggagaaa 9426



to top

>emb|AL589699.4| Mouse DNA sequence from clone RP23-92G13 on chromosome 13 Contains the
             3' end of the gene for a novel protein similar to
             KIAA0386, five novel genes, the Gmnn gene for geminin,
             gene PNAS-27, the Ttrap gene for Traf and Tnf receptor
             associated protein, the gene for a novel protein similar
             to KIAA0319, the gene for the ortholog of human and rat
             aldehyde dehydrogenase 5A1 (succinate-semialdehyde
             dehydrogenase) (ALDH5A1) (SSADH), the 5' end of the Gpld1
             gene for glycosylphosphatidylinositol specific
             phospholipase D1 and four CpG islands, complete sequence
          Length = 256608

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 575   aattaatttcacatcttttg 594
             ||||||||||||||||||||
Sbjct: 28316 aattaatttcacatcttttg 28335



to top

>gb|AC154634.2| Mus musculus BAC clone RP23-298D14 from chromosome 14, complete sequence
          Length = 218356

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 622    atatatatgaattggagaaa 641
              ||||||||||||||||||||
Sbjct: 127230 atatatatgaattggagaaa 127211



to top

>gb|AC117507.5| Homo sapiens 3 BAC RP11-137K3 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 134182

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 174   cagcatccttcatgcttagc 193
             ||||||||||||||||||||
Sbjct: 68818 cagcatccttcatgcttagc 68837



to top

>gb|AC040968.6| Homo sapiens chromosome 11, clone RP11-372B5, complete sequence
          Length = 176988

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 361   ttcttcagtattcaagctgt 380
             ||||||||||||||||||||
Sbjct: 11864 ttcttcagtattcaagctgt 11883



to top

>emb|BX322663.8| Zebrafish DNA sequence from clone CH211-224D23 in linkage group 3,
             complete sequence
          Length = 145520

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 622   atatatatgaattggagaaa 641
             ||||||||||||||||||||
Sbjct: 35035 atatatatgaattggagaaa 35016



to top

>dbj|AK134538.1| Mus musculus adult male medulla oblongata cDNA, RIKEN full-length
            enriched library, clone:6330405L09 product:neurotrophic
            tyrosine kinase, receptor, type 2, full insert sequence
          Length = 5528

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 575  aattaatttcacatcttttg 594
            ||||||||||||||||||||
Sbjct: 5398 aattaatttcacatcttttg 5417



to top

>gb|AC067902.6| Homo sapiens chromosome 11, clone RP11-72C9, complete sequence
          Length = 189071

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 361   ttcttcagtattcaagctgt 380
             ||||||||||||||||||||
Sbjct: 84765 ttcttcagtattcaagctgt 84746



to top

>gb|AC012603.7| Homo sapiens chromosome 5 clone CTC-332L22, complete sequence
          Length = 146999

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 569    atcacaaattaatttcacat 588
              ||||||||||||||||||||
Sbjct: 137138 atcacaaattaatttcacat 137119



to top

>emb|BX255961.5| Zebrafish DNA sequence from clone DKEY-261N6 in linkage group 9,
             complete sequence
          Length = 176428

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 574   aaattaatttcacatctttt 593
             ||||||||||||||||||||
Sbjct: 54926 aaattaatttcacatctttt 54945



to top

>gb|AC069144.9|AC069144 Arabidopsis thaliana chromosome 1 BAC F14C21 genomic sequence, complete
             sequence
          Length = 102135

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 622   atatatatgaattggagaaa 641
             ||||||||||||||||||||
Sbjct: 53320 atatatatgaattggagaaa 53301



to top

>gb|AC019159.8| Homo sapiens BAC clone RP11-56O18 from 2, complete sequence
          Length = 163085

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 347   acactgtacccagcttcttcagtattca 374
             ||||||||||||| ||||||| ||||||
Sbjct: 72514 acactgtacccagtttcttcattattca 72541



to top

>gb|AC064840.2|AC064840 Arabidopsis thaliana chromosome I BAC T24C10 genomic sequence, complete
             sequence
          Length = 77923

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 622   atatatatgaattggagaaa 641
             ||||||||||||||||||||
Sbjct: 41252 atatatatgaattggagaaa 41271



to top

>gb|AC008417.3|AC008417 Homo sapiens chromosome 5 clone CTC-287O8, complete sequence
          Length = 216067

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 569   atcacaaattaatttcacat 588
             ||||||||||||||||||||
Sbjct: 99662 atcacaaattaatttcacat 99643



to top

>emb|AL626767.15| Mouse DNA sequence from clone RP23-421C7 on chromosome 4, complete
              sequence
          Length = 199694

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 573    caaattaatttcacatcttt 592
              ||||||||||||||||||||
Sbjct: 166787 caaattaatttcacatcttt 166768



to top

>gb|AC090673.5| Homo sapiens 12 BAC RP11-366L20 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 178755

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 574    aaattaatttcacatctttt 593
              ||||||||||||||||||||
Sbjct: 141619 aaattaatttcacatctttt 141638



to top

>dbj|AK122269.1| Mus musculus mRNA for mKIAA0386 protein
          Length = 5528

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 575  aattaatttcacatcttttg 594
            ||||||||||||||||||||
Sbjct: 5398 aattaatttcacatcttttg 5417



to top

>emb|CR855318.9| Zebrafish DNA sequence from clone DKEY-239I15 in linkage group 16,
              complete sequence
          Length = 150812

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 574    aaattaatttcacatctttt 593
              ||||||||||||||||||||
Sbjct: 107603 aaattaatttcacatctttt 107584



to top

>gb|AC139351.4| Mus musculus BAC clone RP24-156K15 from 8, complete sequence
          Length = 190998

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   cccagatgatccgaatttat 447
             ||||||||||||||||||||
Sbjct: 29265 cccagatgatccgaatttat 29284



to top

>gb|AC145931.4| Gallus gallus BAC clone CH261-32O1 from chromosome unknown, complete
            sequence
          Length = 202356

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 600  agagcattgtggaactcaaa 619
            ||||||||||||||||||||
Sbjct: 8758 agagcattgtggaactcaaa 8777



to top

>gb|BC060202.1| Mus musculus RIKEN cDNA 6330500D04 gene, mRNA (cDNA clone
            IMAGE:6854098), partial cds
          Length = 2789

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 575  aattaatttcacatcttttg 594
            ||||||||||||||||||||
Sbjct: 2641 aattaatttcacatcttttg 2660


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,193,288
Number of Sequences: 3902068
Number of extensions: 5193288
Number of successful extensions: 89747
Number of sequences better than 10.0: 44
Number of HSP's better than 10.0 without gapping: 44
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89629
Number of HSP's gapped (non-prelim): 118
length of query: 642
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 619
effective length of database: 17,143,297,704
effective search space: 10611701278776
effective search space used: 10611701278776
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top