Clone Name | rbah61l24 |
---|---|
Clone Library Name | barley_pub |
>dbj|D86327.1| Triticum aestivum mRNA for catalase, complete cds Length = 1573 Score = 432 bits (218), Expect = e-118 Identities = 284/306 (92%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||| | ||||||||||||||| ||||||||||| |||||||||||||| Sbjct: 1501 ttacatgctcggcttggagctgagacggctcgcgagcttctggccgagagacttgtcagc 1442 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 |||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| Sbjct: 1441 ctgagaccagtaggagagccagatggccttgatctcatgggtgaggcgggggtccgacag 1382 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1381 cgcgtcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 1322 Query: 460 ctcccctggctgcttgaagttgttctccttgtcaatgcatgccttctcgcggcggccgtt 519 |||||| ||||||||||||||||||||||| || || |||||||||||||||||| Sbjct: 1321 ctccccgggctgcttgaagttgttctccttctcgatcaccatcttctcgcggcggccgtt 1262 Query: 520 gagcgcgcgcgccgggatggggtagcggggcgcgtgcttggcggggtcgaacctggaggg 579 ||| | ||| | ||||||||||||||||||||||||||||||||||||||||| ||||| Sbjct: 1261 gagggtgcgggaggggatggggtagcggggcgcgtgcttggcggggtcgaaccttgaggg 1202 Query: 580 gaagta 585 |||||| Sbjct: 1201 gaagta 1196 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 173 tttgccgataagagggaaga 192 |||||||||||||||||||| Sbjct: 1573 tttgccgataagagggaaga 1554
>emb|AJ634002.1| Schedonorus arundinaceus mRNA for catalase (cat1 gene) Length = 1735 Score = 361 bits (182), Expect = 2e-96 Identities = 275/306 (89%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 |||||||||||||||| ||||||| |||| || |||||||| || |||||| ||||||| Sbjct: 1482 ttacatgctcggcttcacgctgaggcggccggccagcttctgtcccagagacctgtcagc 1423 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| || Sbjct: 1422 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgagggtcggagag 1363 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1362 ggcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 1303 Query: 460 ctcccctggctgcttgaagttgttctccttgtcaatgcatgccttctcgcggcggccgtt 519 ||||||||| |||||||||||||||||||| || || |||||||||||||||||| Sbjct: 1302 ctcccctggttgcttgaagttgttctccttctcgatcaccatcttctcgcggcggccgtt 1243 Query: 520 gagcgcgcgcgccgggatggggtagcggggcgcgtgcttggcggggtcgaacctggaggg 579 ||| | ||||| |||||||||||| | |||||||| |||| || || ||||||||||| Sbjct: 1242 gagtgtgcgcgacgggatggggtacctgggcgcgtctgtggcaggatcaaacctggaggg 1183 Query: 580 gaagta 585 |||||| Sbjct: 1182 gaagta 1177 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 33 ggctcttgtacacattattacatgaatgacagacg 67 |||||||||||| |||||||||||||||||||||| Sbjct: 1691 ggctcttgtacaaattattacatgaatgacagacg 1657
>gb|AY339372.1| Oryza sativa (japonica cultivar-group) catalase mRNA, complete cds Length = 1861 Score = 274 bits (138), Expect = 3e-70 Identities = 246/282 (87%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 1562 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 1503 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||||||||||||||||| | ||||||||||||||||||| ||||| || || Sbjct: 1502 ctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagagag 1443 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 || ||||||||||| |||||||| || |||||||||||||| ||| || |||||||| Sbjct: 1442 tgcgtcgatccatctcttgatgaaccggtcttgccttgccggatcccatgaacggtacct 1383 Query: 460 ctcccctggctgcttgaagttgttctccttgtcaatgcatgccttctcgcggcggccgtt 519 ||||||||||||||||||||||||||||||| |||| ||||||||||||||||| | Sbjct: 1382 ctcccctggctgcttgaagttgttctccttggcaatcaccaccttctcgcggcggccggt 1323 Query: 520 gagcgcgcgcgccgggatggggtagcggggcgcgtgcttggc 561 ||| | | | ||||||||||||||||| ||||||||||| Sbjct: 1322 gagggtggcggaggggatggggtagcggggggcgtgcttggc 1281
>dbj|AK066378.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013060B21, full insert sequence Length = 1945 Score = 274 bits (138), Expect = 3e-70 Identities = 246/282 (87%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 1688 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 1629 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||||||||||||||||| | ||||||||||||||||||| ||||| || || Sbjct: 1628 ctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagagag 1569 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 || ||||||||||| |||||||| || |||||||||||||| ||| || |||||||| Sbjct: 1568 tgcgtcgatccatctcttgatgaaccggtcttgccttgccggatcccatgaacggtacct 1509 Query: 460 ctcccctggctgcttgaagttgttctccttgtcaatgcatgccttctcgcggcggccgtt 519 ||||||||||||||||||||||||||||||| |||| ||||||||||||||||| | Sbjct: 1508 ctcccctggctgcttgaagttgttctccttggcaatcaccaccttctcgcggcggccggt 1449 Query: 520 gagcgcgcgcgccgggatggggtagcggggcgcgtgcttggc 561 ||| | | | ||||||||||||||||| ||||||||||| Sbjct: 1448 gagggtggcggaggggatggggtagcggggggcgtgcttggc 1407
>dbj|AK062174.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-C11, full insert sequence Length = 1763 Score = 274 bits (138), Expect = 3e-70 Identities = 246/282 (87%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 1540 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 1481 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||||||||||||||||| | ||||||||||||||||||| ||||| || || Sbjct: 1480 ctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagagag 1421 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 || ||||||||||| |||||||| || |||||||||||||| ||| || |||||||| Sbjct: 1420 tgcgtcgatccatctcttgatgaaccggtcttgccttgccggatcccatgaacggtacct 1361 Query: 460 ctcccctggctgcttgaagttgttctccttgtcaatgcatgccttctcgcggcggccgtt 519 ||||||||||||||||||||||||||||||| |||| ||||||||||||||||| | Sbjct: 1360 ctcccctggctgcttgaagttgttctccttggcaatcaccaccttctcgcggcggccggt 1301 Query: 520 gagcgcgcgcgccgggatggggtagcggggcgcgtgcttggc 561 ||| | | | ||||||||||||||||| ||||||||||| Sbjct: 1300 gagggtggcggaggggatggggtagcggggggcgtgcttggc 1259
>dbj|AB020502.1| Oryza sativa mRNA for catalase, complete cds Length = 1778 Score = 274 bits (138), Expect = 3e-70 Identities = 246/282 (87%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 1513 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 1454 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||||||||||||||||| | ||||||||||||||||||| ||||| || || Sbjct: 1453 ctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagagag 1394 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 || ||||||||||| |||||||| || |||||||||||||| ||| || |||||||| Sbjct: 1393 tgcgtcgatccatctcttgatgaaccggtcttgccttgccggatcccatgaacggtacct 1334 Query: 460 ctcccctggctgcttgaagttgttctccttgtcaatgcatgccttctcgcggcggccgtt 519 ||||||||||||||||||||||||||||||| |||| ||||||||||||||||| | Sbjct: 1333 ctcccctggctgcttgaagttgttctccttggcaatcaccaccttctcgcggcggccggt 1274 Query: 520 gagcgcgcgcgccgggatggggtagcggggcgcgtgcttggc 561 ||| | | | ||||||||||||||||| ||||||||||| Sbjct: 1273 gagggtggcggaggggatggggtagcggggggcgtgcttggc 1232
>ref|XM_470174.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1626 Score = 268 bits (135), Expect = 2e-68 Identities = 243/279 (87%) Strand = Plus / Minus Query: 283 catgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagcctg 342 |||||||||||||||||||||||||||||| || ||||| || |||||| |||||||||| Sbjct: 1476 catgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagcctg 1417 Query: 343 agaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacagcgc 402 |||||||||||||||||||||| | ||||||||||||||||||| ||||| || || || Sbjct: 1416 agaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagagagtgc 1357 Query: 403 atcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacctctc 462 ||||||||||| |||||||| || |||||||||||||| ||| || ||||||||||| Sbjct: 1356 gtcgatccatctcttgatgaaccggtcttgccttgccggatcccatgaacggtacctctc 1297 Query: 463 ccctggctgcttgaagttgttctccttgtcaatgcatgccttctcgcggcggccgttgag 522 |||||||||||||||||||||||||||| |||| ||||||||||||||||| |||| Sbjct: 1296 ccctggctgcttgaagttgttctccttggcaatcaccaccttctcgcggcggccggtgag 1237 Query: 523 cgcgcgcgccgggatggggtagcggggcgcgtgcttggc 561 | | | ||||||||||||||||| ||||||||||| Sbjct: 1236 ggtggcggaggggatggggtagcggggggcgtgcttggc 1198
>emb|X54819.1|ZMCAT2R Maize mRNA for catalase 2 Length = 1778 Score = 268 bits (135), Expect = 2e-68 Identities = 192/211 (90%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||| |||||||| |||||||| ||||||||||| |||||| |||| || Sbjct: 1515 ttacatgctcggcttggcgctgaggcggctcgcgagcttctggcccagagacctgtcggc 1456 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||| || Sbjct: 1455 ctgagaccagttggagagccagatggtcctgatctcgtgggtgaggcgggggtcggagag 1396 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 ||| |||| ||||||| | ||||| |||||||||||||| |||||||| | ||||||||| Sbjct: 1395 cgcgtcgacccatctggttatgaaccgctcttgccttgctgggtccatcgcgcggtacct 1336 Query: 460 ctcccctggctgcttgaagttgttctccttg 490 |||||| |||||||||||||||||||||||| Sbjct: 1335 ctccccgggctgcttgaagttgttctccttg 1305
>gb|AY107763.1| Zea mays PCO104975 mRNA sequence Length = 1200 Score = 268 bits (135), Expect = 2e-68 Identities = 192/211 (90%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||| |||||||| |||||||| ||||||||||| |||||| |||| || Sbjct: 731 ttacatgctcggcttggcgctgaggcggctcgcgagcttctggcccagagacctgtcggc 672 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||| || Sbjct: 671 ctgagaccagttggagagccagatggtcctgatctcgtgggtgaggcgggggtcggagag 612 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 ||| |||| ||||||| | ||||| |||||||||||||| |||||||| | ||||||||| Sbjct: 611 cgcgtcgacccatctggttatgaaccgctcttgccttgctgggtccatcgcgcggtacct 552 Query: 460 ctcccctggctgcttgaagttgttctccttg 490 |||||| |||||||||||||||||||||||| Sbjct: 551 ctccccgggctgcttgaagttgttctccttg 521
>gb|J02976.1|MZECAT2 Maize catalase (Cat2) mRNA, 3' end Length = 1793 Score = 268 bits (135), Expect = 2e-68 Identities = 192/211 (90%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||| |||||||| |||||||| ||||||||||| |||||| |||| || Sbjct: 1527 ttacatgctcggcttggcgctgaggcggctcgcgagcttctggcccagagacctgtcggc 1468 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||| |||||||||||||| | |||||||||||||||||||||||||||| || Sbjct: 1467 ctgagaccagttggagagccagatggtcctgatctcgtgggtgaggcgggggtcggagag 1408 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 ||| |||| ||||||| | ||||| |||||||||||||| |||||||| | ||||||||| Sbjct: 1407 cgcgtcgacccatctggttatgaaccgctcttgccttgctgggtccatcgcgcggtacct 1348 Query: 460 ctcccctggctgcttgaagttgttctccttg 490 |||||| |||||||||||||||||||||||| Sbjct: 1347 ctccccgggctgcttgaagttgttctccttg 1317
>gb|DQ118681.1| Oryza sativa (indica cultivar-group) catalase-C mRNA, complete cds Length = 1503 Score = 266 bits (134), Expect = 7e-68 Identities = 245/282 (86%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 1503 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 1444 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||||||||||||||||| | ||||||||||||||||||| ||| | || || Sbjct: 1443 ctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggccagagag 1384 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 || ||||||||||| |||||||| || |||||||||||||| ||| || |||||||| Sbjct: 1383 tgcgtcgatccatctcttgatgaaccggtcttgccttgccggatcccatgaacggtacct 1324 Query: 460 ctcccctggctgcttgaagttgttctccttgtcaatgcatgccttctcgcggcggccgtt 519 ||||||||||||||||||||||||||||||| |||| ||||||||||||||||| | Sbjct: 1323 ctcccctggctgcttgaagttgttctccttggcaatcaccaccttctcgcggcggccggt 1264 Query: 520 gagcgcgcgcgccgggatggggtagcggggcgcgtgcttggc 561 ||| | | | ||||||||||||||||| ||||||||||| Sbjct: 1263 gagggtggcggaggggatggggtagcggggggcgtgcttggc 1222
>gb|AY110648.1| Zea mays CL1739_1 mRNA sequence Length = 1813 Score = 238 bits (120), Expect = 2e-59 Identities = 187/211 (88%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||| |||||||| |||||||| ||||||||||| |||||| |||| || Sbjct: 1529 ttacatgctcggcttggcgctgaggcggctcgcgagcttctggcccagagacctgtcggc 1470 Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggacag 399 ||||||||||| |||||||||||||| | |||||||||||||||||| ||||| || Sbjct: 1469 ctgagaccagttggagagccagatggtcctgatctcgtgggtgaggcnnnnntcggagag 1410 Query: 400 cgcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacct 459 ||| |||| ||||||| | ||||| |||||||||||||| |||||||| | ||||||||| Sbjct: 1409 cgcgtcgacccatctggttatgaaccgctcttgccttgctgggtccatcgcgcggtacct 1350 Query: 460 ctcccctggctgcttgaagttgttctccttg 490 |||||| |||||||||||||||||||||||| Sbjct: 1349 ctccccgggctgcttgaagttgttctccttg 1319
>emb|Z54358.1|ZMCAT2GN Z.mays cat2 gene Length = 3662 Score = 121 bits (61), Expect = 3e-24 Identities = 88/97 (90%) Strand = Plus / Minus Query: 339 cctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggaca 398 |||||||||||| |||||||||||||| | |||||||||||||||||||||||||||| | Sbjct: 3490 cctgagaccagttggagagccagatggtcctgatctcgtgggtgaggcgggggtcggaga 3431 Query: 399 gcgcatcgatccatctgttgatgaatcgctcttgcct 435 |||| |||| ||||||| | ||||| ||||||||||| Sbjct: 3430 gcgcgtcgacccatctggttatgaaccgctcttgcct 3394 Score = 83.8 bits (42), Expect = 6e-13 Identities = 54/58 (93%) Strand = Plus / Minus Query: 433 ccttgccgggtccatggagcggtacctctcccctggctgcttgaagttgttctccttg 490 |||||| |||||||| | ||||||||||||||| |||||||||||||||||||||||| Sbjct: 3318 ccttgctgggtccatcgcgcggtacctctccccgggctgcttgaagttgttctccttg 3261 Score = 77.8 bits (39), Expect = 4e-11 Identities = 57/63 (90%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||| |||||||| |||||||| ||||||||||| |||||| |||| || Sbjct: 3662 ttacatgctcggcttggcgctgaggcggctcgcgagcttctggcccagagacctgtcggc 3603 Query: 340 ctg 342 ||| Sbjct: 3602 ctg 3600
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Plus Query: 339 cctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggaca 398 |||||||||||||||||||||||||| | ||||||||||||||||||| ||||| || | Sbjct: 1767799 cctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagaga 1767858 Query: 399 gcgcatcgatccatctgttgatgaatcgctcttgcct 435 | || ||||||||||| |||||||| || |||||||| Sbjct: 1767859 gtgcgtcgatccatctcttgatgaaccggtcttgcct 1767895 Score = 85.7 bits (43), Expect = 1e-13 Identities = 58/63 (92%) Strand = Plus / Plus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 1767619 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 1767678 Query: 340 ctg 342 ||| Sbjct: 1767679 ctg 1767681 Score = 79.8 bits (40), Expect = 9e-12 Identities = 43/44 (97%) Strand = Plus / Plus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 1768024 cggtacctctcccctggctgcttgaagttgttctccttggcaat 1768067 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 533 gggatggggtagcggggcgcgtgcttggc 561 ||||||||||||||||| ||||||||||| Sbjct: 1768474 gggatggggtagcggggggcgtgcttggc 1768502
>gb|AC098693.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1004C08, complete sequence Length = 133090 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Minus Query: 339 cctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggaca 398 |||||||||||||||||||||||||| | ||||||||||||||||||| ||||| || | Sbjct: 66563 cctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagaga 66504 Query: 399 gcgcatcgatccatctgttgatgaatcgctcttgcct 435 | || ||||||||||| |||||||| || |||||||| Sbjct: 66503 gtgcgtcgatccatctcttgatgaaccggtcttgcct 66467 Score = 85.7 bits (43), Expect = 1e-13 Identities = 58/63 (92%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 66743 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 66684 Query: 340 ctg 342 ||| Sbjct: 66683 ctg 66681 Score = 79.8 bits (40), Expect = 9e-12 Identities = 43/44 (97%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 66338 cggtacctctcccctggctgcttgaagttgttctccttggcaat 66295 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 533 gggatggggtagcggggcgcgtgcttggc 561 ||||||||||||||||| ||||||||||| Sbjct: 65888 gggatggggtagcggggggcgtgcttggc 65860
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Plus Query: 339 cctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggaca 398 |||||||||||||||||||||||||| | ||||||||||||||||||| ||||| || | Sbjct: 1767797 cctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagaga 1767856 Query: 399 gcgcatcgatccatctgttgatgaatcgctcttgcct 435 | || ||||||||||| |||||||| || |||||||| Sbjct: 1767857 gtgcgtcgatccatctcttgatgaaccggtcttgcct 1767893 Score = 85.7 bits (43), Expect = 1e-13 Identities = 58/63 (92%) Strand = Plus / Plus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 1767617 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 1767676 Query: 340 ctg 342 ||| Sbjct: 1767677 ctg 1767679 Score = 79.8 bits (40), Expect = 9e-12 Identities = 43/44 (97%) Strand = Plus / Plus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 1768022 cggtacctctcccctggctgcttgaagttgttctccttggcaat 1768065 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Plus Query: 533 gggatggggtagcggggcgcgtgcttggc 561 ||||||||||||||||| ||||||||||| Sbjct: 1768472 gggatggggtagcggggggcgtgcttggc 1768500
>dbj|D86611.1| Oryza sativa (japonica cultivar-group) CatC gene for catalase, complete cds Length = 4167 Score = 105 bits (53), Expect = 2e-19 Identities = 86/97 (88%) Strand = Plus / Minus Query: 339 cctgagaccagtaggagagccagatggccttgatctcgtgggtgaggcgggggtcggaca 398 |||||||||||||||||||||||||| | ||||||||||||||||||| ||||| || | Sbjct: 3696 cctgagaccagtaggagagccagatgctcctgatctcgtgggtgaggcgagggtcagaga 3637 Query: 399 gcgcatcgatccatctgttgatgaatcgctcttgcct 435 | || ||||||||||| |||||||| || |||||||| Sbjct: 3636 gtgcgtcgatccatctcttgatgaaccggtcttgcct 3600 Score = 85.7 bits (43), Expect = 1e-13 Identities = 58/63 (92%) Strand = Plus / Minus Query: 280 ttacatgctcggcttcgcgctgagacggctcgcaagcttctggccaagagacttgtcagc 339 ||||||||||||||||||||||||||||||||| || ||||| || |||||| ||||||| Sbjct: 3876 ttacatgctcggcttcgcgctgagacggctcgccagtttctgacccagagacctgtcagc 3817 Query: 340 ctg 342 ||| Sbjct: 3816 ctg 3814 Score = 79.8 bits (40), Expect = 9e-12 Identities = 43/44 (97%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 3471 cggtacctctcccctggctgcttgaagttgttctccttggcaat 3428 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 533 gggatggggtagcggggcgcgtgcttggc 561 ||||||||||||||||| ||||||||||| Sbjct: 3021 gggatggggtagcggggggcgtgcttggc 2993
>gb|AY173073.1| Hypericum perforatum catalase (cat1) mRNA, complete cds Length = 1800 Score = 75.8 bits (38), Expect = 1e-10 Identities = 101/122 (82%) Strand = Plus / Minus Query: 314 agcttctggccaagagacttgtcagcctgagaccagtaggagagccagatggccttgatc 373 |||||||| |||||||| ||||||||||| ||||||||| || ||||||||| |||| Sbjct: 1527 agcttctgaccaagagatttgtcagcctggtaccagtaggtgacccagatggctctgatt 1468 Query: 374 tcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatgaatcgctcttgc 433 || ||||||| |||||||| ||||||| ||||||||||||| ||| || |||||| Sbjct: 1467 tcatgggtgacacgggggtcagacagcgagctaatccatctgttgaggaagcgttcttgc 1408 Query: 434 ct 435 || Sbjct: 1407 ct 1406
>gb|AY128695.1| Capsicum annuum catalase 3 (CAT3) mRNA, complete cds Length = 1745 Score = 69.9 bits (35), Expect = 9e-09 Identities = 44/47 (93%) Strand = Plus / Minus Query: 314 agcttctggccaagagacttgtcagcctgagaccagtaggagagcca 360 |||||||| |||||||||||||||||||| |||||||| |||||||| Sbjct: 1477 agcttctgaccaagagacttgtcagcctgtgaccagtatgagagcca 1431 Score = 61.9 bits (31), Expect = 2e-06 Identities = 34/35 (97%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctc 486 ||||| ||||||||||||||||||||||||||||| Sbjct: 1339 cggtatctctcccctggctgcttgaagttgttctc 1305
>gb|AF104453.1|AF104453 Brassica juncea catalase (CAT3) mRNA, complete cds Length = 1769 Score = 69.9 bits (35), Expect = 9e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| ||||||||||| || |||| |||||||||||||||||||| |||| |||| Sbjct: 1519 agacggcttgcaagcttctgtcccagagttttgtcagcctgagaccagtaagagatccag 1460 Query: 362 atg 364 ||| Sbjct: 1459 atg 1457 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| ||||||||||||||| || ||||| Sbjct: 1369 cggtatctctctccaggctccttgaagttgttctctttctcaat 1326
>gb|AF104452.1|AF104452 Brassica juncea catalase (CAT2) mRNA, complete cds Length = 1778 Score = 69.9 bits (35), Expect = 9e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 ||||||||||| |||||||| || || ||||| ||||||||||||||||| |||| |||| Sbjct: 1520 agacggctcgccagcttctgtcccagtgacttatcagcctgagaccagtaagagatccag 1461 Query: 362 atg 364 ||| Sbjct: 1460 atg 1458
>gb|AF104451.1|AF104451 Brassica juncea catalase (CAT1) mRNA, complete cds Length = 1778 Score = 69.9 bits (35), Expect = 9e-09 Identities = 56/63 (88%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| ||||||||||| || |||| |||||||||||||||||||| |||| |||| Sbjct: 1511 agacggcttgcaagcttctgtcccagagttttgtcagcctgagaccagtaagagatccag 1452 Query: 362 atg 364 ||| Sbjct: 1451 atg 1449 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| ||||||||||||||| || ||||| Sbjct: 1349 cggtatctctctccaggctccttgaagttgttctctttctcaat 1306
>ref|NM_119675.2| Arabidopsis thaliana CAT2 (CATALASE 2); catalase AT4G35090 (CAT2) transcript variant AT4G35090.1 mRNA, complete cds Length = 1856 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| || |||||||| || | |||||| ||||||||||||||||| |||| |||| Sbjct: 1529 agacggcttgccagcttctgtcccaaagacttatcagcctgagaccagtaagagatccag 1470 Query: 362 atggccttgatctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatg 421 || ||| || || |||| ||| |||||||| || ||||| |||||||| | |||| Sbjct: 1469 atactgcggatttcatgcgtgatgcgtgggtcggatagggcatcaatccatctctggatg 1410 Query: 422 aatcgctcttgcct 435 ||||| |||||||| Sbjct: 1409 aatcgttcttgcct 1396
>gb|AY113854.1| Arabidopsis thaliana putative catalase (At4g35090) mRNA, complete cds Length = 1510 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| || |||||||| || | |||||| ||||||||||||||||| |||| |||| Sbjct: 1457 agacggcttgccagcttctgtcccaaagacttatcagcctgagaccagtaagagatccag 1398 Query: 362 atggccttgatctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatg 421 || ||| || || |||| ||| |||||||| || ||||| |||||||| | |||| Sbjct: 1397 atactgcggatttcatgcgtgatgcgtgggtcggatagggcatcaatccatctctggatg 1338 Query: 422 aatcgctcttgcct 435 ||||| |||||||| Sbjct: 1337 aatcgttcttgcct 1324
>gb|AY074301.1| Arabidopsis thaliana putative catalase (At4g35090) mRNA, complete cds Length = 1775 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| || |||||||| || | |||||| ||||||||||||||||| |||| |||| Sbjct: 1529 agacggcttgccagcttctgtcccaaagacttatcagcctgagaccagtaagagatccag 1470 Query: 362 atggccttgatctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatg 421 || ||| || || |||| ||| |||||||| || ||||| |||||||| | |||| Sbjct: 1469 atactgcggatttcatgcgtgatgcgtgggtcggatagggcatcaatccatctctggatg 1410 Query: 422 aatcgctcttgcct 435 ||||| |||||||| Sbjct: 1409 aatcgttcttgcct 1396
>emb|X64271.1|ATCATRNA A.thaliana mRNA for catalase Length = 1803 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| || |||||||| || | |||||| ||||||||||||||||| |||| |||| Sbjct: 1511 agacggcttgccagcttctgtcccaaagacttatcagcctgagaccagtaagagatccag 1452 Query: 362 atggccttgatctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatg 421 || ||| || || |||| ||| |||||||| || ||||| |||||||| | |||| Sbjct: 1451 atactgcggatttcatgcgtgatgcgtgggtcggatagggcatcaatccatctctggatg 1392 Query: 422 aatcgctcttgcct 435 ||||| |||||||| Sbjct: 1391 aatcgttcttgcct 1378
>dbj|AK221016.1| Arabidopsis thaliana mRNA for catalase, partial cds, clone: RAFL22-68-I09 Length = 628 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| || |||||||| || | |||||| ||||||||||||||||| |||| |||| Sbjct: 307 agacggcttgccagcttctgtcccaaagacttatcagcctgagaccagtaagagatccag 248 Query: 362 atggccttgatctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatg 421 || ||| || || |||| ||| |||||||| || ||||| |||||||| | |||| Sbjct: 247 atactgcggatttcatgcgtgatgcgtgggtcggatagggcatcaatccatctctggatg 188 Query: 422 aatcgctcttgcct 435 ||||| |||||||| Sbjct: 187 aatcgttcttgcct 174
>gb|AY054663.1| Arabidopsis thaliana catalase (At4g35090; M4E13.140) mRNA, complete cds Length = 1759 Score = 67.9 bits (34), Expect = 4e-08 Identities = 109/134 (81%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| || |||||||| || | |||||| ||||||||||||||||| |||| |||| Sbjct: 1529 agacggcttgccagcttctgtcccaaagacttatcagcctgagaccagtaagagatccag 1470 Query: 362 atggccttgatctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatg 421 || ||| || || |||| ||| |||||||| || ||||| |||||||| | |||| Sbjct: 1469 atactgcggatttcatgcgtgatgcgtgggtcggatagggcatcaatccatctctggatg 1410 Query: 422 aatcgctcttgcct 435 ||||| |||||||| Sbjct: 1409 aatcgttcttgcct 1396
>emb|X12539.1|ZMCAT3 Maize cat-3 mRNA for catalase-3 isoenzyme (EC 1.11.1.6) Length = 1801 Score = 63.9 bits (32), Expect = 5e-07 Identities = 32/32 (100%) Strand = Plus / Minus Query: 448 ggagcggtacctctcccctggctgcttgaagt 479 |||||||||||||||||||||||||||||||| Sbjct: 1341 ggagcggtacctctcccctggctgcttgaagt 1310
>gb|AF236127.1| Vitis vinifera catalase (GCat) mRNA, complete cds Length = 1779 Score = 63.9 bits (32), Expect = 5e-07 Identities = 74/88 (84%) Strand = Plus / Minus Query: 409 ccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacctctcccctgg 468 ||||||||||||||| ||||||||||| |||| | | || ||||| ||||| || || Sbjct: 1386 ccatctgttgatgaaacgctcttgcctgtccggtgcaaatgaacggtatctctcaccagg 1327 Query: 469 ctgcttgaagttgttctccttgtcaatg 496 ||||||||| ||||||||||| |||||| Sbjct: 1326 ctgcttgaaattgttctccttctcaatg 1299 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagacca 348 ||||||||||| || |||||| |||||||||||||||| Sbjct: 1484 gcaagcttctgacccagagacctgtcagcctgagacca 1447
>gb|AF243517.1|AF243517 Helianthus annuus catalase 2 (CATA2) mRNA, complete cds Length = 1736 Score = 63.9 bits (32), Expect = 5e-07 Identities = 35/36 (97%) Strand = Plus / Minus Query: 316 cttctggccaagagacttgtcagcctgagaccagta 351 |||||| ||||||||||||||||||||||||||||| Sbjct: 1494 cttctgcccaagagacttgtcagcctgagaccagta 1459 Score = 50.1 bits (25), Expect = 0.008 Identities = 28/29 (96%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaagttgttctc 486 ||||| ||||||||||||||||||||||| Sbjct: 1352 ctctctcctggctgcttgaagttgttctc 1324
>gb|AY104630.1| Zea mays PCO080157 mRNA sequence Length = 1960 Score = 63.9 bits (32), Expect = 5e-07 Identities = 32/32 (100%) Strand = Plus / Minus Query: 448 ggagcggtacctctcccctggctgcttgaagt 479 |||||||||||||||||||||||||||||||| Sbjct: 1491 ggagcggtacctctcccctggctgcttgaagt 1460
>gb|L05934.1|MZECAT3GN Zea mays catalase (Cat3) gene, complete cds Length = 6041 Score = 63.9 bits (32), Expect = 5e-07 Identities = 32/32 (100%) Strand = Plus / Minus Query: 448 ggagcggtacctctcccctggctgcttgaagt 479 |||||||||||||||||||||||||||||||| Sbjct: 4008 ggagcggtacctctcccctggctgcttgaagt 3977
>gb|M33103.1|MZECAT3 Z.mays catalase isozyme 3 (CAT-3) mRNA, complete cds Length = 1790 Score = 63.9 bits (32), Expect = 5e-07 Identities = 32/32 (100%) Strand = Plus / Minus Query: 448 ggagcggtacctctcccctggctgcttgaagt 479 |||||||||||||||||||||||||||||||| Sbjct: 1341 ggagcggtacctctcccctggctgcttgaagt 1310
>ref|NM_101914.2| Arabidopsis thaliana CAT1 (CATALASE 1); catalase AT1G20630 (CAT1) mRNA, complete cds Length = 1929 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| ||||||||||| |||||||||||||||||||| Sbjct: 1389 cggtatctctcccctggttgcttgaagttgttctcctt 1352 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 317 ttctggccaagagacttgtcagcctgagaccagtaggaga 356 ||||| || ||||| ||||| |||||||||||||| |||| Sbjct: 1524 ttctgtcccagagatttgtctgcctgagaccagtaagaga 1485
>gb|U43340.1| Arabidopsis thaliana catalase 1 (CAT1) mRNA, complete cds Length = 1928 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| ||||||||||| |||||||||||||||||||| Sbjct: 1388 cggtatctctcccctggttgcttgaagttgttctcctt 1351 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 317 ttctggccaagagacttgtcagcctgagaccagtaggaga 356 ||||| || ||||| ||||| |||||||||||||| |||| Sbjct: 1523 ttctgtcccagagatttgtctgcctgagaccagtaagaga 1484
>gb|BT010373.1| Arabidopsis thaliana At1g20630 mRNA, complete cds Length = 1479 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| ||||||||||| |||||||||||||||||||| Sbjct: 1307 cggtatctctcccctggttgcttgaagttgttctcctt 1270 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 317 ttctggccaagagacttgtcagcctgagaccagtaggaga 356 ||||| || ||||| ||||| |||||||||||||| |||| Sbjct: 1442 ttctgtcccagagatttgtctgcctgagaccagtaagaga 1403
>gb|AY136424.1| Arabidopsis thaliana expressed protein (At1g20630) mRNA, complete cds Length = 1746 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| ||||||||||| |||||||||||||||||||| Sbjct: 1389 cggtatctctcccctggttgcttgaagttgttctcctt 1352 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 317 ttctggccaagagacttgtcagcctgagaccagtaggaga 356 ||||| || ||||| ||||| |||||||||||||| |||| Sbjct: 1524 ttctgtcccagagatttgtctgcctgagaccagtaagaga 1485
>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I, complete sequence Length = 143879 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| ||||||||||| |||||||||||||||||||| Sbjct: 39793 cggtatctctcccctggttgcttgaagttgttctcctt 39756 Score = 44.1 bits (22), Expect = 0.51 Identities = 40/46 (86%) Strand = Plus / Minus Query: 339 cctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 36500 cctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 36455 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 317 ttctggccaagagacttgtcagcctgagaccagtaggaga 356 ||||| || ||||| ||||| |||||||||||||| |||| Sbjct: 40030 ttctgtcccagagatttgtctgcctgagaccagtaagaga 39991
>gb|AC027665.4|AC027665 Genomic sequence for Arabidopsis thaliana BAC F5M15 from chromosome I, complete sequence Length = 99231 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Plus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| ||||||||||| |||||||||||||||||||| Sbjct: 15322 cggtatctctcccctggttgcttgaagttgttctcctt 15359 Score = 44.1 bits (22), Expect = 0.51 Identities = 40/46 (86%) Strand = Plus / Plus Query: 339 cctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 18615 cctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 18660 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Plus Query: 317 ttctggccaagagacttgtcagcctgagaccagtaggaga 356 ||||| || ||||| ||||| |||||||||||||| |||| Sbjct: 15085 ttctgtcccagagatttgtctgcctgagaccagtaagaga 15124
>gb|AF031318.2|AF031318 Raphanus sativus catalase (Cat1) mRNA, complete cds Length = 1658 Score = 60.0 bits (30), Expect = 9e-06 Identities = 54/62 (87%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccag 361 |||||||| || |||||||| || || ||||| ||||||||||||||||| |||| |||| Sbjct: 1512 agacggcttgccagcttctgtcccagtgacttatcagcctgagaccagtaagagatccag 1453 Query: 362 at 363 || Sbjct: 1452 at 1451 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| ||||||||||||||| || ||||| Sbjct: 1362 cggtatctctctccaggctccttgaagttgttctctttctcaat 1319
>gb|AF021937.1|AF021937 Arabidopsis thaliana catalase 3 (CAT3) and catalase 1 (CAT1) genes, complete cds Length = 7707 Score = 60.0 bits (30), Expect = 9e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| ||||||||||| |||||||||||||||||||| Sbjct: 6858 cggtatctctcccctggttgcttgaagttgttctcctt 6821 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Minus Query: 317 ttctggccaagagacttgtcagcctgagaccagtaggaga 356 ||||| || ||||| ||||| |||||||||||||| |||| Sbjct: 7095 ttctgtcccagagatttgtctgcctgagaccagtaagaga 7056
>gb|BT018650.1| Zea mays clone EL01N0505F10.d mRNA sequence Length = 1928 Score = 56.0 bits (28), Expect = 1e-04 Identities = 61/72 (84%) Strand = Plus / Minus Query: 418 gatgaatcgctcttgccttgccgggtccatggagcggtacctctcccctggctgcttgaa 477 |||||| || ||||||||||| ||||| | ||| || || ||||| || | ||||||||| Sbjct: 1416 gatgaaccggtcttgccttgcagggtcgaaggaacgatatctctcgccagcctgcttgaa 1357 Query: 478 gttgttctcctt 489 |||||||||||| Sbjct: 1356 gttgttctcctt 1345
>emb|Z12021.1|GMCATALG G.max gene for catalase Length = 4687 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| |||||||| || |||||||||||||||||||| ||||| Sbjct: 3834 cggtatctctccccaggttgcttgaagttgttctccttctcaat 3791
>emb|X12538.1|ZMCAT1 Maize cat-1 mRNA for catalase-1 isoenzyme (EC 1.11.1.6) Length = 2079 Score = 56.0 bits (28), Expect = 1e-04 Identities = 61/72 (84%) Strand = Plus / Minus Query: 418 gatgaatcgctcttgccttgccgggtccatggagcggtacctctcccctggctgcttgaa 477 |||||| || ||||||||||| ||||| | ||| || || ||||| || | ||||||||| Sbjct: 1509 gatgaaccggtcttgccttgcagggtcgaaggaacgatatctctcgccagcctgcttgaa 1450 Query: 478 gttgttctcctt 489 |||||||||||| Sbjct: 1449 gttgttctcctt 1438
>gb|AF390210.2| Suaeda maritima subsp. salsa catalase (CAT1) mRNA, complete cds Length = 1791 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 422 aatcgctcttgccttgccgggtccatggagcggtacctctcccctggctgcttgaagttg 481 |||| ||||||||| || |||||||| || | ||| ||||| || ||||||||||||||| Sbjct: 1392 aatctctcttgcctagctgggtccattgatctgtatctctctccaggctgcttgaagttg 1333 Query: 482 ttctcctt 489 || ||||| Sbjct: 1332 ttttcctt 1325 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 326 agagacttgtcagcctgagaccagta 351 ||||| |||||||||||||||||||| Sbjct: 1488 agagatttgtcagcctgagaccagta 1463
>emb|AJ874264.1| Populus deltoides cat2 gene for catalase, exons 1-8 Length = 3147 Score = 56.0 bits (28), Expect = 1e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctg 342 |||||||||||||| ||||||||||||||||| Sbjct: 2962 gcaagcttctggcccagagacttgtcagcctg 2931 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||||||||||||| |||||||| ||||| Sbjct: 2500 cggtatctctcgccaggctgcttgaagttattctccttctcaat 2457
>gb|AY103601.1| Zea mays PCO144994 mRNA sequence Length = 2149 Score = 56.0 bits (28), Expect = 1e-04 Identities = 61/72 (84%) Strand = Plus / Minus Query: 418 gatgaatcgctcttgccttgccgggtccatggagcggtacctctcccctggctgcttgaa 477 |||||| || ||||||||||| ||||| | ||| || || ||||| || | ||||||||| Sbjct: 1579 gatgaaccggtcttgccttgcagggtcgaaggaacgatatctctcgccagcctgcttgaa 1520 Query: 478 gttgttctcctt 489 |||||||||||| Sbjct: 1519 gttgttctcctt 1508
>gb|AF069319.1|AF069319 Mesembryanthemum crystallinum leaf catalase mRNA, complete cds Length = 1845 Score = 56.0 bits (28), Expect = 1e-04 Identities = 58/68 (85%) Strand = Plus / Minus Query: 422 aatcgctcttgccttgccgggtccatggagcggtacctctcccctggctgcttgaagttg 481 |||| |||||||||||| |||||| || | ||| ||||| ||||| |||||||||||| Sbjct: 1424 aatctctcttgccttgctgggtcccatgacctgtatctctctcctggttgcttgaagttg 1365 Query: 482 ttctcctt 489 |||||||| Sbjct: 1364 ttctcctt 1357
>gb|AF035255.1|AF035255 Glycine max catalase (cat4) mRNA, complete cds Length = 1719 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || ||||||||||||||||||||||| ||||| Sbjct: 1344 cggtatctctctccgggctgcttgaagttgttctccttctcaat 1301
>gb|AF035254.1|AF035254 Glycine max catalase (cat3) mRNA, complete cds Length = 1715 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| |||||||| || |||||||||||||||||||| ||||| Sbjct: 1312 cggtatctctccccaggttgcttgaagttgttctccttctcaat 1269
>gb|AF035253.1|AF035253 Glycine max catalase (cat2) mRNA, complete cds Length = 1831 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| |||||||| || |||||||||||||||||||| ||||| Sbjct: 1344 cggtatctctccccaggttgcttgaagttgttctccttctcaat 1301
>gb|AF035252.1|AF035252 Glycine max catalase (cat1) mRNA, complete cds Length = 1733 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| |||||||| || |||||||||||||||||||| ||||| Sbjct: 1359 cggtatctctccccaggttgcttgaagttgttctccttctcaat 1316
>dbj|AP006107.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT29P11, TM0193, complete sequence Length = 102354 Score = 56.0 bits (28), Expect = 1e-04 Identities = 40/44 (90%) Strand = Plus / Plus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || ||||||||||||||||||||||| ||||| Sbjct: 64736 cggtatctctctccaggctgcttgaagttgttctccttctcaat 64779
>gb|U93244.1|NTU93244 Nicotiana tabacum catalase 1 (cat1) mRNA, complete cds Length = 1756 Score = 54.0 bits (27), Expect = 5e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccagatgg 365 |||||||| || || ||||| |||||||||||||||||||| |||| ||| |||| Sbjct: 1500 gcaagcttttgacccagagatttgtcagcctgagaccagtatgagatccaaatgg 1446
>gb|AY442179.2| Solanum tuberosum catalase mRNA, partial cds Length = 1648 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagtaggaga 356 |||||||| || || | |||||||||||||||||||||||| |||| Sbjct: 1397 gcaagcttttgacccaaagacttgtcagcctgagaccagtatgaga 1352
>ref|NM_101913.2| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3) transcript variant AT1G20620.1 mRNA, complete cds Length = 1832 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 335 tcagcctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1483 tcagcctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1434
>ref|NM_202144.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3) transcript variant AT1G20620.2 mRNA, complete cds Length = 1931 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 335 tcagcctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1582 tcagcctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1533
>ref|NM_001035994.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3) transcript variant AT1G20620.3 mRNA, complete cds Length = 1901 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 335 tcagcctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1499 tcagcctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1450
>ref|XM_507430.1| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.27-1 mRNA Length = 1874 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 1377 gtacctctccccgggctgcttgaagtcgttctgcttgt 1340
>ref|XM_463869.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1874 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 1377 gtacctctccccgggctgcttgaagtcgttctgcttgt 1340
>ref|XM_506682.2| PREDICTED Oryza sativa (japonica cultivar-group), P0036E06.27-1 mRNA Length = 1876 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 1379 gtacctctccccgggctgcttgaagtcgttctgcttgt 1342
>ref|XM_463870.1| Oryza sativa (japonica cultivar-group), mRNA Length = 977 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 517 gtacctctccccgggctgcttgaagtcgttctgcttgt 480
>emb|X71653.1|SMCATSM S.melongena CATSM mRNA for catalase Length = 1691 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| |||||||||| ||| ||||||||||||||||| Sbjct: 1326 cggtatctctcccctgcctgtttgaagttgttctcctt 1289
>emb|X61626.1|OSCATAL O.sativa mRNA for catalase Length = 1865 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 1336 gtacctctccccgggctgcttgaagtcgttctgcttgt 1299
>gb|AY128694.1| Capsicum annuum catalase 2 (CAT2) mRNA, partial cds Length = 1680 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagtaggaga 356 |||||||| || || ||||| |||||||||||||||||||| |||| Sbjct: 1425 gcaagcttttgacccagagatttgtcagcctgagaccagtatgaga 1380
>gb|AY058104.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, complete cds Length = 1759 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 335 tcagcctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1481 tcagcctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1432
>gb|AY056447.1| Arabidopsis thaliana At1g20620/F5M15_4 mRNA, complete cds Length = 1757 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 335 tcagcctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1478 tcagcctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1429
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 825892 gtacctctccccgggctgcttgaagtcgttctgcttgt 825929
>emb|BX815559.1|CNS0ABH4 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS71ZD06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1709 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 335 tcagcctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1458 tcagcctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1409
>gb|AY087477.1| Arabidopsis thaliana clone 35868 mRNA, complete sequence Length = 1756 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Minus Query: 335 tcagcctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1481 tcagcctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1432
>dbj|AP004121.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1442_E05 Length = 162407 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 35100 gtacctctccccgggctgcttgaagtcgttctgcttgt 35137
>dbj|AP004867.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0036E06 Length = 137926 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Plus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 104023 gtacctctccccgggctgcttgaagtcgttctgcttgt 104060
>dbj|AK099923.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116M08, full insert sequence Length = 1875 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 1378 gtacctctccccgggctgcttgaagtcgttctgcttgt 1341
>dbj|AK099231.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013095I04, full insert sequence Length = 1873 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 1376 gtacctctccccgggctgcttgaagtcgttctgcttgt 1339
>dbj|AK071061.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023079C18, full insert sequence Length = 977 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 517 gtacctctccccgggctgcttgaagtcgttctgcttgt 480
>dbj|AK065094.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001M08, full insert sequence Length = 1873 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 1376 gtacctctccccgggctgcttgaagtcgttctgcttgt 1339
>gb|U68219.2|BNU68219 Brassica napus catalase (LSC650) mRNA, partial cds Length = 1728 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 464 cctggctgcttgaagttgttctcctt 489 |||||||||||||||||||||||||| Sbjct: 1335 cctggctgcttgaagttgttctcctt 1310 Score = 44.1 bits (22), Expect = 0.51 Identities = 28/30 (93%) Strand = Plus / Minus Query: 335 tcagcctgagaccagtaggagagccagatg 364 ||||||||||||||||| |||| ||||||| Sbjct: 1464 tcagcctgagaccagtaagagatccagatg 1435
>gb|AF006067.1|AF006067 Nicotiana glutinosa catalase-1 mRNA, complete cds Length = 1744 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagtaggaga 356 |||||||| || || ||||| |||||||||||||||||||| |||| Sbjct: 1488 gcaagcttttgacccagagatttgtcagcctgagaccagtatgaga 1443 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 449 gagcggtacctctcccctggctgcttgaagttgttctc 486 ||||||||||| || ||||| |||||||| |||||||| Sbjct: 1350 gagcggtacctttctcctggttgcttgaaattgttctc 1313
>dbj|D29966.1|RICCA Rice CatA gene for catalase, complete cds Length = 4670 Score = 52.0 bits (26), Expect = 0.002 Identities = 35/38 (92%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctccttgt 491 |||||||||||| ||||||||||||| ||||| ||||| Sbjct: 3269 gtacctctccccgggctgcttgaagtcgttctgcttgt 3232
>dbj|D55645.1|CUCCAT1 Pumpkin mRNA for catalase (cat1), complete cds Length = 1800 Score = 52.0 bits (26), Expect = 0.002 Identities = 148/186 (79%), Gaps = 2/186 (1%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccagatggccttg 370 ||||||||||| ||||||||| | || |||||||||||||| || | ||| ||| | Sbjct: 1563 gcaagcttctgaccaagagacctatccgcctgagaccagtatgaaatccatatgctgcgg 1504 Query: 371 atctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatgaatcgctct 430 ||||| ||||||| |||| |||||||| ||||| | ||||||| || |||||| ||| Sbjct: 1503 atctcatgggtgactcgggtgtcggacaaagcatcaacccatctgcggacgaatcgttct 1444 Query: 431 tgccttgccgg-gtccatggagcggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| | || ||||| || | ||| ||||| || |||| |||||||||||||||||| Sbjct: 1443 tgcctgtctggtgtcca-agatctgtatctctctccaggctccttgaagttgttctcctt 1385 Query: 490 gtcaat 495 ||||| Sbjct: 1384 ttcaat 1379
>gb|BT012965.1| Lycopersicon esculentum clone 114156F, mRNA sequence Length = 1794 Score = 50.1 bits (25), Expect = 0.008 Identities = 37/41 (90%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagta 351 |||||||| || || | |||||||||||||||||||||||| Sbjct: 1540 gcaagcttttgacccaaagacttgtcagcctgagaccagta 1500 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 449 gagcggtacctctcccctggctgcttgaagttgttctc 486 ||||||||||| || ||||| |||||||| |||||||| Sbjct: 1402 gagcggtacctttctcctggttgcttgaaattgttctc 1365
>gb|AY500290.1| Solanum tuberosum catalase (CAT2) mRNA, complete cds Length = 1761 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctc 486 |||||||||||||| ||| |||||||||||||| Sbjct: 1305 gtacctctcccctgcctgtttgaagttgttctc 1273
>emb|Z37106.1|STCATGP S.tuberosum cat gene encoding catalase (partial) Length = 4272 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctc 486 |||||||||||||| ||| |||||||||||||| Sbjct: 3109 gtacctctcccctgcctgtttgaagttgttctc 3077
>emb|X52135.1|GHCAT1 Cotton mRNA for cottonseed catalase subunit 1 (EC 1.11.1.6) Length = 1666 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaatg 496 ||||| ||||| || ||||| ||||||||||||||||| |||||| Sbjct: 1355 cggtatctctctccgggctgtttgaagttgttctccttctcaatg 1311
>gb|AY973614.1| Manihot esculenta catalase CAT2 mRNA, partial cds Length = 1001 Score = 50.1 bits (25), Expect = 0.008 Identities = 46/53 (86%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccagat 363 ||||||||||| |||||||| ||||| |||||||||||| |||| |||||| Sbjct: 783 gcaagcttctgaccaagagatttgtcgcactgagaccagtatgagacccagat 731 Score = 44.1 bits (22), Expect = 0.51 Identities = 28/30 (93%) Strand = Plus / Minus Query: 467 ggctgcttgaagttgttctccttgtcaatg 496 ||||||||||| ||||||||||| |||||| Sbjct: 627 ggctgcttgaaattgttctccttctcaatg 598
>emb|AJ874263.1| Populus deltoides cat1 gene for catalase, exons 1-8 Length = 3947 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaatg 496 ||||| ||||| || || |||||||||||||||||||| |||||| Sbjct: 3371 cggtatctctctccaggttgcttgaagttgttctccttctcaatg 3327
>gb|AF112368.1|AF112368 Lycopersicon esculentum catalase 2 mRNA, complete cds Length = 1725 Score = 50.1 bits (25), Expect = 0.008 Identities = 37/41 (90%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagta 351 |||||||| || || | |||||||||||||||||||||||| Sbjct: 1470 gcaagcttttgacccaaagacttgtcagcctgagaccagta 1430 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 449 gagcggtacctctcccctggctgcttgaagttgttctc 486 ||||||||||| || ||||| |||||||| |||||||| Sbjct: 1332 gagcggtacctttctcctggttgcttgaaattgttctc 1295
>gb|DQ294281.1| Solanum tuberosum clone 048E08 catalase isozyme 1-like protein mRNA, complete cds Length = 1746 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctc 486 |||||||||||||| ||| |||||||||||||| Sbjct: 1345 gtacctctcccctgcctgtttgaagttgttctc 1313
>gb|DQ268837.1| Solanum tuberosum clone 120C07 catalase isozyme 1-like protein mRNA, complete cds Length = 1525 Score = 50.1 bits (25), Expect = 0.008 Identities = 31/33 (93%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctc 486 |||||||||||||| ||| |||||||||||||| Sbjct: 1348 gtacctctcccctgcctgtttgaagttgttctc 1316
>emb|X94447.1|ATCATAL A.thaliana cat gene for catalase Length = 3677 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| |||||||||||||||||| ||||| Sbjct: 3288 cggtatctctctccaggctccttgaagttgttctccttctcaat 3245 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 302 agacggctcgcaagcttctggccaagagacttgtcagcctg 342 |||||||| || |||||||| || | ||||||||||||||| Sbjct: 3629 agacggcttgccagcttctgtcccaaagacttgtcagcctg 3589
>gb|AF104454.1|AF104454 Brassica juncea catalase (CAT4) mRNA, complete cds Length = 1792 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| |||||||||||||||||| ||||| Sbjct: 1380 cggtatctctctccaggctccttgaagttgttctccttctcaat 1337 Score = 46.1 bits (23), Expect = 0.13 Identities = 44/51 (86%) Strand = Plus / Minus Query: 314 agcttctggccaagagacttgtcagcctgagaccagtaggagagccagatg 364 |||||||| || || ||||| ||||||||||||||||| || | ||||||| Sbjct: 1518 agcttctgtcccagtgacttatcagcctgagaccagtaagatatccagatg 1468
>gb|AF035256.1|AF035256 Glycine max catalase (cat5) mRNA, partial cds Length = 1134 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||||||| |||||||||||||| ||||| Sbjct: 757 cggtatctctctccgggctgcttaaagttgttctccttctcaat 714
>gb|L28740.1|HNNCATA Helianthus annuus catalase mRNA, complete cds Length = 1735 Score = 48.1 bits (24), Expect = 0.033 Identities = 33/36 (91%) Strand = Plus / Minus Query: 316 cttctggccaagagacttgtcagcctgagaccagta 351 |||||| || ||||||||||||||||| |||||||| Sbjct: 1459 cttctgtcccagagacttgtcagcctgggaccagta 1424 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaagttgtt 483 ||||| |||||||||||||||||||| Sbjct: 1317 ctctctcctggctgcttgaagttgtt 1292
>emb|Z54143.2|SSCATMR Secale cereale mRNA for catalase (cat1a gene) Length = 1747 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Minus Query: 451 gcggtacctctcccctggctgcttgaagttgttctcctt 489 ||||||||||||||| |||||| ||||| ||||||||| Sbjct: 1389 gcggtacctctccccgggctgcacgaagtcgttctcctt 1351
>emb|Z36977.1|NPCAT3MR N.plumbaginifolia mRNA for catalase (cat3 gene) Length = 1688 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaagttgttctccttgtcaatg 496 ||||| || |||||||||||||||||||| || |||||| Sbjct: 1335 ctctctcccggctgcttgaagttgttctctttttcaatg 1297 Score = 40.1 bits (20), Expect = 8.0 Identities = 32/36 (88%) Strand = Plus / Minus Query: 316 cttctggccaagagacttgtcagcctgagaccagta 351 |||||| ||||||| ||||||||||| |||||||| Sbjct: 1477 cttctgaccaagagttttgtcagcctgtgaccagta 1442
>emb|Z36976.1|NPCAT2MR N.plumbaginifolia mRNA for catalase (cat2 gene) Length = 1716 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaagttgttctccttgtcaatg 496 ||||| |||| |||||||||||||||||| || |||||| Sbjct: 1346 ctctctcctgcctgcttgaagttgttctctttctcaatg 1308 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 328 agacttgtcagcctgagaccagta 351 ||||||||||||||||||| |||| Sbjct: 1476 agacttgtcagcctgagacaagta 1453
>emb|Z36975.1|NPCAT1MR N.plumbaginifolia mRNA for catalase (cat1 gene) Length = 1693 Score = 46.1 bits (23), Expect = 0.13 Identities = 29/31 (93%) Strand = Plus / Minus Query: 326 agagacttgtcagcctgagaccagtaggaga 356 ||||| |||||||||||||||||||| |||| Sbjct: 1413 agagatttgtcagcctgagaccagtatgaga 1383 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 449 gagcggtacctctcccctggctgcttgaagttgttctc 486 ||||||||||| || ||||| |||||||| |||||||| Sbjct: 1290 gagcggtacctttctcctggttgcttgaaattgttctc 1253
>emb|AJ849640.1| Secale cereale mRNA for catalase (cat1b gene) Length = 1781 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Minus Query: 451 gcggtacctctcccctggctgcttgaagttgttctcctt 489 ||||||||||||||| |||||| ||||| ||||||||| Sbjct: 1393 gcggtacctctccccgggctgcacgaagtcgttctcctt 1355
>emb|AJ234405.1|HVU234405 Hordeum vulgare partial mRNA; clone cMWG0652.rev Length = 357 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Plus Query: 451 gcggtacctctcccctggctgcttgaagttgttctcctt 489 ||||||||||||||| |||||| ||||| ||||||||| Sbjct: 242 gcggtacctctccccgggctgcacgaagtcgttctcctt 280
>dbj|AB109090.1| Acacia ampliceps cat mRNA for catalase, complete cds Length = 1833 Score = 46.1 bits (23), Expect = 0.13 Identities = 32/35 (91%) Strand = Plus / Minus Query: 461 tcccctggctgcttgaagttgttctccttgtcaat 495 ||||| || |||||||||||||||||||| ||||| Sbjct: 1364 tccccgggttgcttgaagttgttctccttctcaat 1330
>gb|AF021939.1|AF021939 Hordeum vulgare catalase 2 (CAT2) gene, partial cds Length = 1326 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Minus Query: 451 gcggtacctctcccctggctgcttgaagttgttctcctt 489 ||||||||||||||| |||||| ||||| ||||||||| Sbjct: 1014 gcggtacctctccccgggctgcacgaagtcgttctcctt 976
>gb|U20778.1|HVU20778 Hordeum vulgare catalase (Cat2) mRNA, complete cds Length = 1756 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Minus Query: 451 gcggtacctctcccctggctgcttgaagttgttctcctt 489 ||||||||||||||| |||||| ||||| ||||||||| Sbjct: 1372 gcggtacctctccccgggctgcacgaagtcgttctcctt 1334
>dbj|D13557.1|VIRCAT Vigna radiata mRNA for catalase, complete cds Length = 1824 Score = 46.1 bits (23), Expect = 0.13 Identities = 26/27 (96%) Strand = Plus / Minus Query: 469 ctgcttgaagttgttctccttgtcaat 495 ||||||||||||||||||||| ||||| Sbjct: 1343 ctgcttgaagttgttctccttctcaat 1317 Score = 40.1 bits (20), Expect = 8.0 Identities = 29/32 (90%) Strand = Plus / Minus Query: 320 tggccaagagacttgtcagcctgagaccagta 351 ||||||||||| |||||||||||||||||| Sbjct: 1492 tggccaagagaacggtcagcctgagaccagta 1461
>ref|NM_001035995.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3) transcript variant AT1G20620.4 mRNA, complete cds Length = 1930 Score = 44.1 bits (22), Expect = 0.51 Identities = 40/46 (86%) Strand = Plus / Minus Query: 339 cctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 ||||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1495 cctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1450
>gb|AF207906.1| Zantedeschia aethiopica catalase 1 (cat1) mRNA, complete cds Length = 1917 Score = 44.1 bits (22), Expect = 0.51 Identities = 79/98 (80%) Strand = Plus / Minus Query: 401 gcatcgatccatctgttgatgaatcgctcttgccttgccgggtccatggagcggtacctc 460 ||||||||||| | || ||||| ||||||||||| | ||| || ||| |||||| || Sbjct: 1426 gcatcgatccagcgcttaatgaaacgctcttgcctgtcaggggcccaggaccggtacttc 1367 Query: 461 tcccctggctgcttgaagttgttctccttgtcaatgca 498 || || ||||| ||||||||||| ||||| | |||||| Sbjct: 1366 tctccaggctgtttgaagttgttttccttttgaatgca 1329
>emb|X59694.1|RCCATAL R.communis mRNA for catalase, C.-term Length = 456 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| || ||||||||||| ||||||||||| ||||| Sbjct: 95 ctctcaccaggctgcttgaaattgttctccttctcaat 58
>emb|X05549.1|IBCATR Seet potato mRNA for catalase (EC 1.11.1.6) Length = 1804 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Minus Query: 470 tgcttgaagttgttctccttgtcaat 495 |||||||||||||||||||| ||||| Sbjct: 1370 tgcttgaagttgttctccttctcaat 1345
>gb|DQ123920.1| Coffea arabica x Coffea canephora clone HT-SSH1-A01 mRNA sequence Length = 509 Score = 44.1 bits (22), Expect = 0.51 Identities = 27/29 (93%) Strand = Plus / Minus Query: 323 ccaagagacttgtcagcctgagaccagta 351 |||||||| |||||||| ||||||||||| Sbjct: 450 ccaagagatttgtcagcntgagaccagta 422 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctcctt 489 ||||| ||||| || || |||||||||||||||||||| Sbjct: 320 cggtatctctctcccggttgcttgaagttgttctcctt 283
>emb|AJ297612.1|DLA297612 Digitalis lanata partial mRNA for catalase (cat gene) Length = 992 Score = 44.1 bits (22), Expect = 0.51 Identities = 46/54 (85%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagtaggagagccagatg 364 ||||| ||||| || || |||||||||||||||| |||||| || | ||||||| Sbjct: 767 gcaagtttctgaccgagggacttgtcagcctgagtccagtatgaaacccagatg 714
>emb|X59383.1|RCCAT R.communis mRNA for catalase Length = 456 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| || ||||||||||| ||||||||||| ||||| Sbjct: 95 ctctcaccaggctgcttgaaattgttctccttctcaat 58
>gb|M93719.1|TOMCAT1A Lycopersicon esculentum catalase (cat1) mRNA, complete cds Length = 1804 Score = 44.1 bits (22), Expect = 0.51 Identities = 28/30 (93%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgtt 483 |||||||||||||| ||| ||||||||||| Sbjct: 1337 gtacctctcccctgcctgtttgaagttgtt 1308
>dbj|D21161.1|RCCCATALAA Ricinus communis gene for catalase CAT1, complete cds (exon 1-8) Length = 3711 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| || ||||||||||| ||||||||||| ||||| Sbjct: 3021 ctctcaccaggctgcttgaaattgttctccttctcaat 2984
>ref|NM_001035996.1| Arabidopsis thaliana CAT3 (CATALASE 3); catalase AT1G20620 (CAT3) transcript variant AT1G20620.5 mRNA, complete cds Length = 1817 Score = 42.1 bits (21), Expect = 2.0 Identities = 39/45 (86%) Strand = Plus / Minus Query: 340 ctgagaccagtaggagagccagatggccttgatctcgtgggtgag 384 |||||||||||| |||| ||||||| | ||||||||||||||| Sbjct: 1494 ctgagaccagtaagagatccagatgccgcggatctcgtgggtgag 1450
>emb|X94352.1|TACATAGEN T.aestivum mRNA for catalase Length = 1869 Score = 42.1 bits (21), Expect = 2.0 Identities = 54/65 (83%) Strand = Plus / Minus Query: 428 tcttgccttgccgggtccatggagcggtacctctcccctggctgcttgaagttgttctcc 487 |||||||| || ||||| | ||| || || ||||| || | ||||||||| ||||||||| Sbjct: 1448 tcttgcctggcagggtcgaaggaccgatatctctcaccagcctgcttgaaattgttctcc 1389 Query: 488 ttgtc 492 ||||| Sbjct: 1388 ttgtc 1384
>emb|X60135.1|ZMCATA1 Z.mays cat1 gene for catalase 1 Length = 6933 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 469 ctgcttgaagttgttctcctt 489 ||||||||||||||||||||| Sbjct: 5712 ctgcttgaagttgttctcctt 5692
>emb|X56675.1|GHLCCSU2 G. hirsutum mRNA for cotton catalase subunit 2 Length = 1763 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Minus Query: 332 ttgtcagcctgagaccagtaggaga 356 |||||||||||||||||||| |||| Sbjct: 1464 ttgtcagcctgagaccagtatgaga 1440 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 461 tcccctggctgcttgaagttgttctcctt 489 ||||| |||||||| |||||||||||||| Sbjct: 1335 tccccaggctgcttaaagttgttctcctt 1307
>emb|BX640440.1| Bordetella bronchiseptica strain RB50, complete genome; segment 4/16 Length = 349497 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 510 ggcggccgttgagcgcgcgcgccgg 534 |||||||| |||||||||||||||| Sbjct: 182569 ggcggccgatgagcgcgcgcgccgg 182593
>emb|BX640425.1| Bordetella parapertussis strain 12822, complete genome; segment 3/14 Length = 348257 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 510 ggcggccgttgagcgcgcgcgccgg 534 |||||||| |||||||||||||||| Sbjct: 306616 ggcggccgatgagcgcgcgcgccgg 306640
>emb|AJ132444.1|PPE132444 Prunus persica mRNA for catalase 1, partial Length = 1610 Score = 42.1 bits (21), Expect = 2.0 Identities = 54/65 (83%) Strand = Plus / Minus Query: 371 atctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatgaatcgctct 430 ||||| ||||||| || ||||| || || ||||| | ||||| || ||||||||||||| Sbjct: 1182 atctcatgggtgacacgtgggtctgatagggcatccacccatcggtggatgaatcgctct 1123 Query: 431 tgcct 435 ||||| Sbjct: 1122 tgcct 1118
>gb|AY272049.1| Avicennia marina catalase (Cat1) gene, complete cds Length = 2036 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagta 351 ||||| |||||||| | |||||||| |||||||||||||| Sbjct: 1903 gcaagtttctggccgaaggacttgtcggcctgagaccagta 1863
>gb|DQ078758.1| Oryza sativa (indica cultivar-group) catalase mRNA, complete cds Length = 1479 Score = 42.1 bits (21), Expect = 2.0 Identities = 39/45 (86%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaatg 496 ||||| ||||| || | ||| ||||| |||||||||||||||||| Sbjct: 1307 cggtatctctcaccagcctgtttgaaattgttctccttgtcaatg 1263
>gb|AF328861.1|AF328861 Avicennia marina catalase mRNA, complete cds Length = 1754 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagta 351 ||||| |||||||| | |||||||| |||||||||||||| Sbjct: 1468 gcaagtttctggccgaaggacttgtcggcctgagaccagta 1428
>gb|AF227952.1|AF227952 Capsicum annuum catalase (CAT) mRNA, complete cds Length = 1837 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaagttgttctc 486 |||||||| | |||||||||||||||||| Sbjct: 1346 ctctccccagcctgcttgaagttgttctc 1318 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 328 agacttgtcagcctgagaccagta 351 ||||||||||||||||||| |||| Sbjct: 1476 agacttgtcagcctgagacaagta 1453
>gb|AF139538.2|AF139538 Raphanus sativus catalase 2 (cat2) mRNA, complete cds Length = 1824 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 469 ctgcttgaagttgttctcctt 489 ||||||||||||||||||||| Sbjct: 1332 ctgcttgaagttgttctcctt 1312
>gb|U03473.1|NTU03473 Nicotiana tabacum SR1 salicylic acid binding catalase mRNA, partial cds Length = 1860 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 464 cctggctgcttgaagttgttctccttgtcaatg 496 |||| |||||||||||||||||| || |||||| Sbjct: 1287 cctgcctgcttgaagttgttctctttctcaatg 1255
>emb|BX294652.6| Mouse DNA sequence from clone RP23-254N16 on chromosome 2, complete sequence Length = 41854 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 404 tcgatccatctgttgatgaat 424 ||||||||||||||||||||| Sbjct: 25654 tcgatccatctgttgatgaat 25674
>gb|U20777.1|HVU20777 Hordeum vulgare catalase (Cat1) mRNA, complete cds Length = 1879 Score = 42.1 bits (21), Expect = 2.0 Identities = 54/65 (83%) Strand = Plus / Minus Query: 428 tcttgccttgccgggtccatggagcggtacctctcccctggctgcttgaagttgttctcc 487 |||||||| || ||||| | ||| || || ||||| || | ||||||||| ||||||||| Sbjct: 1407 tcttgcctggcagggtcgaaggaccgatatctctcaccagcctgcttgaaattgttctcc 1348 Query: 488 ttgtc 492 ||||| Sbjct: 1347 ttgtc 1343
>gb|U27082.1|STU27082 Solanum tuberosum catalase (CAT1) mRNA, complete cds Length = 1772 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 454 gtacctctcccctggctgcttgaagttgttctc 486 |||||||||||||| ||| ||| |||||||||| Sbjct: 1307 gtacctctcccctgcctgtttggagttgttctc 1275
>gb|U07627.1|NTU07627 Nicotiana tabacum Petit Havana SR1 catalase (CAT-1) mRNA, complete cds Length = 1897 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 464 cctggctgcttgaagttgttctccttgtcaatg 496 |||| |||||||||||||||||| || |||||| Sbjct: 1323 cctgcctgcttgaagttgttctctttctcaatg 1291
>gb|U07626.1|NSU07626 Nicotiana sylvestris catalase (CAT-1) mRNA, partial cds Length = 1416 Score = 42.1 bits (21), Expect = 2.0 Identities = 30/33 (90%) Strand = Plus / Minus Query: 464 cctggctgcttgaagttgttctccttgtcaatg 496 |||| |||||||||||||||||| || |||||| Sbjct: 968 cctgcctgcttgaagttgttctctttctcaatg 936
>gb|DQ255945.1| Avicennia marina truncated catalase 2 mRNA, complete cds, alternatively spliced Length = 2254 Score = 42.1 bits (21), Expect = 2.0 Identities = 36/41 (87%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagaccagta 351 ||||| |||||||| | |||||||| |||||||||||||| Sbjct: 1944 gcaagtttctggccgaaggacttgtcggcctgagaccagta 1904
>dbj|D63385.1|CUSCB Cucumis sativus mRNA for catalase, partial cds, clone CRR26-3' Length = 274 Score = 42.1 bits (21), Expect = 2.0 Identities = 33/37 (89%) Strand = Plus / Minus Query: 311 gcaagcttctggccaagagacttgtcagcctgagacc 347 ||||||||||| |||| |||| | ||||||||||||| Sbjct: 43 gcaagcttctgcccaacagacctatcagcctgagacc 7
>ref|NM_001036714.1| Arabidopsis thaliana CAT2 (CATALASE 2); catalase AT4G35090 (CAT2) transcript variant AT4G35090.2 mRNA, complete cds Length = 2259 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| ||||||||||||||| || ||||| Sbjct: 1378 cggtatctctctccaggctccttgaagttgttctctttctcaat 1335
>gb|CP000153.1| Thiomicrospira denitrificans ATCC 33889, complete genome Length = 2201561 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 137 agtagctgatgtagcatttg 156 |||||||||||||||||||| Sbjct: 1517266 agtagctgatgtagcatttg 1517247
>ref|XM_421873.1| PREDICTED: Gallus gallus similar to receptor-activity modifying protein 1 (LOC424016), mRNA Length = 3265 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 507 cgcggcggccgttgagcgcg 526 |||||||||||||||||||| Sbjct: 42 cgcggcggccgttgagcgcg 61
>gb|AC141899.4| Mus musculus BAC clone RP23-116G15 from chromosome 10, complete sequence Length = 210306 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 139 tagctgatgtagcatttggt 158 |||||||||||||||||||| Sbjct: 64030 tagctgatgtagcatttggt 64049
>gb|AC147336.2| Pan troglodytes BAC clone CH251-70I12 from Y, complete sequence Length = 194849 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 356 agccagatggccttgatctc 375 |||||||||||||||||||| Sbjct: 162302 agccagatggccttgatctc 162283
>gb|AC147339.2| Pan troglodytes BAC clone CH251-65E18 from Y, complete sequence Length = 178935 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 agccagatggccttgatctc 375 |||||||||||||||||||| Sbjct: 134255 agccagatggccttgatctc 134274
>emb|AL161586.2|ATCHRIV82 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 82 Length = 195165 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Plus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| ||||||||||||||| || ||||| Sbjct: 156092 cggtatctctctccaggctccttgaagttgttctctttctcaat 156135
>emb|AL035522.1|ATT12J5 Arabidopsis thaliana DNA chromosome 4, BAC clone T12J5 (ESSAII project) Length = 84499 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Plus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| ||||||||||||||| || ||||| Sbjct: 26170 cggtatctctctccaggctccttgaagttgttctctttctcaat 26213
>emb|AL022023.1|ATM4E13 Arabidopsis thaliana DNA chromosome 4, BAC clone M4E13 (ESSAII project) Length = 80346 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Plus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| ||||||||||||||| || ||||| Sbjct: 57125 cggtatctctctccaggctccttgaagttgttctctttctcaat 57168
>emb|AJ496419.1|PPE496419 Prunus persica mRNA for catalase (cat2 gene) Length = 1777 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 313 aagcttctggccaagagacttgtcagcctgagaccagtaggaga 356 |||||| || || |||||||| || |||||||||||||| |||| Sbjct: 1546 aagcttttgacccagagacttatctgcctgagaccagtatgaga 1503
>emb|AJ496418.1|PPE496418 Prunus persica mRNA for catalase (cat1 gene) Length = 1813 Score = 40.1 bits (20), Expect = 8.0 Identities = 53/64 (82%) Strand = Plus / Minus Query: 371 atctcgtgggtgaggcgggggtcggacagcgcatcgatccatctgttgatgaatcgctct 430 ||||| ||||||| || ||||| || || ||||| | ||||| || ||||||||||||| Sbjct: 1396 atctcatgggtgacacgtgggtctgatagggcatccacccatcggtggatgaatcgctct 1337 Query: 431 tgcc 434 |||| Sbjct: 1336 tgcc 1333
>dbj|BS000651.1| Pan troglodytes chromosome Y clone: PTBY-012K02, complete sequence Length = 162358 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 agccagatggccttgatctc 375 |||||||||||||||||||| Sbjct: 134030 agccagatggccttgatctc 134049
>dbj|BS000559.1| Pan troglodytes chromosome Y clone:PTB-473B14, complete sequences Length = 127252 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 agccagatggccttgatctc 375 |||||||||||||||||||| Sbjct: 124304 agccagatggccttgatctc 124323
>dbj|BS000549.1| Pan troglodytes chromosome Y clone:PTB-240N05, complete sequences Length = 148562 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 agccagatggccttgatctc 375 |||||||||||||||||||| Sbjct: 56709 agccagatggccttgatctc 56728
>gb|DP000054.1| Pan troglodytes chromosome Y, partial sequence Length = 23952694 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 356 agccagatggccttgatctc 375 |||||||||||||||||||| Sbjct: 16558659 agccagatggccttgatctc 16558640
>gb|AC009235.4|AC009235 Homo sapiens BAC clone RP11-392F24 from Y, complete sequence Length = 159910 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 356 agccagatggccttgatctc 375 |||||||||||||||||||| Sbjct: 79774 agccagatggccttgatctc 79793
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 512 cggccgttgagcgcgcgcgc 531 |||||||||||||||||||| Sbjct: 1507405 cggccgttgagcgcgcgcgc 1507424
>gb|AF248491.1|AF248491 Raphanus sativus catalase (cat) gene, complete cds Length = 4780 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || |||| ||||||||||||||| || ||||| Sbjct: 4263 cggtatctctctccaggctccttgaagttgttctctttctcaat 4220
>gb|AF243519.1|AF243519 Helianthus annuus catalase 4 (CATA4) mRNA, complete cds Length = 1871 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 458 ctctcccctggctgcttgaa 477 |||||||||||||||||||| Sbjct: 1338 ctctcccctggctgcttgaa 1319
>gb|AF149283.1|AF149283 Phaseolus vulgaris catalase 1 (CAT1) mRNA, partial cds Length = 1286 Score = 40.1 bits (20), Expect = 8.0 Identities = 38/44 (86%) Strand = Plus / Minus Query: 452 cggtacctctcccctggctgcttgaagttgttctccttgtcaat 495 ||||| ||||| || || ||||| |||||||||||||| ||||| Sbjct: 1131 cggtatctctctccaggttgcttaaagttgttctccttctcaat 1088
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 509 cggcggccgttgagcgcgcg 528 |||||||||||||||||||| Sbjct: 661439 cggcggccgttgagcgcgcg 661458
>emb|AL136087.12| Human DNA sequence from clone RP1-137F1 on chromosome 6p21.1-21.2, complete sequence Length = 140136 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 526 gcgcgccgggatggggtagcggggcgcg 553 ||||| ||||||||||||||||| |||| Sbjct: 66917 gcgcggcgggatggggtagcgggccgcg 66890
>gb|AC163645.5| Mus musculus BAC clone RP23-206F16 from chromosome 10, complete sequence Length = 212773 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 139 tagctgatgtagcatttggt 158 |||||||||||||||||||| Sbjct: 165707 tagctgatgtagcatttggt 165726
>gb|AF021938.1|AF021938 Hordeum vulgare catalase 1 (CAT1) gene, partial cds Length = 2130 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 469 ctgcttgaagttgttctccttgtc 492 ||||||||| |||||||||||||| Sbjct: 1695 ctgcttgaaattgttctccttgtc 1672 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,666,203 Number of Sequences: 3902068 Number of extensions: 3666203 Number of successful extensions: 63938 Number of sequences better than 10.0: 157 Number of HSP's better than 10.0 without gapping: 156 Number of HSP's successfully gapped in prelim test: 1 Number of HSP's that attempted gapping in prelim test: 63314 Number of HSP's gapped (non-prelim): 617 length of query: 585 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 562 effective length of database: 17,143,297,704 effective search space: 9634533309648 effective search space used: 9634533309648 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)