ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah61l23
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHA... 321 1e-84
2gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase... 192 8e-46
3gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase p... 190 3e-45
4emb|AJ622892.1| Triticum durum partial mRNA for DRP5 protein (dr... 176 5e-41
5gb|AY106435.1| Zea mays PCO106999 mRNA sequence 68 3e-08
6gb|AY074786.1| Oryza sativa dehydroascorbate reductase (DHAR) mR... 56 1e-04
7dbj|AK070895.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
8dbj|AK061836.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 1e-04
9dbj|AB037970.1| Oryza sativa (japonica cultivar-group) DHAR1 mRN... 56 1e-04
10gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome... 54 5e-04
11gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome... 54 5e-04
12dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 54 5e-04
13gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, com... 42 1.8
14dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, comp... 42 1.8
15gb|AC168056.3| Mus musculus BAC clone RP24-189B1 from chromosome... 40 7.1
16emb|AJ632303.1| Sus scrofa partial ICAM3 gene, TYK2, CDC37, PDE4... 40 7.1
17emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 i... 40 7.1
18emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on ch... 40 7.1

>gb|AY074784.1| Triticum aestivum dehydroascorbate reductase (DHAR) mRNA, complete
           cds
          Length = 956

 Score =  321 bits (162), Expect = 1e-84
 Identities = 225/248 (90%)
 Strand = Plus / Minus

                                                                       
Query: 274 ggcgggggagcttacgggttcaccttcggcgcccacccggcgatcaggttcttcttggtc 333
           |||||| | |||||||||||||| |||||||||||||||||||||||||||| |||||||
Sbjct: 724 ggcgggagggcttacgggttcactttcggcgcccacccggcgatcaggttctccttggtc 665

                                                                       
Query: 334 ggnttggtcttgacgaacgactnacggctgaagagagcctcggtgtaagcatggacgctg 393
           |  |||||||||||||||||||  ||||||||||||||||||||||| ||||||||||||
Sbjct: 664 gccttggtcttgacgaacgactcgcggctgaagagagcctcggtgtaggcatggacgctg 605

                                                                       
Query: 394 gtcantgtttcagggaccttncagcctttgaagtgctncagggcaacctggaggtggaag 453
           ||||  |||||||||||||| ||||| |||||||||| |||||| |||||||| ||| ||
Sbjct: 604 gtcagggtttcagggaccttccagcccttgaagtgctccagggcgacctggagatggtag 545

                                                                       
Query: 454 agcttcggagccaagctgagatccncggcggagacgttcgccccgttgatgtagggtcca 513
           ||||||||||||| |||||||||  | ||||||| ||||||||| |||||||||||||||
Sbjct: 544 agcttcggagccaggctgagatcgacagcggagatgttcgccccattgatgtagggtcca 485

                   
Query: 514 tgggcctt 521
           ||||||||
Sbjct: 484 tgggcctt 477



 Score = 44.1 bits (22), Expect = 0.45
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 164 aggctcgctcgcattattccaa 185
           ||||||||||||||||||||||
Sbjct: 806 aggctcgctcgcattattccaa 785



to top

>gb|DQ090998.1| Puccinellia tenuiflora dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 202

 Score =  192 bits (97), Expect = 8e-46
 Identities = 155/176 (88%)
 Strand = Plus / Minus

                                                                       
Query: 283 gcttacgggttcaccttcggcgcccacccggcgatcaggttcttcttggtcggnttggtc 342
           |||||||||||||| || |||||||| |||||||||||||||| |||||| || ||||||
Sbjct: 200 gcttacgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtc 141

                                                                       
Query: 343 ttgacgaacgactnacggctgaagagagcctcggtgtaagcatggacgctggtcantgtt 402
           |||||||| || |  |||||||| ||||||| |||||| ||||||||||||||||  |||
Sbjct: 140 ttgacgaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtt 81

                                                                   
Query: 403 tcagggaccttncagcctttgaagtgctncagggcaacctggaggtggaagagctt 458
           || |||||||| || |||||||| |||| ||||||||||||||| |||||||||||
Sbjct: 80  tcggggaccttccatcctttgaaatgctccagggcaacctggagatggaagagctt 25



to top

>gb|DQ093638.1| Eustoma grandiflorum dehydroascorbate reductase protein mRNA,
           partial cds
          Length = 195

 Score =  190 bits (96), Expect = 3e-45
 Identities = 151/171 (88%)
 Strand = Plus / Minus

                                                                       
Query: 288 cgggttcaccttcggcgcccacccggcgatcaggttcttcttggtcggnttggtcttgac 347
           ||||||||| || |||||||| |||||||||||||||| |||||| || |||||||||||
Sbjct: 195 cgggttcactttgggcgcccatccggcgatcaggttctccttggtgggcttggtcttgac 136

                                                                       
Query: 348 gaacgactnacggctgaagagagcctcggtgtaagcatggacgctggtcantgtttcagg 407
           ||| || |  |||||||| ||||||| |||||| ||||||||||||||||  ||||||||
Sbjct: 135 gaaggattcccggctgaacagagccttggtgtaggcatggacgctggtcagggtttcagg 76

                                                              
Query: 408 gaccttncagcctttgaagtgctncagggcaacctggaggtggaagagctt 458
           |||||| || |||||||| |||| ||||||||||||||| |||||||||||
Sbjct: 75  gaccttccatcctttgaaatgctccagggcaacctggagatggaagagctt 25



to top

>emb|AJ622892.1| Triticum durum partial mRNA for DRP5 protein (drg5 gene)
          Length = 478

 Score =  176 bits (89), Expect = 5e-41
 Identities = 113/122 (92%)
 Strand = Plus / Plus

                                                                       
Query: 400 gtttcagggaccttncagcctttgaagtgctncagggcaacctggaggtggaagagcttc 459
           |||||||||||||| ||||| |||||||||| |||||| |||||||||||| ||||||||
Sbjct: 7   gtttcagggaccttccagcccttgaagtgctccagggcgacctggaggtggtagagcttc 66

                                                                       
Query: 460 ggagccaagctgagatccncggcggagacgttcgccccgttgatgtagggtccatgggcc 519
           ||||||| |||||||||  ||||||||| |||||||||||||||||||||||||||||||
Sbjct: 67  ggagccaggctgagatcgacggcggagatgttcgccccgttgatgtagggtccatgggcc 126

             
Query: 520 tt 521
           ||
Sbjct: 127 tt 128



to top

>gb|AY106435.1| Zea mays PCO106999 mRNA sequence
          Length = 1141

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 175/224 (78%)
 Strand = Plus / Minus

                                                                       
Query: 292 ttcaccttcggcgcccacccggcgatcaggttcttcttggtcggnttggtcttgacgaac 351
           |||||||| |||||||| || || |||| || || || ||  || || |||||||| || 
Sbjct: 728 ttcaccttgggcgcccatcccgcaatcacgtgctcctcggatggcttagtcttgacaaaa 669

                                                                       
Query: 352 gactnacggctgaagagagcctcggtgtaagcatggacgctggtcantgtttcagggacc 411
           || | ||||||||| ||||||| |||||| || |||||| |||| |   |||| |||| |
Sbjct: 668 gattcacggctgaaaagagccttggtgtaggcgtggacgttggttaggttttctgggatc 609

                                                                       
Query: 412 ttncagcctttgaagtgctncagggcaacctggaggtggaagagcttcggagccaagctg 471
           || ||||||||||| |||| ||| || | ||| |||||||| ||||| ||  ||| ||| 
Sbjct: 608 ttccagcctttgaaatgctccagtgcgatctgtaggtggaaaagctttggccccaggcta 549

                                                       
Query: 472 agatccncggcggagacgttcgccccgttgatgtagggtccatg 515
           |||||  | || || |||||| |||| || |||||||| |||||
Sbjct: 548 agatcagctgctgacacgttctccccatttatgtaggggccatg 505



to top

>gb|AY074786.1| Oryza sativa dehydroascorbate reductase (DHAR) mRNA, complete cds
          Length = 1067

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 358 cggctgaagagagcctcggtgtaagcatggacgctggtcantgtttcagggaccttncag 417
           ||||| || |||||||| ||||||||||| ||  |||| |    ||| |||| ||| |||
Sbjct: 648 cggctaaacagagcctctgtgtaagcatgaacattggttaggtcttccgggatcttccag 589

                                                    
Query: 418 cctttgaagtgctncagggcaacctggaggtggaagagctt 458
           |||||||| |||| ||| ||||||||||| ||| |||||||
Sbjct: 588 cctttgaaatgctccagagcaacctggagatggtagagctt 548



to top

>dbj|AK070895.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023074C02, full
           insert sequence
          Length = 1198

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 358 cggctgaagagagcctcggtgtaagcatggacgctggtcantgtttcagggaccttncag 417
           ||||| || |||||||| ||||||||||| ||  |||| |    ||| |||| ||| |||
Sbjct: 649 cggctaaacagagcctctgtgtaagcatgaacattggttaggtcttccgggatcttccag 590

                                                    
Query: 418 cctttgaagtgctncagggcaacctggaggtggaagagctt 458
           |||||||| |||| ||| ||||||||||| ||| |||||||
Sbjct: 589 cctttgaaatgctccagagcaacctggagatggtagagctt 549



to top

>dbj|AK061836.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-D08, full
           insert sequence
          Length = 1053

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 358 cggctgaagagagcctcggtgtaagcatggacgctggtcantgtttcagggaccttncag 417
           ||||| || |||||||| ||||||||||| ||  |||| |    ||| |||| ||| |||
Sbjct: 653 cggctaaacagagcctctgtgtaagcatgaacattggttaggtcttccgggatcttccag 594

                                                    
Query: 418 cctttgaagtgctncagggcaacctggaggtggaagagctt 458
           |||||||| |||| ||| ||||||||||| ||| |||||||
Sbjct: 593 cctttgaaatgctccagagcaacctggagatggtagagctt 553



to top

>dbj|AB037970.1| Oryza sativa (japonica cultivar-group) DHAR1 mRNA for GSH-dependent
           dehydroascorbate reductase 1, complete cds
          Length = 1044

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 82/101 (81%)
 Strand = Plus / Minus

                                                                       
Query: 358 cggctgaagagagcctcggtgtaagcatggacgctggtcantgtttcagggaccttncag 417
           ||||| || |||||||| ||||||||||| ||  |||| |    ||| |||| ||| |||
Sbjct: 618 cggctaaacagagcctctgtgtaagcatgaacattggttaggtcttccgggatcttccag 559

                                                    
Query: 418 cctttgaagtgctncagggcaacctggaggtggaagagctt 458
           |||||||| |||| ||| ||||||||||| ||| |||||||
Sbjct: 558 cctttgaaatgctccagagcaacctggagatggtagagctt 518



to top

>gb|AC078977.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0496H07,
             complete sequence
          Length = 164477

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                  
Query: 406   gggaccttncagcctttgaagtgctncagggcaacctggaggtggaagagctt 458
             |||| ||| ||||||||||| |||| ||| ||||||||||| ||| |||||||
Sbjct: 50721 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 50773



to top

>gb|AC108504.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1654_B10,
              complete sequence
          Length = 140282

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                   
Query: 406    gggaccttncagcctttgaagtgctncagggcaacctggaggtggaagagctt 458
              |||| ||| ||||||||||| |||| ||| ||||||||||| ||| |||||||
Sbjct: 118740 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 118792



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5,
              complete sequence
          Length = 29737217

 Score = 54.0 bits (27), Expect = 5e-04
 Identities = 46/53 (86%)
 Strand = Plus / Plus

                                                                   
Query: 406    gggaccttncagcctttgaagtgctncagggcaacctggaggtggaagagctt 458
              |||| ||| ||||||||||| |||| ||| ||||||||||| ||| |||||||
Sbjct: 846298 gggatcttccagcctttgaaatgctccagagcaacctggagatggtagagctt 846350



to top

>gb|AC109221.32| Mus musculus chromosome 7, clone RP23-207N2, complete sequence
          Length = 195657

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 98    agccaggcagggggcagacag 118
             |||||||||||||||||||||
Sbjct: 71257 agccaggcagggggcagacag 71277



to top

>dbj|AP006840.1| Symbiobacterium thermophilum IAM 14863 DNA, complete genome
          Length = 3566135

 Score = 42.1 bits (21), Expect = 1.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 287    acgggttcaccttcggcgccc 307
              |||||||||||||||||||||
Sbjct: 209716 acgggttcaccttcggcgccc 209736



to top

>gb|AC168056.3| Mus musculus BAC clone RP24-189B1 from chromosome 13, complete sequence
          Length = 179458

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 440   cctggaggtggaagagcttc 459
             ||||||||||||||||||||
Sbjct: 51516 cctggaggtggaagagcttc 51497



to top

>emb|AJ632303.1| Sus scrofa partial ICAM3 gene, TYK2, CDC37, PDE4A, KEAP1, EDG8 and APG4D
              genes and partial FLJ12949 gene
          Length = 185331

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 144    acaggcagagcacacagccgaggc 167
              |||||| |||||||||||||||||
Sbjct: 176008 acaggctgagcacacagccgaggc 176031



to top

>emb|BX088727.14| Zebrafish DNA sequence from clone DKEY-218A22 in linkage group 2,
             complete sequence
          Length = 185178

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 171   ctcgcattattccaaaccca 190
             ||||||||||||||||||||
Sbjct: 28852 ctcgcattattccaaaccca 28833



to top

>emb|Z84494.1|HSLUCA7 Human DNA sequence from clone XXcos-7 on chromosome 3, complete
             sequence
          Length = 16950

 Score = 40.1 bits (20), Expect = 7.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 98    agccaggcagggggcagaca 117
             ||||||||||||||||||||
Sbjct: 12882 agccaggcagggggcagaca 12863


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,251,543
Number of Sequences: 3902068
Number of extensions: 2251543
Number of successful extensions: 37141
Number of sequences better than 10.0: 18
Number of HSP's better than 10.0 without gapping: 18
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 37055
Number of HSP's gapped (non-prelim): 86
length of query: 525
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 502
effective length of database: 17,143,297,704
effective search space: 8605935447408
effective search space used: 8605935447408
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top