ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah61k02
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, part... 410 e-111
2dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 337 2e-89
3gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 337 2e-89
4emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa... 337 2e-89
5dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clon... 329 5e-87
6dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clon... 329 5e-87
7gb|AY108123.1| Zea mays PCO067267 mRNA sequence 272 9e-70
8ref|NM_119780.2| Arabidopsis thaliana structural constituent of ... 224 2e-55
9emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, ... 224 2e-55
10emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, B... 224 2e-55
11emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BA... 224 2e-55
12gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co... 224 2e-55
13gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co... 224 2e-55
14gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, co... 224 2e-55
15gb|AY105581.1| Zea mays PCO150618 mRNA sequence 224 2e-55
16gb|AY109618.1| Zea mays CL8996_1 mRNA sequence 212 8e-52
17emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein ... 206 5e-50
18ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural consti... 200 3e-48
19gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At... 200 3e-48
20gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 ma... 200 3e-48
21emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Co... 200 3e-48
22emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Co... 200 3e-48
23emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Co... 200 3e-48
24gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At... 200 3e-48
25emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Co... 198 1e-47
26emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2 192 7e-46
27emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Co... 186 4e-44
28emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Co... 184 2e-43
29gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protei... 182 7e-43
30gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete se... 178 1e-41
31emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Co... 172 6e-40
32gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence 157 4e-35
33emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2 157 4e-35
34gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein ... 157 4e-35
35emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Co... 147 4e-32
36emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal prote... 145 1e-31
37gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, c... 131 2e-27
38emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1 113 5e-22
39emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1 113 5e-22
40gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein... 111 2e-21
41emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1 105 1e-19
42emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1 105 1e-19
43emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1 105 1e-19
44emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1 105 1e-19
45gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA 103 5e-19
46gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell... 103 5e-19
47ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG... 103 5e-19
48ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG... 103 5e-19
49gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA 103 5e-19
50gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA 103 5e-19
51gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 ... 103 5e-19
52emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1 101 2e-18
53emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1 101 2e-18
54emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1 101 2e-18
55emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1 101 2e-18
56emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1 101 2e-18
57emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1 101 2e-18
58emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1 101 2e-18
59emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1 101 2e-18
60emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1 101 2e-18
61emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1 101 2e-18
62emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1 101 2e-18
63emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1 101 2e-18
64emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1 101 2e-18
65gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribo... 96 1e-16
66gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein... 96 1e-16
67gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mR... 96 1e-16
68emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal pr... 96 1e-16
69gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) ge... 96 1e-16
70emb|CR938630.1| Single read from an extremity of a full-length c... 96 1e-16
71emb|CR938124.1| Single read from an extremity of a full-length c... 96 1e-16
72emb|CR937651.1| Single read from an extremity of a cDNA clone ma... 96 1e-16
73emb|CR937650.1| Single read from an extremity of a cDNA clone ma... 96 1e-16
74emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1 94 5e-16
75dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal pr... 94 5e-16
76ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG126... 90 7e-15
77emb|CR937938.1| Single read from an extremity of a full-length c... 88 3e-14
78gb|AF429973.1| Spodoptera frugiperda ribosomal protein L8 mRNA, ... 88 3e-14
79dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 88 3e-14
80gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 r... 86 1e-13
81gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, pa... 86 1e-13
82gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA... 84 5e-13
83gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal pro... 84 5e-13
84gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal ... 82 2e-12
85gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal ... 82 2e-12
86emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal pro... 82 2e-12
87emb|CR938631.1| Single read from an extremity of a full-length c... 82 2e-12
88gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, parti... 82 2e-12
89gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene e... 82 2e-12
90ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal ... 80 7e-12
91emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protei... 80 7e-12
92gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, m... 80 7e-12
93ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein ... 80 7e-12
94ref|NM_114978.1| Arabidopsis thaliana structural constituent of ... 78 3e-11
95gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal ... 78 3e-11
96gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds 78 3e-11
97emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal... 78 3e-11
98emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, B... 78 3e-11
99emb|CR938453.1| Single read from an extremity of a full-length c... 78 3e-11
100gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At... 78 3e-11
101dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase... 78 3e-11
102emb|AL116103.1|CNS01CXB Botrytis cinerea strain T4 cDNA library 78 3e-11
103emb|AL114960.1|CNS01C1K Botrytis cinerea strain T4 cDNA library 78 3e-11
104emb|AL112851.1|CNS01AEZ Botrytis cinerea strain T4 cDNA library 78 3e-11
105emb|AL112838.1|CNS01AEM Botrytis cinerea strain T4 cDNA library 78 3e-11
106emb|AL112486.1|CNS01A4U Botrytis cinerea strain T4 cDNA library 78 3e-11
107ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal ... 78 3e-11
108emb|AJ563478.1|CGI563478 Crassostrea gigas partial mRNA for ribo... 78 3e-11
109emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-... 76 1e-10
110emb|BX071012.1|CNS09QYG Single read from an extremity of a full-... 76 1e-10
111emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-... 76 1e-10
112emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-... 76 1e-10
113emb|BX068769.1|CNS09P85 Single read from an extremity of a full-... 76 1e-10
114emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-... 76 1e-10
115emb|BX067520.1|CNS09O9G Single read from an extremity of a full-... 76 1e-10
116emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-... 76 1e-10
117emb|BX066544.1|CNS09NIC Single read from an extremity of a full-... 76 1e-10
118emb|BX065896.1|CNS09N0C Single read from an extremity of a full-... 76 1e-10
119emb|BX064864.1|CNS09M7O Single read from an extremity of a full-... 76 1e-10
120emb|BX064747.1|CNS09M4F Single read from an extremity of a full-... 76 1e-10
121emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-... 76 1e-10
122emb|BX063827.1|CNS09LEV Single read from an extremity of a full-... 76 1e-10
123emb|BX063245.1|CNS09KYP Single read from an extremity of a full-... 76 1e-10
124emb|BX063171.1|CNS09KWN Single read from an extremity of a full-... 76 1e-10
125emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-... 76 1e-10
126emb|BX062038.1|CNS09K16 Single read from an extremity of a full-... 76 1e-10
127emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-... 76 1e-10
128emb|BX061503.1|CNS09JMB Single read from an extremity of a full-... 76 1e-10
129emb|BX061238.1|CNS09JEY Single read from an extremity of a full-... 76 1e-10
130emb|BX060724.1|CNS09J0O Single read from an extremity of a full-... 76 1e-10
131emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-... 76 1e-10
132emb|BX059235.1|CNS09HVB Single read from an extremity of a full-... 76 1e-10
133emb|BX057044.1|CNS09G6G Single read from an extremity of a full-... 76 1e-10
134emb|BX056961.1|CNS09G45 Single read from an extremity of a full-... 76 1e-10
135emb|BX055189.1|CNS09EQX Single read from an extremity of a full-... 76 1e-10
136emb|BX054843.1|CNS09EHB Single read from an extremity of a full-... 76 1e-10
137emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-... 76 1e-10
138emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-... 76 1e-10
139emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-... 76 1e-10
140emb|BX054430.1|CNS09E5U Single read from an extremity of a full-... 76 1e-10
141emb|BX054417.1|CNS09E5H Single read from an extremity of a full-... 76 1e-10
142emb|BX054379.1|CNS09E4F Single read from an extremity of a full-... 76 1e-10
143emb|BX053844.1|CNS09DPK Single read from an extremity of a full-... 76 1e-10
144emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-... 76 1e-10
145emb|BX052540.1|CNS09CPC Single read from an extremity of a full-... 76 1e-10
146emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-... 76 1e-10
147emb|BX051644.1|CNS09C0G Single read from an extremity of a full-... 76 1e-10
148emb|BX051423.1|CNS09BUB Single read from an extremity of a full-... 76 1e-10
149emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-... 76 1e-10
150emb|BX050810.1|CNS09BDA Single read from an extremity of a full-... 76 1e-10
151emb|BX050569.1|CNS09B6L Single read from an extremity of a full-... 76 1e-10
152emb|BX049265.1|CNS09A6D Single read from an extremity of a full-... 76 1e-10
153emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-... 76 1e-10
154emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-... 76 1e-10
155emb|BX047425.1|CNS098R9 Single read from an extremity of a full-... 76 1e-10
156emb|BX047145.1|CNS098JH Single read from an extremity of a full-... 76 1e-10
157emb|BX045582.1|CNS097C2 Single read from an extremity of a full-... 76 1e-10
158emb|BX045137.1|CNS096ZP Single read from an extremity of a full-... 76 1e-10
159emb|BX043850.1|CNS095ZY Single read from an extremity of a full-... 76 1e-10
160emb|BX043551.1|CNS095RN Single read from an extremity of a full-... 76 1e-10
161emb|BX041268.1|CNS09408 Single read from an extremity of a full-... 76 1e-10
162emb|BX041134.1|CNS093WI Single read from an extremity of a full-... 76 1e-10
163emb|BX041072.1|CNS093US Single read from an extremity of a full-... 76 1e-10
164emb|BX040787.1|CNS093MV Single read from an extremity of a full-... 76 1e-10
165emb|BX040786.1|CNS093MU Single read from an extremity of a full-... 76 1e-10
166emb|BX039654.1|CNS092RE Single read from an extremity of a full-... 76 1e-10
167emb|BX036687.1|CNS090GZ Single read from an extremity of a full-... 76 1e-10
168emb|BX037078.1|CNS090RU Single read from an extremity of a full-... 76 1e-10
169emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-... 76 1e-10
170emb|BX034653.1|CNS08YWH Single read from an extremity of a full-... 76 1e-10
171emb|BX033967.1|CNS08YDF Single read from an extremity of a full-... 76 1e-10
172emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-... 76 1e-10
173emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-... 76 1e-10
174emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-... 76 1e-10
175emb|BX032954.1|CNS08XLA Single read from an extremity of a full-... 76 1e-10
176emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-... 76 1e-10
177emb|BX032378.1|CNS08X5A Single read from an extremity of a full-... 76 1e-10
178emb|BX031877.1|CNS08WRD Single read from an extremity of a full-... 76 1e-10
179emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-... 76 1e-10
180emb|BX031537.1|CNS08WHX Single read from an extremity of a full-... 76 1e-10
181emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-... 76 1e-10
182emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-... 76 1e-10
183emb|BX030002.1|CNS08VBA Single read from an extremity of a full-... 76 1e-10
184emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-... 76 1e-10
185emb|BX029602.1|CNS08V06 Single read from an extremity of a full-... 76 1e-10
186emb|BX028637.1|CNS08U9D Single read from an extremity of a full-... 76 1e-10
187emb|BX022357.1|CNS08PEX Single read from an extremity of a full-... 76 1e-10
188emb|BX026844.1|CNS08SVK Single read from an extremity of a full-... 76 1e-10
189emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-... 76 1e-10
190emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-... 76 1e-10
191emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-... 76 1e-10
192emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-... 76 1e-10
193emb|BX025073.1|CNS08RID Single read from an extremity of a full-... 76 1e-10
194emb|BX025038.1|CNS08RHE Single read from an extremity of a full-... 76 1e-10
195emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-... 76 1e-10
196emb|BX024670.1|CNS08R76 Single read from an extremity of a full-... 76 1e-10
197emb|BX024145.1|CNS08QSL Single read from an extremity of a full-... 76 1e-10
198emb|BX023815.1|CNS08QJF Single read from an extremity of a full-... 76 1e-10
199emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-... 76 1e-10
200emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-... 76 1e-10
201emb|BX020305.1|CNS08NTX Single read from an extremity of a full-... 76 1e-10
202emb|BX018974.1|CNS08MSY Single read from an extremity of a full-... 76 1e-10
203emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-... 76 1e-10
204emb|BX017981.1|CNS08M1D Single read from an extremity of a full-... 76 1e-10
205emb|BX018524.1|CNS08MGG Single read from an extremity of a full-... 76 1e-10
206emb|BX018377.1|CNS08MCD Single read from an extremity of a full-... 76 1e-10
207emb|BX017737.1|CNS08LUL Single read from an extremity of a full-... 76 1e-10
208emb|BX017331.1|CNS08LJB Single read from an extremity of a full-... 76 1e-10
209emb|BX016524.1|CNS08KWW Single read from an extremity of a full-... 76 1e-10
210emb|BX016411.1|CNS08KTR Single read from an extremity of a full-... 76 1e-10
211emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-... 76 1e-10
212emb|BX014218.1|CNS08J4U Single read from an extremity of a full-... 76 1e-10
213emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-... 76 1e-10
214emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-... 76 1e-10
215emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-... 76 1e-10
216emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-... 76 1e-10
217emb|BX010378.1|CNS08G66 Single read from an extremity of a full-... 76 1e-10
218emb|BX009864.1|CNS08FRW Single read from an extremity of a full-... 76 1e-10
219emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-... 76 1e-10
220emb|BX008448.1|CNS08EOK Single read from an extremity of a full-... 76 1e-10
221emb|BX008129.1|CNS08EFP Single read from an extremity of a full-... 76 1e-10
222emb|BX008128.1|CNS08EFO Single read from an extremity of a full-... 76 1e-10
223emb|BX007575.1|CNS08E0B Single read from an extremity of a full-... 76 1e-10
224emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-... 76 1e-10
225emb|BX005817.1|CNS08CNH Single read from an extremity of a full-... 76 1e-10
226emb|AL112254.1|CNS019YE Botrytis cinerea strain T4 cDNA library 76 1e-10
227gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, co... 76 1e-10
228ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416 ... 76 1e-10
229gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal ... 74 4e-10
230gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal ... 74 4e-10
231gb|AY769276.1| Bombyx mori ribosomal protein L8 (RpL8) mRNA, com... 74 4e-10
232emb|BX046386.1|CNS097YE Single read from an extremity of a full-... 74 4e-10
233emb|AM049008.1| Biphyllus lunatus mRNA for ribosomal protein L8e... 72 2e-09
234emb|BX054108.1|CNS09DWW Single read from an extremity of a full-... 72 2e-09
235emb|BX007182.1|CNS08DPE Single read from an extremity of a full-... 72 2e-09
236emb|BX005504.1|CNS08CES Single read from an extremity of a full-... 72 2e-09
237gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon... 70 7e-09
238gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clo... 70 7e-09
239ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA 70 7e-09
240ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g ... 70 7e-09
241ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA 70 7e-09
242emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 70 7e-09
243gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clon... 70 7e-09
244dbj|AK131970.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 70 7e-09
245dbj|AK145498.1| Mus musculus blastocyst blastocyst cDNA, RIKEN f... 70 7e-09
246dbj|AK146330.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-... 70 7e-09
247dbj|AK152063.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 70 7e-09
248dbj|AK151408.1| Mus musculus bone marrow macrophage cDNA, RIKEN ... 70 7e-09
249dbj|AK167775.1| Mus musculus cDNA, RIKEN full-length enriched li... 70 7e-09
250dbj|AK168769.1| Mus musculus 13 days embryo liver cDNA, RIKEN fu... 70 7e-09
251dbj|AK168332.1| Mus musculus TIB-55 BB88 cDNA, RIKEN full-length... 70 7e-09
252dbj|AK088263.1| Mus musculus 2 days neonate thymus thymic cells ... 70 7e-09
253emb|AL111256.1|CNS0196O Botrytis cinerea strain T4 cDNA library 70 7e-09
254gb|AY168762.1| Branchiostoma belcheri tsingtaunese ribosomal pro... 70 7e-09
255dbj|AB180407.1| Plutella xylostella mRNA for Ribosomal protein L... 70 7e-09
256dbj|AK108964.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
257dbj|AK108169.1| Oryza sativa (japonica cultivar-group) cDNA clon... 70 7e-09
258gb|U67771.1|MMU67771 Mus musculus ribosomal protein L8 (RPL8) mR... 70 7e-09
259gb|AF481057.1| Aplysia californica ribosomal protein L8 mRNA, pa... 68 3e-08
260emb|BX060935.1|CNS09J6J Single read from an extremity of a full-... 68 3e-08
261emb|BX063741.1|CNS09LCH Single read from an extremity of a full-... 68 3e-08
262emb|BX055232.1|CNS09ES4 Single read from an extremity of a full-... 68 3e-08
263emb|BX052582.1|CNS09CQI Single read from an extremity of a full-... 68 3e-08
264emb|BX052386.1|CNS09CL2 Single read from an extremity of a full-... 68 3e-08
265emb|BX044908.1|CNS096TC Single read from an extremity of a full-... 68 3e-08
266emb|BX043909.1|CNS0961L Single read from an extremity of a full-... 68 3e-08
267emb|BX036920.1|CNS090NG Single read from an extremity of a full-... 68 3e-08
268emb|BX025869.1|CNS08S4H Single read from an extremity of a full-... 68 3e-08
269emb|BX022874.1|CNS08PTA Single read from an extremity of a full-... 68 3e-08
270emb|BX021963.1|CNS08P3Z Single read from an extremity of a full-... 68 3e-08
271emb|BX012237.1|CNS08HLT Single read from an extremity of a full-... 68 3e-08
272emb|BX010208.1|CNS08G1G Single read from an extremity of a full-... 68 3e-08
273emb|BX008408.1|CNS08ENG Single read from an extremity of a full-... 68 3e-08
274emb|BX007216.1|CNS08DQC Single read from an extremity of a full-... 68 3e-08
275emb|AJ414568.1| Paracentrotus mRNA for ribosomal protein L8 (suL... 68 3e-08
276emb|AL115964.1|CNS01CTG Botrytis cinerea strain T4 cDNA library 68 3e-08
277gb|DQ206473.1| Platynereis dumerilii isolate TOA23 ribosomal pro... 68 3e-08
278gb|AF057288.1|AF057288 Aplysia californica ribosomal protein L8 ... 68 3e-08
279gb|AY533227.1| Chinchilla lanigera ribosomal protein L8 mRNA, pa... 66 1e-07
280ref|XM_447807.1| Candida glabrata CBS138, CAGL0J02354g partial mRNA 66 1e-07
281emb|BX036193.1|CNS09039 Single read from an extremity of a full-... 66 1e-07
282emb|CR380956.1| Candida glabrata strain CBS138 chromosome J comp... 66 1e-07
283gb|AF440009.1|AF440009 Talaromyces emersonii 60S ribosomal prote... 66 1e-07
284ref|XM_505841.1| Yarrowia lipolytica CLIB122, YALI0F24739g predi... 64 4e-07
285emb|BX036225.1|CNS09045 Single read from an extremity of a full-... 64 4e-07
286emb|BX006811.1|CNS08DF3 Single read from an extremity of a full-... 64 4e-07
287dbj|AK175100.1| Ciona intestinalis cDNA, clone:cixxx00151, full ... 64 4e-07
288dbj|AK175099.1| Ciona intestinalis cDNA, clone:cixxx00150, full ... 64 4e-07
289dbj|AK174301.1| Ciona intestinalis cDNA, clone:cicl028m21, full ... 64 4e-07
290emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB1... 64 4e-07
291ref|XM_369754.1| Magnaporthe grisea 70-15 hypothetical protein (... 62 2e-06
292ref|XM_322498.1| Neurospora crassa OR74A hypothetical protein ( ... 62 2e-06
293ref|XM_952206.1| Neurospora crassa OR74A hypothetical protein ( ... 62 2e-06
294emb|BX070723.1|CNS09QQF Single read from an extremity of a full-... 62 2e-06
295emb|BX042526.1|CNS094Z6 Single read from an extremity of a full-... 62 2e-06
296emb|BX035977.1|CNS08ZX9 Single read from an extremity of a full-... 62 2e-06
297emb|BX019953.1|CNS08NK5 Single read from an extremity of a full-... 62 2e-06
298ref|XM_628385.1| Cryptosporidium parvum Iowa II 60S ribosomal pr... 62 2e-06
299gb|AY130440.1| Danio rerio ribosomal protein L8-like mRNA, parti... 62 2e-06
300gb|AY130438.1| Petromyzon marinus ribosomal protein L8 mRNA, par... 62 2e-06
301gb|AY130436.1| Branchiostoma lanceolatum ribosomal protein L8 mR... 62 2e-06
302gb|AY829774.1| Lonomia obliqua ribosomal protein 17 mRNA, comple... 60 7e-06
303ref|XM_791845.1| PREDICTED: Strongylocentrotus purpuratus simila... 60 7e-06
304emb|BX068768.1|CNS09P84 Single read from an extremity of a full-... 60 7e-06
305emb|BX066573.1|CNS09NJ5 Single read from an extremity of a full-... 60 7e-06
306emb|BX064210.1|CNS09LPI Single read from an extremity of a full-... 60 7e-06
307emb|BX061860.1|CNS09JW8 Single read from an extremity of a full-... 60 7e-06
308emb|BX058354.1|CNS09H6U Single read from an extremity of a full-... 60 7e-06
309emb|BX053072.1|CNS09D44 Single read from an extremity of a full-... 60 7e-06
310emb|BX052868.1|CNS09CYG Single read from an extremity of a full-... 60 7e-06
311emb|BX052221.1|CNS09CGH Single read from an extremity of a full-... 60 7e-06
312emb|BX050253.1|CNS09AXT Single read from an extremity of a full-... 60 7e-06
313emb|BX050252.1|CNS09AXS Single read from an extremity of a full-... 60 7e-06
314emb|BX047421.1|CNS098R5 Single read from an extremity of a full-... 60 7e-06
315emb|BX033148.1|CNS08XQO Single read from an extremity of a full-... 60 7e-06
316emb|BX025144.1|CNS08RKC Single read from an extremity of a full-... 60 7e-06
317emb|BX025032.1|CNS08RH8 Single read from an extremity of a full-... 60 7e-06
318emb|BX022054.1|CNS08P6I Single read from an extremity of a full-... 60 7e-06
319emb|BX018523.1|CNS08MGF Single read from an extremity of a full-... 60 7e-06
320emb|BX017330.1|CNS08LJA Single read from an extremity of a full-... 60 7e-06
321emb|BX016910.1|CNS08L7M Single read from an extremity of a full-... 60 7e-06
322emb|BX013459.1|CNS08IJR Single read from an extremity of a full-... 60 7e-06
323emb|BX012210.1|CNS08HL2 Single read from an extremity of a full-... 60 7e-06
324emb|BX010377.1|CNS08G65 Single read from an extremity of a full-... 60 7e-06
325ref|XM_790908.1| PREDICTED: Strongylocentrotus purpuratus simila... 60 7e-06
326gb|AY857413.1| Suberites domuncula L2/L8 mRNA, partial cds 60 7e-06
327ref|XM_568209.1| Cryptococcus neoformans var. neoformans JEC21 h... 58 3e-05
328ref|NM_075539.2| Caenorhabditis elegans Ribosomal Protein, Large... 58 3e-05
329emb|Z81453.1|CEB0250 Caenorhabditis elegans Cosmid B0250, comple... 58 3e-05
330gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chr... 56 1e-04
331ref|XM_654787.1| Aspergillus nidulans FGSC A4 hypothetical prote... 56 1e-04
332ref|XM_757274.1| Ustilago maydis 521 hypothetical protein (UM062... 56 1e-04
333ref|XM_748904.1| Aspergillus fumigatus Af293 60s ribosomal prote... 56 1e-04
334ref|XM_661983.1| Cryptosporidium hominis TU502 60S ribosomal pro... 56 1e-04
335emb|BX057209.1|CNS09GB1 Single read from an extremity of a full-... 56 1e-04
336emb|BX034140.1|CNS08YI8 Single read from an extremity of a full-... 56 1e-04
337emb|BX008695.1|CNS08EVF Single read from an extremity of a full-... 56 1e-04
338emb|AL929353.1|PFA929353 Plasmodium falciparum strain 3D7, chrom... 56 1e-04
339dbj|AB010072.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 56 1e-04
340gb|BC059744.1| Xenopus tropicalis 60S ribosomal protein L8, mRNA... 54 4e-04
341ref|XM_387107.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 54 4e-04
342gb|BC043823.1| Xenopus laevis ribosomal protein L8, mRNA (cDNA c... 54 4e-04
343ref|XM_773289.1| Giardia lamblia ATCC 50803 60S ribosomal protei... 54 4e-04
344emb|BX036686.1|CNS090GY Single read from an extremity of a full-... 54 4e-04
345gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10... 54 4e-04
346ref|NM_001026174.2| Caenorhabditis elegans B0250.3 (B0250.3) mRN... 54 4e-04
347ref|NM_203594.1| Xenopus tropicalis 60S ribosomal protein L8 (MG... 54 4e-04
348dbj|AB089491.1| Giardia intestinalis gene for ribosomal protein ... 54 4e-04
349ref|NM_209322.1| Eremothecium gossypii ADL127Cp (ADL127C), mRNA 54 4e-04
350emb|CR760793.2| Xenopus tropicalis finished cDNA, clone TTpA008p15 54 4e-04
351gb|U00920.1|U00920 Xenopus laevis ribosomal protein L8 mRNA, com... 54 4e-04
352ref|NM_001034916.2| Rattus norvegicus ribosomal protein L8 (Rpl8... 52 0.002
353emb|BX071011.1|CNS09QYF Single read from an extremity of a full-... 52 0.002
354emb|BX070722.1|CNS09QQE Single read from an extremity of a full-... 52 0.002
355emb|BX066503.1|CNS09NH7 Single read from an extremity of a full-... 52 0.002
356emb|BX065895.1|CNS09N0B Single read from an extremity of a full-... 52 0.002
357emb|BX065161.1|CNS09MFX Single read from an extremity of a full-... 52 0.002
358emb|BX062637.1|CNS09KHT Single read from an extremity of a full-... 52 0.002
359emb|BX059791.1|CNS09IAR Single read from an extremity of a full-... 52 0.002
360emb|BX056960.1|CNS09G44 Single read from an extremity of a full-... 52 0.002
361emb|BX055357.1|CNS09EVL Single read from an extremity of a full-... 52 0.002
362emb|BX054429.1|CNS09E5T Single read from an extremity of a full-... 52 0.002
363emb|BX053843.1|CNS09DPJ Single read from an extremity of a full-... 52 0.002
364emb|BX044907.1|CNS096TB Single read from an extremity of a full-... 52 0.002
365emb|BX043550.1|CNS095RM Single read from an extremity of a full-... 52 0.002
366emb|BX033966.1|CNS08YDE Single read from an extremity of a full-... 52 0.002
367emb|BX030001.1|CNS08VB9 Single read from an extremity of a full-... 52 0.002
368emb|BX026788.1|CNS08SU0 Single read from an extremity of a full-... 52 0.002
369emb|BX019695.1|CNS08NCZ Single read from an extremity of a full-... 52 0.002
370emb|BX020304.1|CNS08NTW Single read from an extremity of a full-... 52 0.002
371emb|BX018002.1|CNS08M1Y Single read from an extremity of a full-... 52 0.002
372emb|BX015957.1|CNS08KH5 Single read from an extremity of a full-... 52 0.002
373emb|BX009833.1|CNS08FR1 Single read from an extremity of a full-... 52 0.002
374emb|X62145.1|RRRPL8 R.rattus mRNA for ribosomal protein L8 52 0.002
375gb|DQ206502.1| Priapulus caudatus isolate TOA23 ribosomal protei... 52 0.002
376emb|AL031229.2|HS15D7 Human DNA sequence from clone RP1-15D7 on ... 50 0.006
377emb|AL445067.1|TACID5 Thermoplasma acidophilum complete genome; ... 50 0.006
378gb|AC069218.13| Homo sapiens 3 BAC RP11-393N4 (Roswell Park Canc... 50 0.006
379emb|AL112347.1|CNS01A0Z Botrytis cinerea strain T4 cDNA library 50 0.006
380dbj|AB011475.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 50 0.006
381gb|CP000081.1| Leishmania major chromosome 35, complete sequence 48 0.025
382gb|AY389974.1| Latimeria chalumnae ribosomal protein L8 mRNA, pa... 48 0.025
383ref|XM_838156.1| Leishmania major strain Friedlin 60S ribosomal ... 48 0.025
384ref|XM_838157.1| Leishmania major strain Friedlin 60S ribosomal ... 48 0.025
385ref|XM_804562.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 48 0.025
386ref|XM_805929.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 48 0.025
387ref|XM_811273.1| Trypanosoma cruzi strain CL Brener 60S ribosoma... 48 0.025
388gb|AY961525.1| Lysiphlebus testaceipes ribosomal protein L8 (RpL... 48 0.025
389ref|XM_853403.1| PREDICTED: Canis familiaris similar to 60S ribo... 46 0.10
390ref|XM_853369.1| PREDICTED: Canis familiaris similar to 60S ribo... 46 0.10
391ref|XM_532360.2| PREDICTED: Canis familiaris similar to 60S ribo... 46 0.10
392ref|XM_761479.1| Theileria parva strain Muguga chromosome 1 60S ... 46 0.10
393ref|XM_719533.1| Plasmodium yoelii yoelii str. 17XNL 60S ribosom... 46 0.10
394ref|XM_849369.1| PREDICTED: Canis familiaris similar to 60S ribo... 46 0.10
395emb|BX012209.1|CNS08HL1 Single read from an extremity of a full-... 46 0.10
396emb|BX571661.1| Wolinella succinogenes, complete genome; segment... 46 0.10
397dbj|AB226245.1| Aspergillus oryzae cDNA, contig sequence: AoEST3104 46 0.10
398gb|DQ206602.1| Monosiga brevicollis isolate TOA23 ribosomal prot... 46 0.10
399gb|AY871293.1| Gekko japonicus GekBS074P mRNA, complete cds 46 0.10
400ref|XM_416772.1| PREDICTED: Gallus gallus similar to 60S ribosom... 44 0.40
401gb|AY452063.1| Rana catesbeiana ribosomal protein L8 mRNA, parti... 44 0.40
402gb|AC098683.18| Mus musculus strain 129/Sv clone ct7-128f23 map ... 44 0.40
403gb|AC115293.5| Mus musculus BAC clone RP23-92N2 from chromosome ... 44 0.40
404gb|AC098684.13| Mus musculus strain 129/Sv clone ct7-391l15 map ... 44 0.40
405emb|BX017736.1|CNS08LUK Single read from an extremity of a full-... 44 0.40
406emb|BX935284.2| Gallus gallus finished cDNA, clone ChEST961c19 44 0.40
407emb|BX933795.2| Gallus gallus finished cDNA, clone ChEST911e3 44 0.40
408emb|CR386367.1| Gallus gallus finished cDNA, clone ChEST931o12 44 0.40
409emb|AL111994.1|CNS019R6 Botrytis cinerea strain T4 cDNA library 44 0.40
410gb|AC156029.2| Mus musculus BAC clone RP23-42O8 from chromosome ... 44 0.40
411emb|BX935079.1| Gallus gallus finished cDNA, clone ChEST72m12 44 0.40
412gb|BC013104.1| Homo sapiens ribosomal protein L8, transcript var... 42 1.6
413gb|CP000127.1| Nitrosococcus oceani ATCC 19707, complete genome 42 1.6
414ref|NM_000973.3| Homo sapiens ribosomal protein L8 (RPL8), trans... 42 1.6
415ref|NM_033301.1| Homo sapiens ribosomal protein L8 (RPL8), trans... 42 1.6
416gb|AY116659.1| Trimenia moorei ribosomal protein L2 (rpl2) gene,... 42 1.6
417gb|BC002423.1| Homo sapiens ribosomal protein L8, mRNA (cDNA clo... 42 1.6
418gb|BC000047.2| Homo sapiens ribosomal protein L8, mRNA (cDNA clo... 42 1.6
419gb|AE004288.1| Vibrio cholerae O1 biovar eltor str. N16961 chrom... 42 1.6
420gb|BC000077.2| Homo sapiens ribosomal protein L8, transcript var... 42 1.6
421emb|BX545856.10| Zebrafish DNA sequence from clone DKEY-216E24 i... 42 1.6
422gb|BC021069.1| Homo sapiens cDNA clone IMAGE:2964491, **** WARNI... 42 1.6
423gb|BC021039.1| Homo sapiens cDNA clone IMAGE:2964491, **** WARNI... 42 1.6
424gb|BC090060.1| Homo sapiens cDNA clone IMAGE:6568950, **** WARNI... 42 1.6
425gb|BC099919.1| Homo sapiens cDNA clone IMAGE:4549190, **** WARNI... 42 1.6
426gb|BC015588.1| Homo sapiens cDNA clone IMAGE:4643311, **** WARNI... 42 1.6
427emb|AL356794.10| Human DNA sequence from clone RP11-551A11 on ch... 42 1.6
428gb|BT009875.1| Synthetic construct Homo sapiens ribosomal protei... 42 1.6
429emb|Z28407.1|HSRBPL8 H.sapiens mRNA for ribosomal protein L8 42 1.6
430emb|CR859970.1| Pongo pygmaeus mRNA; cDNA DKFZp468G132 (from clo... 42 1.6
431emb|CR457046.1| Homo sapiens full open reading frame cDNA clone ... 42 1.6
432gb|BT007379.1| Homo sapiens ribosomal protein L8 mRNA, complete cds 42 1.6
433gb|BC012197.1| Homo sapiens ribosomal protein L8, transcript var... 42 1.6
434emb|CR615771.1| full-length cDNA clone CS0DA007YK24 of Neuroblas... 42 1.6
435emb|CR626383.1| full-length cDNA clone CS0DC017YA07 of Neuroblas... 42 1.6
436emb|CR625384.1| full-length cDNA clone CS0DJ005YH06 of T cells (... 42 1.6
437emb|CR625112.1| full-length cDNA clone CS0DJ013YB05 of T cells (... 42 1.6
438emb|CR624942.1| full-length cDNA clone CS0DB004YO19 of Neuroblas... 42 1.6
439emb|CR623747.1| full-length cDNA clone CS0DL002YC07 of B cells (... 42 1.6
440emb|CR623386.1| full-length cDNA clone CS0DC016YE12 of Neuroblas... 42 1.6
441emb|CR619989.1| full-length cDNA clone CS0DI087YD17 of Placenta ... 42 1.6
442emb|CR614795.1| full-length cDNA clone CS0DG007YO04 of B cells (... 42 1.6
443emb|CR614597.1| full-length cDNA clone CS0DK003YN23 of HeLa cell... 42 1.6
444emb|CR612339.1| full-length cDNA clone CS0DF019YP10 of Fetal bra... 42 1.6
445emb|CR611740.1| full-length cDNA clone CS0DJ005YH14 of T cells (... 42 1.6
446emb|CR610036.1| full-length cDNA clone CS0DL002YC15 of B cells (... 42 1.6
447emb|CR607220.1| full-length cDNA clone CS0DB007YI18 of Neuroblas... 42 1.6
448emb|CR606016.1| full-length cDNA clone CS0DJ014YC19 of T cells (... 42 1.6
449emb|CR605549.1| full-length cDNA clone CS0DI051YJ22 of Placenta ... 42 1.6
450emb|CR604122.1| full-length cDNA clone CS0DC004YG24 of Neuroblas... 42 1.6
451emb|CR604065.1| full-length cDNA clone CS0DD005YI10 of Neuroblas... 42 1.6
452emb|CR603238.1| full-length cDNA clone CL0BA003ZC08 of Placenta ... 42 1.6
453emb|CR601765.1| full-length cDNA clone CS0DI015YA02 of Placenta ... 42 1.6
454emb|CR601648.1| full-length cDNA clone CS0DI025YJ10 of Placenta ... 42 1.6
455emb|CR601133.1| full-length cDNA clone CS0DB005YD21 of Neuroblas... 42 1.6
456emb|CR599267.1| full-length cDNA clone CS0CAP005YM14 of Thymus o... 42 1.6
457emb|CR599190.1| full-length cDNA clone CS0DK003YE12 of HeLa cell... 42 1.6
458emb|CR599063.1| full-length cDNA clone CS0DC008YC19 of Neuroblas... 42 1.6
459emb|CR596459.1| full-length cDNA clone CS0DK008YJ05 of HeLa cell... 42 1.6
460emb|CR595877.1| full-length cDNA clone CS0DK006YP04 of HeLa cell... 42 1.6
461emb|CR595000.1| full-length cDNA clone CS0DL010YC19 of B cells (... 42 1.6
462emb|CR592009.1| full-length cDNA clone CS0DM014YC11 of Fetal liv... 42 1.6
463emb|CR590460.1| full-length cDNA clone CS0DC024YH14 of Neuroblas... 42 1.6
464emb|CR590177.1| full-length cDNA clone CS0DI071YE07 of Placenta ... 42 1.6
465gb|BC093064.1| Homo sapiens ribosomal protein L8, transcript var... 42 1.6
466gb|AY892765.1| Synthetic construct Homo sapiens clone FLH024583.... 42 1.6
467gb|AY892421.1| Synthetic construct Homo sapiens clone FLH028535.... 42 1.6
468gb|AY890288.1| Synthetic construct Homo sapiens clone FLH024588.... 42 1.6
469gb|AY890287.1| Synthetic construct Homo sapiens clone FLH024587.... 42 1.6
470gb|AY889944.1| Synthetic construct Homo sapiens clone FLH028539.... 42 1.6
471gb|BC030151.2| Homo sapiens ribosomal protein L8, transcript var... 42 1.6
472gb|AC152111.1| Pichia stipitis clone JGIAHYZ-17L1, complete sequ... 40 6.2
473ref|XM_507655.1| PREDICTED: Pan troglodytes similar to chromosom... 40 6.2
474gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, com... 40 6.2
475gb|CP000068.1| Trypanosoma brucei chromosome 5, complete sequence 40 6.2
476gb|AC159432.1| Trypanosoma brucei chromosome 5 clone RPCI93-28F8... 40 6.2
477gb|AC157554.7| Mus musculus chromosome 15, clone RP24-324P21, co... 40 6.2
478ref|XM_458992.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 6.2
479ref|XM_457613.1| Debaryomyces hansenii CBS767 hypothetical prote... 40 6.2
480ref|NM_153256.2| Homo sapiens chromosome 10 open reading frame 4... 40 6.2
481gb|AC137096.10| Mus musculus chromosome 8, clone RP24-473D4, com... 40 6.2
482ref|XM_819275.1| Trypanosoma brucei TREU927 clone RPCI93-28F8 60... 40 6.2
483gb|BC017269.2| Homo sapiens chromosome 10 open reading frame 47,... 40 6.2
484gb|AC127677.4| Mus musculus BAC clone RP24-226C2 from chromosome... 40 6.2
485gb|CP000107.1| Ehrlichia canis str. Jake, complete genome 40 6.2
486emb|AL138898.19| Human DNA sequence from clone RP11-401F24 on ch... 40 6.2
487emb|BX022542.1|CNS08PK2 Single read from an extremity of a full-... 40 6.2
488emb|CR628337.1| Legionella pneumophila str. Lens complete genome 40 6.2
489emb|CR382136.1| Debaryomyces hansenii chromosome D of strain CBS... 40 6.2
490emb|CR382134.1| Debaryomyces hansenii chromosome B of strain CBS... 40 6.2
491dbj|AP008230.1| Desulfitobacterium hafniense Y51 genomic DNA, co... 40 6.2
492emb|CR621861.1| full-length cDNA clone CS0DK003YK10 of HeLa cell... 40 6.2
493gb|CP000264.1| Jannaschia sp. CCS1, complete genome 40 6.2
494ref|XM_697241.1| PREDICTED: Danio rerio hypothetical protein LOC... 40 6.2
495gb|AE006470.1| Chlorobium tepidum TLS, complete genome 40 6.2
496dbj|BA000003.2| Buchnera aphidicola str. APS (Acyrthosiphon pisu... 40 6.2
497gb|AY325816.1| Zea mays BAC clone Z013I05, complete sequence 40 6.2
498gb|BC048800.1| Homo sapiens chromosome 10 open reading frame 47,... 40 6.2
499gb|AC172370.2| Gallus gallus BAC clone CH261-119J18 from chromos... 40 6.2
500gb|AC160019.2| Gallus gallus BAC clone CH261-50H15 from chromoso... 40 6.2

>gb|AF479049.1| Triticum aestivum ribosomal protein L2 mRNA, partial cds
          Length = 270

 Score =  410 bits (207), Expect = e-111
 Identities = 234/243 (96%)
 Strand = Plus / Minus

                                                                       
Query: 219 ctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagt 278
           ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||
Sbjct: 270 ctaagtggccttgtcggccttggcagcagaggcggcagcctggcctctgagacgaccagt 211

                                                                       
Query: 279 cctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtgga 338
           |||||| ||||| |||||||||||||||||||| ||||||||||||||||| ||||||||
Sbjct: 210 cctcctagcagcgatgagaccaaccttctggccaggtggtgcatcacggcggacagtgga 151

                                                                       
Query: 339 agcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggc 398
           ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Sbjct: 150 agcgtgaccaatatgctggtggttacctcctccgtggggatgctccacagggttcatggc 91

                                                                       
Query: 399 cacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttacc 458
           ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
Sbjct: 90  cacaccacgcaccttaggccacgagttcctcttcacacggtacttgtggtaggcgttacc 31

              
Query: 459 agc 461
           |||
Sbjct: 30  agc 28



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score =  337 bits (170), Expect = 2e-89
 Identities = 227/246 (92%)
 Strand = Plus / Minus

                                                                            
Query: 216      actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 275
                |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 23385250 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 23385191

                                                                            
Query: 276      agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 335
                ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 23385190 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 23385131

                                                                            
Query: 336      ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 395
                ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 23385130 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 23385071

                                                                            
Query: 396      ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
                ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 23385070 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 23385011

                      
Query: 456      accagc 461
                 |||||
Sbjct: 23385010 tccagc 23385005



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                                
Query: 123      accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 170
                |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 23385354 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 23385307



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score =  337 bits (170), Expect = 2e-89
 Identities = 227/246 (92%)
 Strand = Plus / Minus

                                                                            
Query: 216      actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 275
                |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 23313441 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 23313382

                                                                            
Query: 276      agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 335
                ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 23313381 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 23313322

                                                                            
Query: 336      ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 395
                ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 23313321 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 23313262

                                                                            
Query: 396      ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
                ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 23313261 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 23313202

                      
Query: 456      accagc 461
                 |||||
Sbjct: 23313201 tccagc 23313196



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                                
Query: 123      accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 170
                |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 23313545 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 23313498



to top

>emb|AL731784.3|CNS08C88 Oryza sativa chromosome 12, . BAC OSJNBa0016C14 of library OSJNBa from
              chromosome 12 of cultivar Nipponbare of ssp. japonica of
              Oryza sativa (rice), complete sequence
          Length = 162261

 Score =  337 bits (170), Expect = 2e-89
 Identities = 227/246 (92%)
 Strand = Plus / Plus

                                                                          
Query: 216    actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 275
              |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 116909 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 116968

                                                                          
Query: 276    agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 335
              ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 116969 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 117028

                                                                          
Query: 336    ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 395
              ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 117029 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 117088

                                                                          
Query: 396    ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
              ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 117089 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 117148

                    
Query: 456    accagc 461
               |||||
Sbjct: 117149 tccagc 117154



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 41/48 (85%)
 Strand = Plus / Plus

                                                              
Query: 123    accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 170
              |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 116805 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 116852



to top

>dbj|AK104806.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-040-E03, full
           insert sequence
          Length = 1037

 Score =  329 bits (166), Expect = 5e-87
 Identities = 226/246 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 275
           |||||||||||||||||||| ||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 854 actctaagtggccttgtcggtcttggcagcggtagcggcggcctggcctctgagacgacc 795

                                                                       
Query: 276 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 335
           ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 794 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 735

                                                                       
Query: 336 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 395
           ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 734 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 675

                                                                       
Query: 396 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 674 ggccacaccacgcaccttaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 615

                 
Query: 456 accagc 461
            |||||
Sbjct: 614 tccagc 609



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 123 accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 170
           |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 958 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 911



to top

>dbj|AK070647.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063F19, full
           insert sequence
          Length = 1072

 Score =  329 bits (166), Expect = 5e-87
 Identities = 226/246 (91%)
 Strand = Plus / Minus

                                                                       
Query: 216 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 275
           |||||||||||||||||||||||| ||||| |  ||||| ||||||||||| ||||||||
Sbjct: 855 actctaagtggccttgtcggccttggcagcggtagcggcggcctggcctctgagacgacc 796

                                                                       
Query: 276 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 335
           ||||||||| ||||| |||||||||||||||||||| || |||||||||||||| || ||
Sbjct: 795 agtcctccttgcagcgatgagaccaaccttctggccaggaggtgcatcacggcggacggt 736

                                                                       
Query: 336 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 395
           ||| || |||||||| ||||||||||||||||||||||||||||||||||| ||||||||
Sbjct: 735 ggaggcgtgaccaatgtgctggtggttacctcctccgtggggatgctcaacggggttcat 676

                                                                       
Query: 396 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           |||||||||||||||| |||||||| ||||||||||||| ||||||||||||||||||||
Sbjct: 675 ggccacaccacgcaccctaggccagcagttcctcttcacgcggtacttgtggtaggcgtt 616

                 
Query: 456 accagc 461
            |||||
Sbjct: 615 tccagc 610



 Score = 40.1 bits (20), Expect = 6.2
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 123 accaaagtaccgagcaaaaacgacaaccttactgcaatacatgtcctt 170
           |||| |||||| ||||||||  || ||| ||||| |||||||||||||
Sbjct: 959 accagagtaccaagcaaaaagcacgaccatactggaatacatgtcctt 912



to top

>gb|AY108123.1| Zea mays PCO067267 mRNA sequence
          Length = 1062

 Score =  272 bits (137), Expect = 9e-70
 Identities = 212/237 (89%)
 Strand = Plus / Minus

                                                                       
Query: 225 ggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcct 284
           ||||||||| ||||| |||||||  || ||||| ||||| |||||||||||||| |||||
Sbjct: 876 ggccttgtcagccttggcagcagtagcagcagcttggcccctaagacgaccagttctcct 817

                                                                       
Query: 285 ggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatg 344
            || ||||| ||||||||||||||||| || || ||||||||||| |||||||| |||||
Sbjct: 816 tgcggcaataagaccaaccttctggccaggaggagcatcacggcggacagtggaggcatg 757

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| |||||||||||||||||||| || |||||||||||||||||||||||||||||
Sbjct: 756 accaatgtgctggtggttacctcctccatgaggatgctcaacagggttcatggccacacc 697

                                                                    
Query: 405 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgttaccagc 461
           ||||||||||||||||  ||||||||| || ||||||||||||||||| || |||||
Sbjct: 696 acgcaccttaggccagctgttcctcttgacgcggtacttgtggtaggcattgccagc 640



to top

>ref|NM_119780.2| Arabidopsis thaliana structural constituent of ribosome AT4G36130
           mRNA, complete cds
          Length = 1048

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 312
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 313 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 372
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 373 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 432
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                        
Query: 433 acacggtacttgtggtaggcgttaccagc 461
           ||||||||||||||||| |||||||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagc 592



to top

>emb|AL161588.2|ATCHRIV84 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 84
          Length = 195452

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                          
Query: 253    gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 312
              ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 170391 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 170332

                                                                          
Query: 313    ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 372
              |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 170331 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 170272

                                                                          
Query: 373    tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 432
              || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 170271 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 170212

                                           
Query: 433    acacggtacttgtggtaggcgttaccagc 461
              ||||||||||||||||| |||||||||||
Sbjct: 170211 acacggtacttgtggtatgcgttaccagc 170183



to top

>emb|AL022141.1|ATF23E13 Arabidopsis thaliana DNA chromosome 4, BAC clone F23E13 (ESSAII
            project)
          Length = 94695

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                        
Query: 253  gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 312
            ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 3218 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 3159

                                                                        
Query: 313  ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 372
            |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 3158 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 3099

                                                                        
Query: 373  tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 432
            || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 3098 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 3039

                                         
Query: 433  acacggtacttgtggtaggcgttaccagc 461
            ||||||||||||||||| |||||||||||
Sbjct: 3038 acacggtacttgtggtatgcgttaccagc 3010



to top

>emb|AL022373.1|ATT19K4 Arabidopsis thaliana DNA chromosome 4, BAC clone T19K4 (ESSAII project)
          Length = 106007

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                          
Query: 253    gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 312
              ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 105120 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 105061

                                                                          
Query: 313    ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 372
              |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 105060 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 105001

                                                                          
Query: 373    tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 432
              || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 105000 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 104941

                                           
Query: 433    acacggtacttgtggtaggcgttaccagc 461
              ||||||||||||||||| |||||||||||
Sbjct: 104940 acacggtacttgtggtatgcgttaccagc 104912



to top

>gb|AF361610.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 1029

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 312
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 313 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 372
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 373 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 432
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                        
Query: 433 acacggtacttgtggtaggcgttaccagc 461
           ||||||||||||||||| |||||||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagc 592



to top

>gb|AF367335.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 972

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 312
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 800 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 741

                                                                       
Query: 313 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 372
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 740 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 681

                                                                       
Query: 373 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 432
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 680 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 621

                                        
Query: 433 acacggtacttgtggtaggcgttaccagc 461
           ||||||||||||||||| |||||||||||
Sbjct: 620 acacggtacttgtggtatgcgttaccagc 592



to top

>gb|AY058221.1| Arabidopsis thaliana AT4g36130/F23E13_20 mRNA, complete cds
          Length = 777

 Score =  224 bits (113), Expect = 2e-55
 Identities = 185/209 (88%)
 Strand = Plus / Minus

                                                                       
Query: 253 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 312
           ||||| || ||||| ||||||||||||||||| |||||||| ||||||||||| |  || 
Sbjct: 752 gcagcttgacctctgagacgaccagtcctccttgcagcaataagaccaaccttttttcct 693

                                                                       
Query: 313 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 372
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 692 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 633

                                                                       
Query: 373 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 432
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 632 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 573

                                        
Query: 433 acacggtacttgtggtaggcgttaccagc 461
           ||||||||||||||||| |||||||||||
Sbjct: 572 acacggtacttgtggtatgcgttaccagc 544



to top

>gb|AY105581.1| Zea mays PCO150618 mRNA sequence
          Length = 1102

 Score =  224 bits (113), Expect = 2e-55
 Identities = 215/249 (86%)
 Strand = Plus / Minus

                                                                       
Query: 213 ataactctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacg 272
           ||||||||| ||||||||||| ||||| |  || | ||| ||||| || || || || | 
Sbjct: 863 ataactctaggtggccttgtcagccttggaggctgtggcagcagcttgacccctgagcct 804

                                                                       
Query: 273 accagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaac 332
            ||||||||||| || ||||||||||||||||||||||| || || || || ||||| ||
Sbjct: 803 tccagtcctcctagcggcaatgagaccaaccttctggccagggggagcgtctcggcggac 744

                                                                       
Query: 333 agtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggtt 392
           ||| || || ||||| || || ||||||||||||||||||||||||||||| ||||||||
Sbjct: 743 agtagaggcgtgaccgatgtgttggtggttacctcctccgtggggatgctccacagggtt 684

                                                                       
Query: 393 catggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||||||||||||||||||| ||||||  ||||||||||||||||||||||||||| ||
Sbjct: 683 catggccacaccacgcaccttgggccagctgttcctcttcacacggtacttgtggtacgc 624

                    
Query: 453 gttaccagc 461
           |||||||||
Sbjct: 623 gttaccagc 615



to top

>gb|AY109618.1| Zea mays CL8996_1 mRNA sequence
          Length = 1322

 Score =  212 bits (107), Expect = 8e-52
 Identities = 210/246 (85%)
 Strand = Plus / Minus

                                                                       
Query: 216 actctaagtggccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgacc 275
           |||||| ||||||||||| ||||| |  || | ||| |||||||||||||| || |  ||
Sbjct: 864 actctaggtggccttgtcagccttggaggctgtggcagcagcctggcctctgagccttcc 805

                                                                       
Query: 276 agtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagt 335
           ||||||||| || ||||| ||||| |||||||||||       ||||| ||||| |||||
Sbjct: 804 agtcctcctagccgcaataagaccgaccttctggccannnnnagcatcgcggcggacagt 745

                                                                       
Query: 336 ggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcat 395
            || |||||||| ||||||||||||||||||||||||||||||||||| || ||||||||
Sbjct: 744 agaggcatgaccgatatgctggtggttacctcctccgtggggatgctccacggggttcat 685

                                                                       
Query: 396 ggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           |||||||||||| ||||| ||||||  |||||||||||||||||||||| ||||||||||
Sbjct: 684 ggccacaccacggaccttgggccagctgttcctcttcacacggtacttggggtaggcgtt 625

                 
Query: 456 accagc 461
            |||||
Sbjct: 624 gccagc 619



to top

>emb|AJ404848.1|GMA404848 Glycine max mRNA for ribosomal protein L2 (rpL2 gene)
          Length = 1000

 Score =  206 bits (104), Expect = 5e-50
 Identities = 194/224 (86%)
 Strand = Plus / Minus

                                                                       
Query: 226 gccttgtcggccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctg 285
           ||||| || ||||| |||||||  || ||||| || ||||||||||||||||||||||| 
Sbjct: 823 gccttatcagccttggcagcagttgcagcagcttgtcctctaagacgaccagtcctccta 764

                                                                       
Query: 286 gcagcaatgagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatga 345
           ||||||||||||||||||||||| || || || ||||||||||  |||||    || |||
Sbjct: 763 gcagcaatgagaccaaccttctgtccaggaggagcatcacggctgacagtacttgcgtga 704

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           |||||||||||||| ||||||||||||||||||||||||||||||||||| || ||||||
Sbjct: 703 ccaatatgctggtgattacctcctccgtggggatgctcaacagggttcatagcaacacca 644

                                                       
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggta 449
           || ||||| |||||| | ||||||||||| | | ||||||||||
Sbjct: 643 cgaaccttgggccagcaattcctcttcactctgaacttgtggta 600



to top

>ref|NM_127358.3| Arabidopsis thaliana EMB2296; structural constituent of ribosome
           AT2G18020 (EMB2296) mRNA, complete cds
          Length = 968

 Score =  200 bits (101), Expect = 3e-48
 Identities = 191/221 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 817 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 758

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 757 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 698

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 697 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 638

                                                    
Query: 415 ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 637 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 597



to top

>gb|AY128314.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 944

 Score =  200 bits (101), Expect = 3e-48
 Identities = 191/221 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 817 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 758

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 757 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 698

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 697 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 638

                                                    
Query: 415 ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 637 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 597



to top

>gb|AC006201.4| Arabidopsis thaliana chromosome 2 clone T27K22 map c245, complete
             sequence
          Length = 88149

 Score =  200 bits (101), Expect = 3e-48
 Identities = 191/221 (86%)
 Strand = Plus / Plus

                                                                         
Query: 235   gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
             ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 37736 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 37795

                                                                         
Query: 295   agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
             |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 37796 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 37855

                                                                         
Query: 355   tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
             || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 37856 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 37915

                                                      
Query: 415   ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
             ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 37916 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 37956



to top

>emb|BX820589.1|CNS0A8QO Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH50ZB11 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 930

 Score =  200 bits (101), Expect = 3e-48
 Identities = 191/221 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 795 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 736

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 735 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 676

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 675 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 616

                                                    
Query: 415 ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 615 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 575



to top

>emb|BX820233.1|CNS0A8O8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH10ZE05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 881

 Score =  200 bits (101), Expect = 3e-48
 Identities = 191/221 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 781 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 722

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 721 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 662

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 661 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 602

                                                    
Query: 415 ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 601 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 561



to top

>emb|BX820387.1|CNS0A8NL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH28ZH04 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 946

 Score =  200 bits (101), Expect = 3e-48
 Identities = 191/221 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 795 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 736

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 735 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 676

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 675 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 616

                                                    
Query: 415 ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 615 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 575



to top

>gb|BT001177.1| Arabidopsis thaliana 60S ribosomal protein L2 (At2g18020) mRNA,
           complete cds
          Length = 858

 Score =  200 bits (101), Expect = 3e-48
 Identities = 191/221 (86%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 770 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 711

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 710 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 651

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 650 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 591

                                                    
Query: 415 ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 590 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 550



to top

>emb|BX827983.1|CNS0A32V Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH41ZD03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 965

 Score =  198 bits (100), Expect = 1e-47
 Identities = 184/211 (87%), Gaps = 2/211 (0%)
 Strand = Plus / Minus

                                                                       
Query: 253 gcagcctggcctctaagacgaccagtcctcctggcagcaatgagaccaaccttctggccg 312
           ||||| || ||||| ||||||||||||||||| ||||| || ||||||||||| |  || 
Sbjct: 787 gcagcttgacctctgagacgaccagtcctccttgcagcgataagaccaaccttttttcct 728

                                                                       
Query: 313 ggtggtgcatcacggcgaacagtggaagcatgaccaatatgctggtggttacctcctccg 372
           |||||||||||||| ||||||||   ||| ||||||||||| || |||||||||||||||
Sbjct: 727 ggtggtgcatcacgacgaacagtactagcgtgaccaatatgttgatggttacctcctccg 668

                                                                       
Query: 373 tggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctcttc 432
           || ||||||||||| || ||||| ||||||||||| |||||||||||| |||| ||||||
Sbjct: 667 tgaggatgctcaactggattcatagccacaccacgaaccttaggccagcagtttctcttc 608

                                          
Query: 433 acac--ggtacttgtggtaggcgttaccagc 461
           ||||  ||||||||||||| |||||||||||
Sbjct: 607 acaccgggtacttgtggtatgcgttaccagc 577



to top

>emb|X86765.1|ATC24RPL2 A.thaliana mRNA for ribosomal protein L2
          Length = 1002

 Score =  192 bits (97), Expect = 7e-46
 Identities = 190/221 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 834 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 775

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    |  |||||||| |||
Sbjct: 774 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggagtgaccaatgtgc 715

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 714 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 655

                                                    
Query: 415 ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 654 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 614



to top

>emb|BX820018.1|CNS0A8IW Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS61ZG10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score =  186 bits (94), Expect = 4e-44
 Identities = 191/222 (86%), Gaps = 1/222 (0%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 788 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 729

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 728 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 669

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 668 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 609

                                                     
Query: 415 ggccaggagttcctcttcacacgg-tacttgtggtaggcgtt 455
           ||||| |||||||||||||||||| ||||||||||| |||||
Sbjct: 608 ggccatgagttcctcttcacacggatacttgtggtacgcgtt 567



to top

>emb|BX820320.1|CNS0A7WS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH22ZA07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 901

 Score =  184 bits (93), Expect = 2e-43
 Identities = 189/221 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 766 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 707

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || | |||||| | |
Sbjct: 706 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgttaccaatgttc 647

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctta 414
           || |||||||||||||| || |||||||| || || ||||| ||||||||||| ||||||
Sbjct: 646 tgatggttacctcctccatgaggatgctccactggattcatagccacaccacgaacctta 587

                                                    
Query: 415 ggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           ||||| ||||||||||||||||||||||||||||| |||||
Sbjct: 586 ggccatgagttcctcttcacacggtacttgtggtacgcgtt 546



to top

>gb|AF156372.1| Nicotiana tabacum clone PR60 60S ribosomal protein L2 mRNA, partial
           cds
          Length = 644

 Score =  182 bits (92), Expect = 7e-43
 Identities = 167/192 (86%)
 Strand = Plus / Minus

                                                                       
Query: 267 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 326
           |||||||||||||||||| |||||||| ||||| ||||| || || ||||||||||||||
Sbjct: 480 aagacgaccagtcctccttgcagcaataagaccgaccttttgaccaggtggtgcatcacg 421

                                                                       
Query: 327 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 386
            || |||||   ||||||||||||||| || |||||||| || || || |||||||| ||
Sbjct: 420 acggacagtactagcatgaccaatatgttgatggttaccaccaccatgaggatgctccac 361

                                                                       
Query: 387 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 446
           |||||||||||| |||||||| ||||| |||||| |||||||||| || |||||||||||
Sbjct: 360 agggttcatggcaacaccacgaaccttgggccagcagttcctctttacccggtacttgtg 301

                       
Query: 447 gtaggcgttacc 458
           ||| ||||||||
Sbjct: 300 gtatgcgttacc 289



to top

>gb|AC135311.13| Medicago truncatula clone mth2-27l9, complete sequence
          Length = 112635

 Score =  178 bits (90), Expect = 1e-41
 Identities = 168/194 (86%)
 Strand = Plus / Plus

                                                                          
Query: 268    agacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacgg 327
              ||||||||||||||| ||||||||||||||||||||||||| || || || |||||||| 
Sbjct: 107018 agacgaccagtcctcttggcagcaatgagaccaaccttctgtccaggaggagcatcacgt 107077

                                                                          
Query: 328    cgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaaca 387
              |  |||||    |||||||||||||| ||||| |||||||||||||||||||||||||| 
Sbjct: 107078 ctgacagtactcgcatgaccaatatgttggtgattacctcctccgtggggatgctcaact 107137

                                                                          
Query: 388    gggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtgg 447
              || ||||| || |||||||| |||||||||||| |||| |||||||| | | ||||||||
Sbjct: 107138 ggattcatagcaacaccacgaaccttaggccagcagtttctcttcactctgaacttgtgg 107197

                            
Query: 448    taggcgttaccagc 461
              || || ||||||||
Sbjct: 107198 taagcattaccagc 107211



to top

>emb|BX820333.1|CNS0A8NS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH23ZG05 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 916

 Score =  172 bits (87), Expect = 6e-40
 Identities = 191/223 (85%), Gaps = 2/223 (0%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaatg 294
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| |||||||| 
Sbjct: 801 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaata 742

                                                                       
Query: 295 agaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatgc 354
           |||||||||||||| || || ||||||||||| | ||||||    || |||||||| |||
Sbjct: 741 agaccaaccttctgtccaggaggtgcatcacgcctaacagtactggcgtgaccaatgtgc 682

                                                                       
Query: 355 tggtggttacctcctccgtggggatgctc-aacagggttcatggccacaccacgcacctt 413
           || |||||||||||||| || ||||||||  || || ||||| ||||||||||| |||||
Sbjct: 681 tgatggttacctcctccatgaggatgctcgcactggattcatagccacaccacgaacctt 622

                                                      
Query: 414 aggccaggagttcctcttcacac-ggtacttgtggtaggcgtt 455
           |||||| |||||||||||||||| ||||||||||||| |||||
Sbjct: 621 aggccatgagttcctcttcacacgggtacttgtggtacgcgtt 579



to top

>gb|BT013866.1| Lycopersicon esculentum clone 132846R, mRNA sequence
          Length = 983

 Score =  157 bits (79), Expect = 4e-35
 Identities = 166/195 (85%)
 Strand = Plus / Minus

                                                                       
Query: 267 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 326
           |||||||||||||||||| || ||||| ||||||||| | || || ||||||||||||||
Sbjct: 756 aagacgaccagtcctccttgctgcaataagaccaaccctttgcccaggtggtgcatcacg 697

                                                                       
Query: 327 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 386
            || |||||    |||||||||||||| || |||||||| || || || |||||||| ||
Sbjct: 696 acgcacagtactggcatgaccaatatgttgatggttaccaccaccatgaggatgctccac 637

                                                                       
Query: 387 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 446
           ||| ||||| || |||||||| |||||||||||| |||||||||| || ||||| |||||
Sbjct: 636 aggattcatagcaacaccacgaaccttaggccagcagttcctcttaacgcggtatttgtg 577

                          
Query: 447 gtaggcgttaccagc 461
           ||| |||||||||||
Sbjct: 576 gtatgcgttaccagc 562



to top

>emb|X64562.1|LERPL2MR L.esculentum mRNA for ribosomal protein L2
          Length = 816

 Score =  157 bits (79), Expect = 4e-35
 Identities = 166/195 (85%)
 Strand = Plus / Minus

                                                                       
Query: 267 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 326
           |||||||||||||||||| |||||||| ||||||||||| || || || |||||||||||
Sbjct: 743 aagacgaccagtcctccttgcagcaataagaccaaccttttgtccaggaggtgcatcacg 684

                                                                       
Query: 327 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 386
            || || ||    ||||||||||| || || |||||||| || || ||||||||||| ||
Sbjct: 683 acggactgtactggcatgaccaatgtgttgatggttaccaccaccatggggatgctccac 624

                                                                       
Query: 387 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 446
            || ||||| || |||||||| |||||||||||| |||||||||||||||||||||| ||
Sbjct: 623 tggattcatagcaacaccacgaaccttaggccagcagttcctcttcacacggtacttatg 564

                          
Query: 447 gtaggcgttaccagc 461
           ||| || ||||||||
Sbjct: 563 gtaagcattaccagc 549



to top

>gb|DQ252497.1| Solanum tuberosum clone 068C11 ribosomal protein L2-like mRNA,
           complete cds
          Length = 899

 Score =  157 bits (79), Expect = 4e-35
 Identities = 166/195 (85%)
 Strand = Plus / Minus

                                                                       
Query: 267 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 326
           |||||||||||||||||| |||||||| ||||||||||| || || || |||||||||||
Sbjct: 789 aagacgaccagtcctccttgcagcaataagaccaaccttttgtccaggaggtgcatcacg 730

                                                                       
Query: 327 gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaac 386
            || || ||    ||||||||||| || || |||||||| || || ||||||||||| ||
Sbjct: 729 acggactgtactggcatgaccaatgtgttgatggttaccaccaccatggggatgctccac 670

                                                                       
Query: 387 agggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtg 446
            || ||||| || |||||||| |||||||||||| |||||||||||||||||||||| ||
Sbjct: 669 gggattcatagcaacaccacgaaccttaggccagcagttcctcttcacacggtacttatg 610

                          
Query: 447 gtaggcgttaccagc 461
           ||| || ||||||||
Sbjct: 609 gtaagcattaccagc 595



to top

>emb|BX818795.1|CNS0A8ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZH09 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 878

 Score =  147 bits (74), Expect = 4e-32
 Identities = 186/222 (83%), Gaps = 1/222 (0%)
 Strand = Plus / Minus

                                                                       
Query: 235 gccttcgcagcagaggcggcagcctggcctctaagacgaccagtcctcctggcagcaa-t 293
           ||||| ||||| || || ||||| || ||||| ||||||||||||||||| ||||||| |
Sbjct: 789 gccttggcagctgaagcagcagcttgacctctgagacgaccagtcctccttgcagcaaat 730

                                                                       
Query: 294 gagaccaaccttctggccgggtggtgcatcacggcgaacagtggaagcatgaccaatatg 353
            |||||||||||||| || || ||||||| ||| | || |||    || |||||||| | 
Sbjct: 729 aagaccaaccttctgtccaggaggtgcatgacgcctaagagtactggcgtgaccaatgta 670

                                                                       
Query: 354 ctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacctt 413
           ||| |||||||||||||| || |||||||| || || ||||| |||||| |||| |||||
Sbjct: 669 ctgatggttacctcctccatgaggatgctccactggattcatagccacaacacgaacctt 610

                                                     
Query: 414 aggccaggagttcctcttcacacggtacttgtggtaggcgtt 455
           |||||| |||| |||||||||||||||||||||||| |||||
Sbjct: 609 aggccatgagtgcctcttcacacggtacttgtggtacgcgtt 568



to top

>emb|X62500.1|NTRL2RNA N.tabacum RL2 mRNA for 60S ribosomal protein L2
          Length = 917

 Score =  145 bits (73), Expect = 1e-31
 Identities = 165/193 (85%), Gaps = 2/193 (1%)
 Strand = Plus / Minus

                                                                       
Query: 267 aagacgaccagtcctcctggcagcaatgagaccaaccttctggccgggtggtgcatcacg 326
           ||||||||||||||||||  | ||||| ||||| ||||| || || ||||||||||| ||
Sbjct: 745 aagacgaccagtcctccttcctgcaataagaccgaccttttgaccaggtggtgcatcgcg 686

                                                                       
Query: 327 -gcgaacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaa 385
            |||| ||||   ||||||||||||||| || |||||||| || || || |||||||| |
Sbjct: 685 agcga-cagtactagcatgaccaatatgttgatggttaccaccaccatgaggatgctcca 627

                                                                       
Query: 386 cagggttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgt 445
           ||||||||||||| |||||||| ||||| |||||| |||||||||| || ||||||||||
Sbjct: 626 cagggttcatggcaacaccacgaaccttgggccagcagttcctctttacccggtacttgt 567

                        
Query: 446 ggtaggcgttacc 458
           |||| ||||||||
Sbjct: 566 ggtatgcgttacc 554



to top

>gb|DQ316258.1| Litopenaeus vannamei ribosomal protein L8 mRNA, complete cds
          Length = 871

 Score =  131 bits (66), Expect = 2e-27
 Identities = 108/122 (88%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||||||||| | ||||||||| || |||||||| || || || |||||||| ||||||
Sbjct: 715 acagtggaagccttaccaatatgttgatggttaccaccaccatgaggatgctctacaggg 656

                                                                       
Query: 391 ttcatggccacaccacgcaccttaggccaggagttcctcttcacacggtacttgtggtag 450
           |||||||||||||||||||||||||||||| ||||||||||||| |  ||||| ||||||
Sbjct: 655 ttcatggccacaccacgcaccttaggccagcagttcctcttcaccctatacttatggtag 596

             
Query: 451 gc 452
           ||
Sbjct: 595 gc 594



to top

>emb|CT033188.1| Platynereis dumerilii EST IB0AAA25AH04EM1
          Length = 878

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 705 accaatatgctgatggttaccacctccgtggggatgctcaacggggttcatagccacacc 646

                                
Query: 405 acgcaccttaggccaggagtt 425
           ||||||||| |||||| ||||
Sbjct: 645 acgcaccttgggccagcagtt 625



to top

>emb|CT033187.1| Platynereis dumerilii EST IB0AAA25AH04FM1
          Length = 823

 Score =  113 bits (57), Expect = 5e-22
 Identities = 75/81 (92%)
 Strand = Plus / Plus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtggggatgctcaacggggttcatagccacacc 233

                                
Query: 405 acgcaccttaggccaggagtt 425
           ||||||||| |||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254



to top

>gb|AF098520.1|AF098520 Drosophila melanogaster ribosomal protein L8 (rpL8) gene, complete
            cds
          Length = 1718

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Minus

                                                                        
Query: 345  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
            |||||| ||||| |||||||| || |||||||||||||| || |||||||||||||||||
Sbjct: 1438 accaatgtgctgatggttaccaccaccgtggggatgctccacggggttcatggccacacc 1379

                                                            
Query: 405  acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
            ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 1378 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 1331



to top

>emb|CT033650.1| Platynereis dumerilii EST IB0AAA16CH07EM1
          Length = 867

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 694 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 635

                                
Query: 405 acgcaccttaggccaggagtt 425
           ||||||||| |||||| ||||
Sbjct: 634 acgcaccttgggccagcagtt 614



to top

>emb|CT033649.1| Platynereis dumerilii EST IB0AAA16CH07FM1
          Length = 744

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 233

                                
Query: 405 acgcaccttaggccaggagtt 425
           ||||||||| |||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254



to top

>emb|CT033017.1| Platynereis dumerilii EST IB0AAA27DH06EM1
          Length = 868

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 696 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 637

                                
Query: 405 acgcaccttaggccaggagtt 425
           ||||||||| |||||| ||||
Sbjct: 636 acgcaccttgggccagcagtt 616



to top

>emb|CT033016.1| Platynereis dumerilii EST IB0AAA27DH06FM1
          Length = 826

 Score =  105 bits (53), Expect = 1e-19
 Identities = 74/81 (91%)
 Strand = Plus / Plus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||||||||| |||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 174 accaatatgctgatggttaccacctccgtgaggatgctcaacggggttcatagccacacc 233

                                
Query: 405 acgcaccttaggccaggagtt 425
           ||||||||| |||||| ||||
Sbjct: 234 acgcaccttgggccagcagtt 254



to top

>gb|BT014913.1| Drosophila melanogaster RH21963 full insert cDNA
          Length = 2439

 Score =  103 bits (52), Expect = 5e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                        
Query: 345  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
            |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 2151 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 2092

                                                            
Query: 405  acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
            ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 2091 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 2044



to top

>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 192681

 Score =  103 bits (52), Expect = 5e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                          
Query: 345    accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
              |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 127344 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 127285

                                                              
Query: 405    acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
              ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 127284 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 127237



to top

>ref|NM_167955.1| Drosophila melanogaster Ribosomal protein L8 CG1263-RB, transcript
           variant B (RpL8), mRNA
          Length = 1264

 Score =  103 bits (52), Expect = 5e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 872 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 813

                                                           
Query: 405 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 812 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 765



to top

>ref|NM_079987.2| Drosophila melanogaster Ribosomal protein L8 CG1263-RA, transcript
           variant A (RpL8), mRNA
          Length = 1118

 Score =  103 bits (52), Expect = 5e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 726 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 667

                                                           
Query: 405 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 666 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 619



to top

>gb|AY071342.1| Drosophila melanogaster RE37829 full length cDNA
          Length = 1019

 Score =  103 bits (52), Expect = 5e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 724 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 665

                                                           
Query: 405 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 664 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 617



to top

>gb|BT022891.1| Drosophila melanogaster IP12501 full insert cDNA
          Length = 1776

 Score =  103 bits (52), Expect = 5e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 527 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 468

                                                           
Query: 405 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 467 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 420



to top

>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete
              sequence
          Length = 301691

 Score =  103 bits (52), Expect = 5e-19
 Identities = 94/108 (87%)
 Strand = Plus / Minus

                                                                          
Query: 345    accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
              |||||| ||||| |||||||| || ||||| |||||||| || |||||||||||||||||
Sbjct: 123716 accaatgtgctgatggttaccaccaccgtgaggatgctccacggggttcatggccacacc 123657

                                                              
Query: 405    acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
              ||||||||||||||||  ||| | ||||||   |||||||||||||||
Sbjct: 123656 acgcaccttaggccagctgttgcgcttcaccttgtacttgtggtaggc 123609



to top

>emb|CT033621.1| Platynereis dumerilii EST IB0AAA17BB03EM1
          Length = 884

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 710 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 651

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 650 ttcatagccacaccacgcaccttgggccagcagtt 616



to top

>emb|CT033394.1| Platynereis dumerilii EST IB0AAA21BA08EM1
          Length = 883

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 724 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 665

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 664 ttcatagccacaccacgcaccttgggccagcagtt 630



to top

>emb|CT033393.1| Platynereis dumerilii EST IB0AAA21BA08FM1
          Length = 814

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255



to top

>emb|CT032883.1| Platynereis dumerilii EST IB0AAA30AD02EM1
          Length = 834

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 706 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 647

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 646 ttcatagccacaccacgcaccttgggccagcagtt 612



to top

>emb|CT032882.1| Platynereis dumerilii EST IB0AAA30AD02FM1
          Length = 838

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255



to top

>emb|CT032622.1| Platynereis dumerilii EST IB0AAA35AA08FM1
          Length = 834

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 174 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 233

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 234 ttcatagccacaccacgcaccttgggccagcagtt 268



to top

>emb|CT032614.1| Platynereis dumerilii EST IB0AAA35BC06EM1
          Length = 854

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 710 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 651

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 650 ttcatagccacaccacgcaccttgggccagcagtt 616



to top

>emb|CT032322.1| Platynereis dumerilii EST IB0AAA40CH03EM1
          Length = 759

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | ||||||||| || |||||||||||||| || ||||||||||| |||
Sbjct: 707 acagttgaagctttaccaatatgatgatggttacctcctccatgaggatgctcaacgggg 648

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 647 ttcatagccacaccacgcaccttgggccagcagtt 613



to top

>emb|CT032321.1| Platynereis dumerilii EST IB0AAA40CH03FM1
          Length = 475

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||| ||||||||||||| |||||||||||
Sbjct: 221 ttcatagcctcaccacgcaccttgggccaggagtt 255



to top

>emb|CT032290.1| Platynereis dumerilii EST IB0AAA41CE04EM1
          Length = 869

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 708 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 649

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 648 ttcatagccacaccacgcaccttgggccagcagtt 614



to top

>emb|CT032289.1| Platynereis dumerilii EST IB0AAA41CE04FM1
          Length = 844

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255



to top

>emb|CT032278.1| Platynereis dumerilii EST IB0AAA41DB03EM1
          Length = 868

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 708 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 649

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 648 ttcatagccacaccacgcaccttgggccagcagtt 614



to top

>emb|CT032277.1| Platynereis dumerilii EST IB0AAA41DB03FM1
          Length = 822

 Score =  101 bits (51), Expect = 2e-18
 Identities = 84/95 (88%)
 Strand = Plus / Plus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 161 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 220

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           ||||| ||||||||||||||||| |||||| ||||
Sbjct: 221 ttcatagccacaccacgcaccttgggccagcagtt 255



to top

>gb|AY432072.1| Aedes aegypti ASAP ID: 34485 cytosolic large ribosomal subunit L8
           mRNA sequence
          Length = 1079

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 748 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 689

                                                       
Query: 409 accttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||| |||||| |||| | ||||||   |||||||||||||||
Sbjct: 688 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 645



to top

>gb|DQ440262.1| Aedes aegypti clone AET-322 60S ribosomal protein L2/L8 mRNA,
           complete cds
          Length = 786

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 656 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 597

                                                       
Query: 409 accttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||| |||||| |||| | ||||||   |||||||||||||||
Sbjct: 596 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 553



to top

>gb|AY485337.1| Mamestra brassicae ribosomal protein L8 (rpl8) mRNA, complete cds
          Length = 877

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 72/80 (90%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||||||||| | ||||||||| || |||||||| || || || |||||||||||||||
Sbjct: 715 acagtggaagccttaccaatatgttgatggttaccaccaccatgaggatgctcaacaggg 656

                               
Query: 391 ttcatggccacaccacgcac 410
           ||||||||||||||||||||
Sbjct: 655 ttcatggccacaccacgcac 636



to top

>emb|AM049012.1| Timarcha balearica partial mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 755

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 84/96 (87%)
 Strand = Plus / Minus

                                                                       
Query: 330 aacagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacagg 389
           |||||| ||||| | ||| ||||| || |||||||| |||||||| |||||||| |||||
Sbjct: 675 aacagtagaagctttaccgatatgttgatggttaccacctccgtgaggatgctctacagg 616

                                               
Query: 390 gttcatggccacaccacgcaccttaggccaggagtt 425
           ||||||||| |||||||| |||||||||||| ||||
Sbjct: 615 gttcatggcaacaccacgtaccttaggccagcagtt 580



to top

>gb|AY128671.1| Drosophila virilis daughter of sevenless (dos) gene, complete cds
          Length = 8311

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 69/76 (90%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || |||||||| || |||||||||||||| |||||||||||||| |||||
Sbjct: 298 accaatatgttgatggttaccaccaccgtggggatgctccacagggttcatggcaacacc 239

                           
Query: 405 acgcaccttaggccag 420
           ||||||||| ||||||
Sbjct: 238 acgcaccttgggccag 223



to top

>emb|CR938630.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 3-prime end of clone
           KW0AAA1YD12BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 701

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 320 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 379

                                                       
Query: 409 accttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||| |||||| |||| | ||||||   |||||||||||||||
Sbjct: 380 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 423



to top

>emb|CR938124.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YJ17AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 817

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 737 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 678

                                                       
Query: 409 accttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||| |||||| |||| | ||||||   |||||||||||||||
Sbjct: 677 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 634



to top

>emb|CR937651.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 5-prime end of clone
           KW0AAB1YJ18AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 765

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Minus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 739 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 680

                                                       
Query: 409 accttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||| |||||| |||| | ||||||   |||||||||||||||
Sbjct: 679 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 636



to top

>emb|CR937650.1| Single read from an extremity of a cDNA clone made from Aedes
           aegypti total adult females. 3-prime end of clone
           KW0AAB1YJ18BBM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 616

 Score = 95.6 bits (48), Expect = 1e-16
 Identities = 90/104 (86%)
 Strand = Plus / Plus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           |||||||| |||||||| || ||||||||||||||||| |||||||| || |||||||| 
Sbjct: 319 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgt 378

                                                       
Query: 409 accttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||| |||||| |||| | ||||||   |||||||||||||||
Sbjct: 379 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 422



to top

>emb|CT032253.1| Platynereis dumerilii EST IB0AAA42BC10FM1
          Length = 778

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 83/95 (87%)
 Strand = Plus / Plus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||| ||||| | |||||||||||| |||||||| ||||| || ||||||||||| |||
Sbjct: 173 acagttgaagctttaccaatatgctgatggttaccacctccatgaggatgctcaacgggg 232

                                              
Query: 391 ttcatggccacaccacgcaccttaggccaggagtt 425
           |||||  |||||||||||||||| |||||| ||||
Sbjct: 233 ttcataaccacaccacgcaccttgggccagcagtt 267



to top

>dbj|AU066544.1| Chlamydomonas sp. HS-5 mRNA for 60S ribosomal protein L2,
           NaCl+paraquat inducible, complete cds, clone:M30
          Length = 987

 Score = 93.7 bits (47), Expect = 5e-16
 Identities = 68/75 (90%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| || |||||||| ||||| || ||||||||||||||||||
Sbjct: 672 ccaatgtgctggtggttaccaccaccgtgggggtgctccacggggttcatggccacacca 613

                          
Query: 406 cgcaccttaggccag 420
           |||||||| ||||||
Sbjct: 612 cgcaccttcggccag 598



to top

>ref|XM_962890.1| PREDICTED: Tribolium castaneum similar to CG1263-PA, isoform A
           (LOC656352), mRNA
          Length = 886

 Score = 89.7 bits (45), Expect = 7e-15
 Identities = 72/81 (88%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| |||||||| ||||| || ||||||||||||||||| ||||||||||| |||||
Sbjct: 685 accaatgtgctggtgattaccaccaccgtggggatgctcaactgggttcatggcaacacc 626

                                
Query: 405 acgcaccttaggccaggagtt 425
           ||| || ||||||||| ||||
Sbjct: 625 acgtactttaggccagcagtt 605



to top

>emb|CR937938.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA2YP16AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 816

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 89/104 (85%)
 Strand = Plus / Minus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           |||||||| |||||||| || ||||||||||||||||| |||||||| || || ||||| 
Sbjct: 740 atatgctgatggttaccaccaccgtggggatgctcaacggggttcatagcaacgccacgt 681

                                                       
Query: 409 accttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||||| |||||| |||| | ||||||   |||||||||||||||
Sbjct: 680 acctttggccagcagttacgcttcaccttgtacttgtggtaggc 637



to top

>gb|AF429973.1| Spodoptera frugiperda ribosomal protein L8 mRNA, complete cds
          Length = 915

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 92/108 (85%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| ||||||||||| |||||||| ||||||||||| |||||||| ||||||||
Sbjct: 702 accaatatgttggtggttaccacctccgtgaggatgctcaacggggttcatagccacacc 643

                                                           
Query: 405 acgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           ||| || |  |||||| |||| | ||| ||   |||||||||||||||
Sbjct: 642 acgaacgtatggccagcagttacgcttaaccttgtacttgtggtaggc 595



to top

>dbj|AK060350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-008-F06, full
           insert sequence
          Length = 864

 Score = 87.7 bits (44), Expect = 3e-14
 Identities = 62/68 (91%)
 Strand = Plus / Minus

                                                                       
Query: 343 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 402
           |||||||| |||||||||||||| || |||||||| ||||| || |||||||||||||||
Sbjct: 682 tgaccaatgtgctggtggttaccaccaccgtgggggtgctccacggggttcatggccaca 623

                   
Query: 403 ccacgcac 410
           ||||||||
Sbjct: 622 ccacgcac 615



to top

>gb|AF526214.1| Argopecten irradians isolate iolsaicl63ct83cn90 ribosomal protein L
           mRNA, complete cds
          Length = 866

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 76/87 (87%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||||||||| |||||||| || || || ||||| ||||| |||||||| ||||||||
Sbjct: 694 accaatatgctgatggttaccaccaccatgaggatgttcaactgggttcatagccacacc 635

                                      
Query: 405 acgcaccttaggccaggagttcctctt 431
           ||| || ||||||||| ||||||||||
Sbjct: 634 acgaactttaggccagcagttcctctt 608



to top

>gb|AY957563.1| Oncorhynchus mykiss ribosomal protein L8 mRNA, partial cds
          Length = 672

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 91/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           |||||||||||||||||||| || |||  ||||||||||||||||| |||||||||||||
Sbjct: 625 ccaatatgctggtggttaccaccaccgaagggatgctcaacagggtccatggccacacca 566

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           || ||    ||||| |||||||||||  |   |||||||||||||||
Sbjct: 565 cggacacgtggccatgagttcctcttggccttgtacttgtggtaggc 519



to top

>gb|AY919670.1| Pimephales promelas 60S ribosomal protein L8 mRNA, partial cds
          Length = 709

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||||||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 621 ccaatatgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 562

                                     
Query: 406 cgcaccttaggccaggagttcctctt 431
           || ||   ||||||| ||||||||||
Sbjct: 561 cggacacgaggccagcagttcctctt 536



to top

>gb|AF164152.1|AF164152 Anopheles gambiae strain M2 ribosomal protein L8 (rpL8) mRNA,
           complete cds
          Length = 937

 Score = 83.8 bits (42), Expect = 5e-13
 Identities = 84/98 (85%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||||||||||
Sbjct: 712 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccacgcacc 653

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 652 ttcggccagcagttacgcttcaccttgtacttgtggta 615



to top

>gb|DQ213524.1| Taeniopygia guttata clone 0058P0020H02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 903

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||||||||| |||||||||  ||||||||| ||||||||||||||||||||||| || 
Sbjct: 725 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 666

                                                    
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggtaggc 452
              |||||| ||||||||||  |   |||||||||||||||
Sbjct: 665 cgtggccagcagttcctcttggccttgtacttgtggtaggc 625



to top

>gb|DQ213521.1| Taeniopygia guttata clone 0058P0051G10 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 854

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||||||||| |||||||||  ||||||||| ||||||||||||||||||||||| || 
Sbjct: 677 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 618

                                                    
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggtaggc 452
              |||||| ||||||||||  |   |||||||||||||||
Sbjct: 617 cgtggccagcagttcctcttggccttgtacttgtggtaggc 577



to top

>emb|AM049010.1| Meladema coriacea partial mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 711

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 68/77 (88%)
 Strand = Plus / Minus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           ||||| || |||||||| || ||||||||||||||||| |||||||| |||||||| |||
Sbjct: 656 atatgttgatggttaccaccaccgtggggatgctcaacggggttcatagccacaccgcgc 597

                            
Query: 409 accttaggccaggagtt 425
           ||||| |||||| ||||
Sbjct: 596 acctttggccagcagtt 580



to top

>emb|CR938631.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YD12AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 724

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 80/93 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 gttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggcca 419
           |||||| || ||||||||||||||||| |||||||| || |||||||| ||||| |||||
Sbjct: 724 gttaccaccaccgtggggatgctcaacggggttcatagcaacaccacgtacctttggcca 665

                                            
Query: 420 ggagttcctcttcacacggtacttgtggtaggc 452
           | |||| | ||||||   |||||||||||||||
Sbjct: 664 gcagttacgcttcaccttgtacttgtggtaggc 632



to top

>gb|AY943311.1| Wyeomyia smithii ribosomal protein L8 mRNA, partial cds
          Length = 331

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                       
Query: 349 atatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgc 408
           ||||||||||| ||||| || || |||||||||||||| |||||||| || |||||||||
Sbjct: 168 atatgctggtgattaccaccaccatggggatgctcaacggggttcatagcaacaccacgc 109

                                                    
Query: 409 accttaggccaggagttcctcttcacacggtacttgtggta 449
           || || |||||| |||| | ||||||   ||||||||||||
Sbjct: 108 actttcggccagcagttacgcttcaccttgtacttgtggta 68



to top

>gb|M99055.1|MQSRPL8X Mosquito ribosomal protein L8 (rpL8) gene exons 1-3, complete cds
          Length = 2231

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 86/101 (85%)
 Strand = Plus / Minus

                                                                        
Query: 352  tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
            ||||| |||||||| || || |||||||||||||| |||||||| ||||||||||| |||
Sbjct: 1937 tgctgatggttaccaccaccatggggatgctcaacggggttcatagccacaccacgtacc 1878

                                                     
Query: 412  ttaggccaggagttcctcttcacacggtacttgtggtaggc 452
            || |||||| |||| | ||||||   ||||||| |||||||
Sbjct: 1877 tttggccagcagttacgcttcaccttgtacttgcggtaggc 1837



to top

>ref|XM_582676.2| PREDICTED: Bos taurus similar to 60S ribosomal protein L8
           (LOC506251), mRNA
          Length = 833

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 682 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 623

                               
Query: 412 ttaggccaggagttcctctt 431
              |||||| ||||||||||
Sbjct: 622 agtggccagcagttcctctt 603



to top

>emb|AM049009.1| Georissus sp. APV-2005 mRNA for ribosomal protein L8e (rpL8e gene)
          Length = 774

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 65/74 (87%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           |||||||| ||||| || ||||| ||||| || || ||||||||||| ||||||||||||
Sbjct: 653 tgctggtgattaccaccaccgtgaggatgytcsactgggttcatggcgacaccacgcacc 594

                         
Query: 412 ttaggccaggagtt 425
           ||||||||| ||||
Sbjct: 593 ttaggccagcagtt 580



to top

>gb|BC102277.1| Bos taurus similar to 60S ribosomal protein L8, mRNA (cDNA clone
           MGC:127227 IMAGE:7945641), complete cds
          Length = 932

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 688 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 629

                               
Query: 412 ttaggccaggagttcctctt 431
              |||||| ||||||||||
Sbjct: 628 cgtggccagcagttcctctt 609



to top

>ref|NM_001034625.1| Bos taurus similar to 60S ribosomal protein L8 (MGC127227), mRNA
          Length = 932

 Score = 79.8 bits (40), Expect = 7e-12
 Identities = 70/80 (87%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||||||||| || ||||||  ||||||||| |||||||||||||||||||| ||||||
Sbjct: 688 tgctggtggttgccacctccgaagggatgctcgacagggttcatggccacaccccgcacc 629

                               
Query: 412 ttaggccaggagttcctctt 431
              |||||| ||||||||||
Sbjct: 628 cgtggccagcagttcctctt 609



to top

>ref|NM_114978.1| Arabidopsis thaliana structural constituent of ribosome AT3G51190
           mRNA, complete cds
          Length = 783

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 402
           |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 665 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 606

                                                          
Query: 403 ccacgcaccttaggccaggagttcctcttcacacggtacttgtggta 449
           ||||| ||   ||||||  ||||||||||| |   ||||||||||||
Sbjct: 605 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggta 559



to top

>gb|DQ213522.1| Taeniopygia guttata clone 0061P0021C08 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 878

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 51/55 (92%)
 Strand = Plus / Minus

                                                                  
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccac 406
           ||||||||||| |||||||||  ||||||||| ||||||||||||||||||||||
Sbjct: 702 tgctggtggttgcctcctccgaagggatgctccacagggttcatggccacaccac 648



to top

>gb|AY190734.1| Pagrus major ribosomal protein L8 mRNA, partial cds
          Length = 688

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||||||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 686 ccaatatgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 627

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           || ||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 626 cggacacgtggccagcagttcctcttggccttgtacttgtggtaggc 580



to top

>emb|AM049011.1| Mycetophagus quadripustulatus mRNA for ribosomal protein L8e (rpL8e
           gene)
          Length = 774

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 60/67 (89%)
 Strand = Plus / Minus

                                                                       
Query: 359 ggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggcc 418
           ||||||| || ||||| ||||||||||| ||||||||||| |||||||||||||| ||||
Sbjct: 646 ggttaccaccaccgtgaggatgctcaacggggttcatggcaacaccacgcacctttggcc 587

                  
Query: 419 aggagtt 425
           || ||||
Sbjct: 586 agcagtt 580



to top

>emb|AL132980.3|ATF24M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F24M12
          Length = 129516

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Plus

                                                                         
Query: 343   tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 402
             |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 76049 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 76108

                                                            
Query: 403   ccacgcaccttaggccaggagttcctcttcacacggtacttgtggta 449
             ||||| ||   ||||||  ||||||||||| |   ||||||||||||
Sbjct: 76109 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggta 76155



to top

>emb|CR938453.1| Single read from an extremity of a full-length cDNA clone made from
           Aedes aegypti total adult females. 5-prime end of clone
           KW0AAA1YN07AAM1 from strain Liverpool of Aedes aegypti
           (yellow fever mosquito)
          Length = 735

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 370 ccgtggggatgctcaacagggttcatggccacaccacgcaccttaggccaggagttcctc 429
           ||||||||||||||||| |||||||| || |||||||| ||||| |||||| |||| | |
Sbjct: 728 ccgtggggatgctcaacggggttcatagcaacaccacgtacctttggccagcagttacgc 669

                                  
Query: 430 ttcacacggtacttgtggtaggc 452
           |||||   |||||||||||||||
Sbjct: 668 ttcaccttgtacttgtggtaggc 646



to top

>gb|DQ056619.1| Arabidopsis thaliana 60S ribosomal protein L8 (At3g51190) mRNA,
           complete cds
          Length = 783

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 90/107 (84%)
 Strand = Plus / Minus

                                                                       
Query: 343 tgaccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccaca 402
           |||||||| ||||||||||| ||||||||||||||||| || || |||||||| || |||
Sbjct: 665 tgaccaatgtgctggtggtttcctcctccgtggggatgttccactgggttcatcgcaaca 606

                                                          
Query: 403 ccacgcaccttaggccaggagttcctcttcacacggtacttgtggta 449
           ||||| ||   ||||||  ||||||||||| |   ||||||||||||
Sbjct: 605 ccacgtacaacaggccaacagttcctcttcgctttgtacttgtggta 559



to top

>dbj|AB242299.1| Asterias amurensis PKA-R mRNA for protein kinase A regulatory
            subunit, complete cds
          Length = 2300

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                        
Query: 345  accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
            ||||||||||||||| ||||| || ||||||||||| || ||||||||||| ||||||||
Sbjct: 1999 accaatatgctggtgattaccaccaccgtggggatggtccacagggttcattgccacacc 1940

               
Query: 405  acg 407
            |||
Sbjct: 1939 acg 1937



to top

>emb|AL116103.1|CNS01CXB Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 652 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 593

              
Query: 405 acg 407
           |||
Sbjct: 592 acg 590



to top

>emb|AL114960.1|CNS01C1K Botrytis cinerea strain T4 cDNA library
          Length = 480

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 214 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 155

              
Query: 405 acg 407
           |||
Sbjct: 154 acg 152



to top

>emb|AL112851.1|CNS01AEZ Botrytis cinerea strain T4 cDNA library
          Length = 600

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 416 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 357

              
Query: 405 acg 407
           |||
Sbjct: 356 acg 354



to top

>emb|AL112838.1|CNS01AEM Botrytis cinerea strain T4 cDNA library
          Length = 360

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 163 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 104

              
Query: 405 acg 407
           |||
Sbjct: 103 acg 101



to top

>emb|AL112486.1|CNS01A4U Botrytis cinerea strain T4 cDNA library
          Length = 720

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 57/63 (90%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || |||||||| |||||||| ||||| ||||||||||||||||| |||||
Sbjct: 587 accaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacc 528

              
Query: 405 acg 407
           |||
Sbjct: 527 acg 525



to top

>ref|XM_393671.2| PREDICTED: Apis mellifera similar to ribosomal protein L8
           (LOC410188), mRNA
          Length = 843

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || || ||||| || ||||| ||||| |||||||||||||| || |||||
Sbjct: 691 accaatatgttgatgattaccaccaccgtgtggatgttcaacagggttcatagcaacacc 632

                                      
Query: 405 acgcaccttaggccaggagttcctctt 431
           ||| |||||||||||  ||||||||||
Sbjct: 631 acgaaccttaggccaacagttcctctt 605



to top

>emb|AJ563478.1|CGI563478 Crassostrea gigas partial mRNA for ribosomal protein L8 (rpll gene)
          Length = 305

 Score = 77.8 bits (39), Expect = 3e-11
 Identities = 75/87 (86%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || |||||||||||||| ||||||||||||||||| |||||||| || ||
Sbjct: 188 accaatatgttgatggttacctcctccatggggatgctcaacaggattcatggctactcc 129

                                      
Query: 405 acgcaccttaggccaggagttcctctt 431
            |  || || |||||| ||||||||||
Sbjct: 128 tctgactttgggccagcagttcctctt 102



to top

>emb|BX071470.1|CNS09RB6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1020

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453



to top

>emb|BX071012.1|CNS09QYG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC8BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 828

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 357 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 416

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 417 ttcggccagcagttgcgcttcaccttgtacttgtggta 454



to top

>emb|BX070207.1|CNS09QC3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC7AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 469

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438



to top

>emb|BX061050.1|CNS09J9Q Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 330 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 389

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 390 ttcggccagcagttgcgcttcaccttgtacttgtggta 427



to top

>emb|BX068769.1|CNS09P85 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC53AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457



to top

>emb|BX067648.1|CNS09OD0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443



to top

>emb|BX067520.1|CNS09O9G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC51BA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 525

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445



to top

>emb|BX066574.1|CNS09NJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446



to top

>emb|BX066544.1|CNS09NIC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC5DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 350 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 409

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 410 ttcggccagcagttgcgcttcaccttgtacttgtggta 447



to top

>emb|BX065896.1|CNS09N0C Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449



to top

>emb|BX064864.1|CNS09M7O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1015

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434



to top

>emb|BX064747.1|CNS09M4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48BB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439



to top

>emb|BX064211.1|CNS09LPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 610

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446



to top

>emb|BX063827.1|CNS09LEV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 983

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457



to top

>emb|BX063245.1|CNS09KYP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 875

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagtagttgcgcttcaccttgtacttgtggta 437



to top

>emb|BX063171.1|CNS09KWN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC44DD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453



to top

>emb|BX062318.1|CNS09K8Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43CC05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagtagttgcgcttcaccttgtacttgtggta 435



to top

>emb|BX062038.1|CNS09K16 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC43AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 626

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 281 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 340

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 341 ttcggccagcagttgcgcttcaccttgtacttgtggta 378



to top

>emb|BX061861.1|CNS09JW9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42DE04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443



to top

>emb|BX061503.1|CNS09JMB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC42BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1006

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451



to top

>emb|BX061238.1|CNS09JEY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 308 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 367

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 368 ttcggccagcagttgcgcttcaccttgtacttgtggta 405



to top

>emb|BX060724.1|CNS09J0O Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41AH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443



to top

>emb|BX059267.1|CNS09HW7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC4AB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 903

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459



to top

>emb|BX059235.1|CNS09HVB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC39DH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 984

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438



to top

>emb|BX057044.1|CNS09G6G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36DC09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 783

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449



to top

>emb|BX056961.1|CNS09G45 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC36CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 831

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459



to top

>emb|BX055189.1|CNS09EQX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33CH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 845

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 350 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 409

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 410 ttcggccagcagttgcgcttcaccttgtacttgtggta 447



to top

>emb|BX054843.1|CNS09EHB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AG04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 904

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 346 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 405

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 406 ttcggccagcagttgcgcttcaccttgtacttgtggta 443



to top

>emb|BX054769.1|CNS09EF9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433



to top

>emb|BX054768.1|CNS09EF8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC33AC11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 715 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 656

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 655 ttcggccagcagttgcgcttcaccttgtacttgtggta 618



to top

>emb|BX053031.1|CNS09D2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC30BG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 274 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 333

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 334 ttcggccagcagttgcgcttcaccttgtacttgtggta 371



to top

>emb|BX054430.1|CNS09E5U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 248 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 307

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 308 ttcggccagcagttgcgcttcaccttgtacttgtggta 345



to top

>emb|BX054417.1|CNS09E5H Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC32CC08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 912

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 744 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 685

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 684 ttcggccagcagttgcgcttcaccttgtacttgtggta 647



to top

>emb|BX054379.1|CNS09E4F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32CA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 787

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446



to top

>emb|BX053844.1|CNS09DPK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459



to top

>emb|BX053555.1|CNS09DHJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC31BB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 362 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 421

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 422 ttcggccagcagttgcgcttcaccttgtacttgtggta 459



to top

>emb|BX052540.1|CNS09CPC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 357 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 416

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 417 ttcggccagcagttgcgcttcaccttgtacttgtggta 454



to top

>emb|BX052387.1|CNS09CL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC3BG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 521

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 358 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 417

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 418 ttcggccagcagttgcgcttcaccttgtacttgtggta 455



to top

>emb|BX051644.1|CNS09C0G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC29AC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462



to top

>emb|BX051423.1|CNS09BUB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC28DA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 873

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451



to top

>emb|BX050118.1|CNS09AU2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC26BE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 536

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441



to top

>emb|BX050810.1|CNS09BDA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27CA08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449



to top

>emb|BX050569.1|CNS09B6L Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC27AE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 334 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 393

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 394 ttcggccagcagttgcgcttcaccttgtacttgtggta 431



to top

>emb|BX049265.1|CNS09A6D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC25AC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 833

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457



to top

>emb|BX048973.1|CNS099Y9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC24CB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 511

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442



to top

>emb|BX046434.1|CNS097ZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441



to top

>emb|BX047425.1|CNS098R9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21CF10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 878

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 366 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 425

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 426 ttcggccagcagttgcgcttcaccttgtacttgtggta 463



to top

>emb|BX047145.1|CNS098JH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC21AG06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461



to top

>emb|BX045582.1|CNS097C2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 567

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453



to top

>emb|BX045137.1|CNS096ZP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC19AF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441



to top

>emb|BX043850.1|CNS095ZY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16CH02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 333 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatagccacaccgcgcacc 392

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 393 ttcggccagcagttgcgcttcaccttgtacttgtggta 430



to top

>emb|BX043551.1|CNS095RN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC16BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437



to top

>emb|BX041268.1|CNS09408 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462



to top

>emb|BX041134.1|CNS093WI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438



to top

>emb|BX041072.1|CNS093US Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC12BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435



to top

>emb|BX040787.1|CNS093MV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 975

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461



to top

>emb|BX040786.1|CNS093MU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC11DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 964

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 716 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 657

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 656 ttcggccagcagttgcgcttcaccttgtacttgtggta 619



to top

>emb|BX039654.1|CNS092RE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC10AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 953

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 333 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 392

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 393 ttcggccagcagttgcgcttcaccttgtacttgtggta 430



to top

>emb|BX036687.1|CNS090GZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA8DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 793

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438



to top

>emb|BX037078.1|CNS090RU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA9BE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 810

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 726 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 667

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 666 ttcggccagcagttgcgcttcaccttgtacttgtggta 629



to top

>emb|BX035978.1|CNS08ZXA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA7CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453



to top

>emb|BX034653.1|CNS08YWH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA50CF05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435



to top

>emb|BX033967.1|CNS08YDF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5CF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 751

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445



to top

>emb|BX033761.1|CNS08Y7P Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA5BE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 990

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 358 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 417

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 418 ttcggccagcagttgcgcttcaccttgtacttgtggta 455



to top

>emb|BX033234.1|CNS08XT2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49CD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 338 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 397

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 398 ttcggccagcagttgcgcttcaccttgtacttgtggta 435



to top

>emb|BX033107.1|CNS08XPJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49BF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442



to top

>emb|BX032954.1|CNS08XLA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AF11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450



to top

>emb|BX032912.1|CNS08XK4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA49AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449



to top

>emb|BX032378.1|CNS08X5A Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA48BA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 640

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437



to top

>emb|BX031877.1|CNS08WRD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437



to top

>emb|BX031828.1|CNS08WQ0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47BG01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 917

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438



to top

>emb|BX031537.1|CNS08WHX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA47AB01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 827

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433



to top

>emb|BX030749.1|CNS08VW1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA45DG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 957

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439



to top

>emb|BX031289.1|CNS08WB1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA46CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433



to top

>emb|BX030002.1|CNS08VBA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1023

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457



to top

>emb|BX029262.1|CNS08UQQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA43DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 811

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439



to top

>emb|BX029602.1|CNS08V06 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA44BA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 349 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 408

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 409 ttcggccagcagttgcgcttcaccttgtacttgtggta 446



to top

>emb|BX028637.1|CNS08U9D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42DB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445



to top

>emb|BX022357.1|CNS08PEX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 838

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442



to top

>emb|BX026844.1|CNS08SVK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40BB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453



to top

>emb|BX026789.1|CNS08SU1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA40AH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 946

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445



to top

>emb|BX025698.1|CNS08RZQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA39BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 988

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450



to top

>emb|BX025349.1|CNS08RQ1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38DE05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 948

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451



to top

>emb|BX025079.1|CNS08RIJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437



to top

>emb|BX025073.1|CNS08RID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BG02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434



to top

>emb|BX025038.1|CNS08RHE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 967

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445



to top

>emb|BX025033.1|CNS08RH9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA38BE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 929

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 340 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 399

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 400 ttcggccagcagttgcgcttcaccttgtacttgtggta 437



to top

>emb|BX024670.1|CNS08R76 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA37DA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 797

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438



to top

>emb|BX024145.1|CNS08QSL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 329 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 388

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 389 ttcggccagcagttgcgcttcaccttgtacttgtggta 426



to top

>emb|BX023815.1|CNS08QJF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA36BE01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 896

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 366 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 425

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 426 ttcggccagcagttgcgcttcaccttgtacttgtggta 463



to top

>emb|BX022223.1|CNS08PB7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA34AB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 376 tgctgatggttaccaccaccgtgcggatgctcgacggggttcattgccacaccgcgcacc 435

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 436 ttcggccagcagttgcgcttcaccttgtacttgtggta 473



to top

>emb|BX021031.1|CNS08OE3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA31AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445



to top

>emb|BX020305.1|CNS08NTX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3DF03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434



to top

>emb|BX018974.1|CNS08MSY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 859

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439



to top

>emb|BX018003.1|CNS08M1Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 961

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442



to top

>emb|BX017981.1|CNS08M1D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27AF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1003

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438



to top

>emb|BX018524.1|CNS08MGG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA28AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 354 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 413

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 414 ttcggccagcagttgcgcttcaccttgtacttgtggta 451



to top

>emb|BX018377.1|CNS08MCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA27DE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1034

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 360 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 419

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 420 ttcggccagcagttgcgcttcaccttgtacttgtggta 457



to top

>emb|BX017737.1|CNS08LUL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26DC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 364 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 423

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 424 ttcggccagcagttgcgcttcaccttgtacttgtggta 461



to top

>emb|BX017331.1|CNS08LJB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26AD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 337 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 396

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 397 ttcggccagcagttgcgcttcaccttgtacttgtggta 434



to top

>emb|BX016524.1|CNS08KWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA24DD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 801

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 627 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 568

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 567 ttcggccagcagttgcgcttcaccttgtacttgtggta 530



to top

>emb|BX016411.1|CNS08KTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA24CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 885

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 368 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 427

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 428 ttcggccagcagttgcgcttcaccttgtacttgtggta 465



to top

>emb|BX015958.1|CNS08KH6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA23DG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 341 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 400

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 401 ttcggccagcagttgcgcttcaccttgtacttgtggta 438



to top

>emb|BX014218.1|CNS08J4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA21BD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 795

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 356 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 415

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 416 ttcggccagcagttgcgcttcaccttgtacttgtggta 453



to top

>emb|BX013506.1|CNS08IL2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggta 433



to top

>emb|BX013505.1|CNS08IL1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 949

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 719 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 660

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 659 ttcggccagcagttgcgcttcaccttgtacttgtggta 622



to top

>emb|BX013494.1|CNS08IKQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA20BC01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 939

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 345 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 404

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 405 ttcggccagcagttgcgcttcaccttgtacttgtggta 442



to top

>emb|BX012299.1|CNS08HNJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19CC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 765

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 353 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 412

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 413 ttcggccagcagttgcgcttcaccttgtacttgtggta 450



to top

>emb|BX010378.1|CNS08G66 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA16CG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 857

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 342 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 401

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 402 ttcggccagcagttgcgcttcaccttgtacttgtggta 439



to top

>emb|BX009864.1|CNS08FRW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 854

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 344 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 403

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 404 ttcggccagcagttgcgcttcaccttgtacttgtggta 441



to top

>emb|BX009834.1|CNS08FR2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA15DE07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 935

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449



to top

>emb|BX008448.1|CNS08EOK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 510

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 365 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 424

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 425 ttcggccagcagttgcgcttcaccttgtacttgtggta 462



to top

>emb|BX008129.1|CNS08EFP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 840

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 330 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 389

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 390 ttcggccagcagttgcgcttcaccttgtacttgtggta 427



to top

>emb|BX008128.1|CNS08EFO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA13BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 900

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 701 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 642

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 641 ttcggccagcagttgcgcttcaccttgtacttgtggta 604



to top

>emb|BX007575.1|CNS08E0B Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12CE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 348 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 407

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 408 ttcggccagcagttgcgcttcaccttgtacttgtggta 445



to top

>emb|BX006812.1|CNS08DF4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 483

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 189 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 248

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 249 ttcggccagcagttgcgcttcaccttgtacttgtggta 286



to top

>emb|BX005817.1|CNS08CNH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA10AA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 872

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 352 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 411

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 412 ttcggccagcagttgcgcttcaccttgtacttgtggta 449



to top

>emb|AL112254.1|CNS019YE Botrytis cinerea strain T4 cDNA library
          Length = 660

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 56/62 (90%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           |||||||| || |||||||| |||||||| ||||| ||||||||||||||||| ||||||
Sbjct: 462 ccaatatgttgatggttaccacctccgtgaggatggtcaacagggttcatggcaacacca 403

             
Query: 406 cg 407
           ||
Sbjct: 402 cg 401



to top

>gb|AF401561.1| Ictalurus punctatus ribosomal protein L8 mRNA, complete cds
          Length = 821

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 74/86 (86%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| ||||| |||||||| || |||  ||||||||||||||||||||| |||||||||
Sbjct: 675 ccaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacca 616

                                     
Query: 406 cgcaccttaggccaggagttcctctt 431
           || ||   ||||||| ||||||||||
Sbjct: 615 cggacacgaggccagcagttcctctt 590



to top

>ref|XM_315817.2| Anopheles gambiae str. PEST ENSANGP00000010416
           (ENSANGG00000007927), mRNA
          Length = 1093

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 83/98 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 751 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 692

                                                 
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggta 449
           || |||||| |||| | ||||||   ||||||||||||
Sbjct: 691 ttcggccagcagttgcgcttcaccttgtacttgtggta 654



to top

>gb|DQ213525.1| Taeniopygia guttata clone 0058P0034B06 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 881

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||||||||  |||||||||  ||||||||| ||||||||||||||||||||||| || 
Sbjct: 703 tgctggtggtcgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 644

                                                    
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggtaggc 452
              |||||| ||||||||||  |   |||||||||||||||
Sbjct: 643 cgtggccagcagttcctcttggccttgtacttgtggtaggc 603



to top

>gb|DQ213523.1| Taeniopygia guttata clone 0058P0011G02 ribosomal protein L8-like
           mRNA, complete sequence
          Length = 882

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 85/101 (84%)
 Strand = Plus / Minus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||||||||  |||||||||  ||||||||| ||||||||||||||||||||||| || 
Sbjct: 703 tgctggtggtcgcctcctccgaagggatgctccacagggttcatggccacaccacggaca 644

                                                    
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggtaggc 452
              |||||| ||||||||||  |   |||||||||||||||
Sbjct: 643 cgtggccagcagttcctcttggccttgtacttgtggtaggc 603



to top

>gb|AY769276.1| Bombyx mori ribosomal protein L8 (RpL8) mRNA, complete cds
          Length = 862

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 67/77 (87%)
 Strand = Plus / Minus

                                                                       
Query: 331 acagtggaagcatgaccaatatgctggtggttacctcctccgtggggatgctcaacaggg 390
           ||||||||||| | ||| ||||| || |||||||| || ||||| |||||||| ||||||
Sbjct: 713 acagtggaagccttacctatatgttgatggttaccaccaccgtgaggatgctctacaggg 654

                            
Query: 391 ttcatggccacaccacg 407
           |||||||| ||||||||
Sbjct: 653 ttcatggcaacaccacg 637



to top

>emb|BX046386.1|CNS097YE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC20AA10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 868

 Score = 73.8 bits (37), Expect = 4e-10
 Identities = 82/97 (84%)
 Strand = Plus / Plus

                                                                       
Query: 352 tgctggtggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcacc 411
           ||||| |||||||| || ||||| |||||||| || |||||||| |||||||| ||||||
Sbjct: 336 tgctgatggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcacc 395

                                                
Query: 412 ttaggccaggagttcctcttcacacggtacttgtggt 448
           || |||||| |||| | ||||||   |||||||||||
Sbjct: 396 ttcggccagcagttgcgcttcaccttgtacttgtggt 432



to top

>emb|AM049008.1| Biphyllus lunatus mRNA for ribosomal protein L8e (rpL8e gene)
          Length = 774

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 66/76 (86%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| || || |||||||| |||||||| |||||||| || |||||||| || |||||
Sbjct: 660 accaatgtgttgatggttaccacctccgtgaggatgctccacggggttcatagcaacacc 601

                           
Query: 405 acgcaccttaggccag 420
           ||| ||||||||||||
Sbjct: 600 acgaaccttaggccag 585



to top

>emb|BX054108.1|CNS09DWW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC32AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 466

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 358 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 417
           |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| |||
Sbjct: 360 tggttaccgccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 419

                                           
Query: 418 caggagttcctcttcacacggtacttgtggta 449
           ||| |||| | ||||||   ||||||||||||
Sbjct: 420 cagcagttgcgcttcaccttgtacttgtggta 451



to top

>emb|BX007182.1|CNS08DPE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA12AB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 749

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 358 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 417
           |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| |||
Sbjct: 228 tggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 287

                                           
Query: 418 caggagttcctcttcacacggtacttgtggta 449
           ||| |||| | ||||||   ||||||||||||
Sbjct: 288 cagcagttgcgcttcaccttgtacttgtggta 319



to top

>emb|BX005504.1|CNS08CES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA1AA12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 662

 Score = 71.9 bits (36), Expect = 2e-09
 Identities = 78/92 (84%)
 Strand = Plus / Plus

                                                                       
Query: 358 tggttacctcctccgtggggatgctcaacagggttcatggccacaccacgcaccttaggc 417
           |||||||| || ||||| |||||||| || |||||||| |||||||| |||||||| |||
Sbjct: 366 tggttaccaccaccgtgcggatgctcgacggggttcatcgccacaccgcgcaccttcggc 425

                                           
Query: 418 caggagttcctcttcacacggtacttgtggta 449
           ||| |||| | ||||||   ||||||||||||
Sbjct: 426 cagcagttgcgcttcaccttgtacttgtggta 457



to top

>gb|BC059473.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:73105
           IMAGE:4786513), complete cds
          Length = 841

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 675 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 616

              
Query: 405 acg 407
           |||
Sbjct: 615 acg 613



to top

>gb|BC043017.1| Mus musculus ribosomal protein L8, mRNA (cDNA clone MGC:57885
           IMAGE:5684024), complete cds
          Length = 861

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 676 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 617

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 616 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 570



to top

>ref|NM_012053.1| Mus musculus ribosomal protein L8 (Rpl8), mRNA
          Length = 842

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 680 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 621

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 620 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 574



to top

>ref|XM_453766.1| Kluyveromyces lactis NRRL Y-1140, KLLA0D16027g predicted mRNA
          Length = 765

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 86/103 (83%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 660 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 601

                                                      
Query: 405 acgcaccttaggccaggagttcctcttcacacggtacttgtgg 447
           |||   ||| ||||| ||||| ||||| || | ||||||||||
Sbjct: 600 acgagtctttggccaagagtttctcttgactctgtacttgtgg 558



to top

>ref|NM_200713.1| Danio rerio ribosomal protein L8 (rpl8), mRNA
          Length = 841

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 675 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 616

              
Query: 405 acg 407
           |||
Sbjct: 615 acg 613



to top

>emb|CR382124.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome D of strain NRRL Y-1140
               of Kluyveromyces lactis
          Length = 1715506

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 86/103 (83%)
 Strand = Plus / Plus

                                                                           
Query: 345     accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
               ||||||||| || |||||||| || ||||| || || ||||||||||||||||| |||||
Sbjct: 1350556 accaatatgttgatggttaccaccaccgtgagggtgatcaacagggttcatggcaacacc 1350615

                                                          
Query: 405     acgcaccttaggccaggagttcctcttcacacggtacttgtgg 447
               |||   ||| ||||| ||||| ||||| || | ||||||||||
Sbjct: 1350616 acgagtctttggccaagagtttctcttgactctgtacttgtgg 1350658



to top

>gb|BC065432.1| Danio rerio ribosomal protein L8, mRNA (cDNA clone MGC:77641
           IMAGE:6996953), complete cds
          Length = 892

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 56/63 (88%)
 Strand = Plus / Minus

                                                                       
Query: 345 accaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacc 404
           |||||| ||||| |||||||| || |||  ||||||||||||||||||||| ||||||||
Sbjct: 672 accaatgtgctgatggttaccaccaccgaagggatgctcaacagggttcatagccacacc 613

              
Query: 405 acg 407
           |||
Sbjct: 612 acg 610



to top

>dbj|AK131970.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:2510006J21 product:ribosomal protein L8,
           full insert sequence
          Length = 848

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 700 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 641

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 640 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 594



to top

>dbj|AK145498.1| Mus musculus blastocyst blastocyst cDNA, RIKEN full-length enriched
           library, clone:I1C0007H22 product:ribosomal protein L8,
           full insert sequence
          Length = 844

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 695 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 636

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 635 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 589



to top

>dbj|AK146330.1| Mus musculus CRL-1722 L5178Y-R cDNA, RIKEN full-length enriched
           library, clone:I730056L04 product:ribosomal protein L8,
           full insert sequence
          Length = 843

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 695 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 636

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 635 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 589



to top

>dbj|AK152063.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830046M18 product:ribosomal
           protein L8, full insert sequence
          Length = 848

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 701 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 642

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 641 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 595



to top

>dbj|AK151408.1| Mus musculus bone marrow macrophage cDNA, RIKEN full-length
           enriched library, clone:I830029F10 product:ribosomal
           protein L8, full insert sequence
          Length = 843

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 695 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 636

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 635 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 589



to top

>dbj|AK167775.1| Mus musculus cDNA, RIKEN full-length enriched library,
           clone:I730021F14 product:ribosomal protein L8, full
           insert sequence
          Length = 843

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 695 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 636

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 635 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 589



to top

>dbj|AK168769.1| Mus musculus 13 days embryo liver cDNA, RIKEN full-length enriched
           library, clone:I920051N08 product:ribosomal protein L8,
           full insert sequence
          Length = 841

 Score = 69.9 bits (35), Expect = 7e-09
 Identities = 89/107 (83%)
 Strand = Plus / Minus

                                                                       
Query: 346 ccaatatgctggtggttacctcctccgtggggatgctcaacagggttcatggccacacca 405
           ||||| |||||||||||||| |||||   ||||||||| ||||| |||||||||||||| 
Sbjct: 693 ccaatgtgctggtggttaccacctccaaagggatgctccacaggattcatggccacaccc 634

                                                          
Query: 406 cgcaccttaggccaggagttcctcttcacacggtacttgtggtaggc 452
           |||||    |||||| ||||||||||  |   |||||||||||||||
Sbjct: 633 cgcacacgtggccagcagttcctctttgccttgtacttgtggtaggc 587


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,352,318
Number of Sequences: 3902068
Number of extensions: 3352318
Number of successful extensions: 65347
Number of sequences better than 10.0: 501
Number of HSP's better than 10.0 without gapping: 492
Number of HSP's successfully gapped in prelim test: 9
Number of HSP's that attempted gapping in prelim test: 64464
Number of HSP's gapped (non-prelim): 849
length of query: 461
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 439
effective length of database: 17,147,199,772
effective search space: 7527620699908
effective search space used: 7527620699908
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top