Clone Name | rbah61j05 |
---|---|
Clone Library Name | barley_pub |
>gb|AF495586.1| Setaria italica putative C4 phosphoenolpyruvate carboxylase (ppc) mRNA, complete cds Length = 3214 Score = 192 bits (97), Expect = 6e-46 Identities = 132/141 (93%), Gaps = 2/141 (1%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2958 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 2899 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgc-cggctggttct 351 |||||||||| |||| |||||||||| |||||||||||| | | ||| ||||||||||| Sbjct: 2898 cagccccggcccgtactcgctcgccgggttgagcttcacaatc-ccgcgcggctggttct 2840 Query: 352 cgtcggcgaactccttggaca 372 ||||||||||||||||||||| Sbjct: 2839 cgtcggcgaactccttggaca 2819
>emb|AJ318582.1|EAU318582 Eulalia aurea partial 3' end mRNA for putative phosphoenolpyruvate carboxylase, (pepc gene) Length = 506 Score = 167 bits (84), Expect = 3e-38 Identities = 126/140 (90%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 321 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 262 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 |||||| |||| ||| |||||||||| ||| ||||||||||| || |||| |||||| Sbjct: 261 cagccctggcgggtactcgctcgccgggttcagcttcaccaggccggcgggcttgttctc 202 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 201 gtcggcgaactccttggaca 182
>emb|AJ318338.1|SSP318338 Saccharum spontaneum mRNA for putative C4 phosphoenolpyruvate carboxylase (pepc gene), (C4 PPCSs-1) Length = 3015 Score = 167 bits (84), Expect = 3e-38 Identities = 126/140 (90%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| || Sbjct: 2886 ctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtcttc 2827 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 |||||| |||| |||||||||||||| ||| ||||||||||| || |||| |||||| Sbjct: 2826 cagcccgggcgggtattcgctcgccgggttcagcttcaccagtccggcgggcttgttctc 2767 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 2766 gtcggcgaactccttggaca 2747
>gb|AY135709.1| Saccharum hybrid cultivar putative C4 phosphoenolpyruvate carboxylase mRNA, complete cds Length = 3205 Score = 159 bits (80), Expect = 8e-36 Identities = 125/140 (89%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| || Sbjct: 2981 ctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtcttc 2922 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 |||||| |||| ||| |||||||||| ||| ||||||||||| || |||| |||||| Sbjct: 2921 cagcccgggcgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgttctc 2862 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 2861 gtcggcgaactccttggaca 2842
>emb|X15239.1|ZMPEPC1G Maize PEPC1 gene for phosphoenolpyruvate carboxylase (EC 4.1.1.31) Length = 6151 Score = 159 bits (80), Expect = 8e-36 Identities = 125/140 (89%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 5674 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 5615 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||| ||| |||||||||| ||| ||||| ||||| || |||| |||||| Sbjct: 5614 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 5555 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 5554 gtcggcgaactccttggaca 5535
>emb|AJ536629.1|ZMA536629 Zea mays mRNA for phosphoenolpyruvate carboxylase (ppc1 gene), clone pM500 Length = 2913 Score = 159 bits (80), Expect = 8e-36 Identities = 125/140 (89%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 2913 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 2854 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||| ||| |||||||||| ||| ||||| ||||| || |||| |||||| Sbjct: 2853 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2794 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 2793 gtcggcgaactccttggaca 2774
>emb|AJ293347.1|SVE293347 Sorghum verticilliflorum partial mRNA for putative C4 phosphoenolpyruvate carboyxlase (PEPC gene) Length = 504 Score = 159 bits (80), Expect = 8e-36 Identities = 125/140 (89%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||| || Sbjct: 321 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagagtgtcttc 262 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||||||||| | ||| |||||||||| ||| ||||||||||| || |||| |||||| Sbjct: 261 cagccccggtgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgttctc 202 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 201 gtcggcgaactccttggaca 182
>emb|AJ293346.1|SOF293346 Saccharum officinarum mRNA for putative C4 phosphoenolpyruvate carboxylase (PEPC gene) Length = 3067 Score = 159 bits (80), Expect = 8e-36 Identities = 125/140 (89%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| || ||||||||||||||||||||||| || Sbjct: 2886 ctagccggtgttctgcatgccggcggcgatacctttcatggtgaggatgagcgtgtcttc 2827 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 |||||| |||| ||| |||||||||| ||| ||||||||||| || |||| |||||| Sbjct: 2826 cagcccgggcgggtactcgctcgccgggttcagcttcaccagtccggcgggcttgttctc 2767 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 2766 gtcggcgaactccttggaca 2747
>emb|X15238.1|ZMPEPC1 Maize mRNA for phosphoenolpyruvate carboxylase (EC 4.1.1.31) Length = 3265 Score = 159 bits (80), Expect = 8e-36 Identities = 125/140 (89%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 2993 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 2934 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||| ||| |||||||||| ||| ||||| ||||| || |||| |||||| Sbjct: 2933 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2874 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 2873 gtcggcgaactccttggaca 2854
>emb|X15642.1|ZMPEP Z.mays gene for phosphoenolpyruvate carboxylase (EC 4.1.1.31) Length = 6781 Score = 159 bits (80), Expect = 8e-36 Identities = 125/140 (89%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 6318 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 6259 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||| ||| |||||||||| ||| ||||| ||||| || |||| |||||| Sbjct: 6258 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 6199 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 6198 gtcggcgaactccttggaca 6179
>gb|AY103747.1| Zea mays PCO070206 mRNA sequence Length = 3289 Score = 159 bits (80), Expect = 8e-36 Identities = 125/140 (89%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 2993 ctagccagtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcttc 2934 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||| ||| |||||||||| ||| ||||| ||||| || |||| |||||| Sbjct: 2933 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2874 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 2873 gtcggcgaactccttggaca 2854
>emb|X63756.1|SVPEPCAA S.vulgare PEPC gene Length = 7071 Score = 153 bits (77), Expect = 5e-34 Identities = 126/140 (90%), Gaps = 3/140 (2%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 6551 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 6492 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||||||||||| ||| |||||||| |||| ||||||||||| || |||| |||||| Sbjct: 6491 cagccccggcg-gtactcgctcgc--cgttcagcttcaccagtccggcgggcttgttctc 6435 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 6434 gtcggcgaactccttggaca 6415
>emb|X17379.1|SVPEPC Sorghum vulgare mRNA for phosphoenolpyruvate involved in C4 photosynthesis (EC 4.1.1.31) Length = 3192 Score = 153 bits (77), Expect = 5e-34 Identities = 126/140 (90%), Gaps = 3/140 (2%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 2914 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 2855 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||||||||||| ||| |||||||| |||| ||||||||||| || |||| |||||| Sbjct: 2854 cagccccggcg-gtactcgctcgc--cgttcagcttcaccagtccggcgggcttgttctc 2798 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 2797 gtcggcgaactccttggaca 2778
>gb|AY491400.1| Setaria italica C3 phosphoenolpyruvate carboxylase (ppc1) mRNA, complete cds Length = 2886 Score = 151 bits (76), Expect = 2e-33 Identities = 124/140 (88%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||| ||||||||||| ||||||||||| ||||| ||||||||||| Sbjct: 2886 ctagccggtgttctgcatcccggcggcgatacccttcatggtcaggatcagcgtgtcctc 2827 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| ||||||||||| |||||| | | ||| |||| ||||||| |||||||||| |||| Sbjct: 2826 caggcccggcgcgtactcgctctcggggttcagctgcaccagctgcgccggctggctctc 2767 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 2766 gtcggtgaactccttggaca 2747
>emb|AJ318583.1|VZI318583 Vetiveria zizanioides partial 3' end mRNA for putative phosphoenolpyruvate carboxylase (pepc gene) Length = 515 Score = 151 bits (76), Expect = 2e-33 Identities = 124/140 (88%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 321 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 262 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||| ||| |||||||||| ||||||||| ||||| || |||| ||||| Sbjct: 261 caggcctggcgggtactcgctcgccgggttgagctttaccagtccggcgggctctttctc 202 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 201 gtcggcgaactccttggaca 182
>emb|AJ293348.1|CLA293348 Coix lacryma-jobi partial mRNA for putative C4 phosphoenolpyruvate carboxylase (PEPC gene) Length = 506 Score = 151 bits (76), Expect = 2e-33 Identities = 124/140 (88%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||| |||||||||||||||||||||||||| || Sbjct: 321 ctagccggtgttctgcatgccggcggcgatacccttcatggtgaggatgagcgtgtcttc 262 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 |||||| |||| ||| |||||||||| ||| || |||||||| || |||| |||| | Sbjct: 261 cagccctggcgggtagtcgctcgccgggttcagtttcaccagttcggcgggcttgttcgc 202 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 201 gtcggcgaactccttggaca 182
>emb|X03613.1|ZMPEPCR Maize mRNA for phosphoenolpyruvate carboxylase (PEPCase EC 4.1.1.31) Length = 3028 Score = 143 bits (72), Expect = 5e-31 Identities = 123/140 (87%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||||||||||||||||| |||||||||||||||||||||||||||||| || Sbjct: 2809 ctagccagtgttctgcatgccggcgcggatgcccttcatggtgaggatgagcgtgtcttc 2750 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||| ||| |||||||||| ||| ||||| ||||| || |||| |||||| Sbjct: 2749 caggccgggcgggtactcgctcgccgggttcagcttgaccagtccggcgggcttgttctc 2690 Query: 353 gtcggcgaactccttggaca 372 |||||||||||||||||||| Sbjct: 2689 gtcggcgaactccttggaca 2670
>gb|BT017928.1| Zea mays clone EL01N0519G10.c mRNA sequence Length = 1453 Score = 135 bits (68), Expect = 1e-28 Identities = 122/140 (87%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||| Sbjct: 1178 ctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgtcctc 1119 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || || ||||| |||||| | ||| |||| ||||||| ||||||||| |||| Sbjct: 1118 caggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgactctc 1059 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 1058 gtcggtgaactccttggaca 1039
>gb|AY109352.1| Zea mays CL1793_1 mRNA sequence Length = 3349 Score = 135 bits (68), Expect = 1e-28 Identities = 122/140 (87%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||| Sbjct: 3080 ctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgtcctc 3021 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || || ||||| |||||| | ||| |||| ||||||| ||||||||| |||| Sbjct: 3020 caggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgactctc 2961 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 2960 gtcggtgaactccttggaca 2941
>dbj|AB012228.1| Zea mays mRNA for phosphoenolpyruvate carboxylase, complete cds Length = 3319 Score = 135 bits (68), Expect = 1e-28 Identities = 122/140 (87%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||||||||||||||||||||| |||||||| |||||||| Sbjct: 3080 ctagccggtgttctgcatgccggcggcgatgcccttcatggtcaggatgagggtgtcctc 3021 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || || ||||| |||||| | ||| |||| ||||||| ||||||||| |||| Sbjct: 3020 caggcctggagcgtactcgctctgctggttcagctgcaccagctccgccggctgactctc 2961 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 2960 gtcggtgaactccttggaca 2941
>ref|NM_188369.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2331 Score = 129 bits (65), Expect = 7e-27 Identities = 92/101 (91%) Strand = Plus / Minus Query: 235 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 2329 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 2270 Query: 295 gccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 |||| || |||| ||||| | |||||||||||||||| Sbjct: 2269 gcccggggtcgtactcgctgtttgggttgagcttcaccagc 2229
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 129 bits (65), Expect = 7e-27 Identities = 92/101 (91%) Strand = Plus / Minus Query: 235 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 5908267 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 5908208 Query: 295 gccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 |||| || |||| ||||| | |||||||||||||||| Sbjct: 5908207 gcccggggtcgtactcgctgtttgggttgagcttcaccagc 5908167 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Plus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 ||||||||||| || || ||||||||||||||||| |||||||| |||||||| Sbjct: 31852803 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 31852855 Score = 40.1 bits (20), Expect = 5.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 249 atgccggcggcgatgcccttcatggtga 276 ||||||||||||||||| || ||||||| Sbjct: 31192163 atgccggcggcgatgccgttgatggtga 31192136
>dbj|AP003052.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBa0016I09 Length = 148517 Score = 129 bits (65), Expect = 7e-27 Identities = 92/101 (91%) Strand = Plus / Minus Query: 235 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 112008 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 111949 Query: 295 gccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 |||| || |||| ||||| | |||||||||||||||| Sbjct: 111948 gcccggggtcgtactcgctgtttgggttgagcttcaccagc 111908
>dbj|AK066635.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071A07, full insert sequence Length = 3495 Score = 129 bits (65), Expect = 7e-27 Identities = 92/101 (91%) Strand = Plus / Minus Query: 235 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 3202 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 3143 Query: 295 gccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 |||| || |||| ||||| | |||||||||||||||| Sbjct: 3142 gcccggggtcgtactcgctgtttgggttgagcttcaccagc 3102
>gb|AF268091.1|AF268091 Chloris gayana phosphoenolpyruvate carboxylase (ppc) mRNA, complete cds Length = 3137 Score = 125 bits (63), Expect = 1e-25 Identities = 93/103 (90%) Strand = Plus / Minus Query: 232 tctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcct 291 ||||||| ||||||||||| ||||||||||| ||||||||||||| |||||| ||||||| Sbjct: 2888 tctagccggtgttctgcataccggcggcgatacccttcatggtgatgatgagggtgtcct 2829 Query: 292 ccagccccggcgcgtattcgctcgccgcgttgagcttcaccag 334 |||| ||||||||||| ||||| |||| ||||||||| ||||| Sbjct: 2828 ccagtcccggcgcgtactcgctggccgggttgagcttgaccag 2786
>emb|X65137.1|SVPEPCGX S.vulgare pepC gene for PEP carboxylase Length = 7586 Score = 119 bits (60), Expect = 7e-24 Identities = 120/140 (85%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| || |||||||||||||| ||||||||||||||||| ||||| || |||||||| Sbjct: 7249 ctagccggtattctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 7190 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||||||| |||||| | ||| |||| ||||||| | |||||||| |||| Sbjct: 7189 caggcctggcgcgtactcgctctgctggttcagctgcaccagctccaccggctggctctc 7130 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 7129 gtcggtgaactccttggaca 7110
>emb|X55664.1|SVPEPCA Sorghum vulgare mRNA for phosphoenolpyruvate carboxylase (PEPC) Length = 3128 Score = 119 bits (60), Expect = 7e-24 Identities = 120/140 (85%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| || |||||||||||||| ||||||||||||||||| ||||| || |||||||| Sbjct: 2883 ctagccggtattctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 2824 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||||||| |||||| | ||| |||| ||||||| | |||||||| |||| Sbjct: 2823 caggcctggcgcgtactcgctctgctggttcagctgcaccagctccaccggctggctctc 2764 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 2763 gtcggtgaactccttggaca 2744
>emb|AJ318339.1|SSP318339 Saccharum hybrid cultivar R570 partial pepc gene for putative phosphoenolpyruvate carboxylase (PPCS-1-1) Length = 755 Score = 119 bits (60), Expect = 7e-24 Identities = 120/140 (85%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||| ||||||||||||||||| ||||| || |||||||| Sbjct: 582 ctagccggtgttctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 523 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || |||||||| |||||| | ||| |||| ||||||| ||| ||||| |||| Sbjct: 522 caggcctggcgcgtactcgctctgctggttcagctgcaccagctccgctggctgactctc 463 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 462 gtcggtgaactccttggaca 443
>gb|AY251482.1| Echinochloa crus-galli phosphoenolpyruvate carboxylase (ppc) mRNA, complete cds Length = 2886 Score = 119 bits (60), Expect = 7e-24 Identities = 120/140 (85%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||||||||||||||||||| |||||||||||||| ||||| ||||||| ||| Sbjct: 2886 ctagccggtgttctgcatgccggcggcaatgcccttcatggtcaggatcagcgtgttctc 2827 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| ||||||||||| |||||| | | ||| || ||||||| ||| |||||| |||| Sbjct: 2826 caggcccggcgcgtactcgctctcagggttcagtcgcaccagctccgcaggctggctctc 2767 Query: 353 gtcggcgaactccttggaca 372 ||| ||||||||||||||| Sbjct: 2766 gtcaacgaactccttggaca 2747
>emb|AJ318341.1|SSP318341 Saccharum hybrid cultivar R570 partial pepc gene for putative phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-1-3) Length = 743 Score = 111 bits (56), Expect = 2e-21 Identities = 119/140 (85%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| ||||||||||||||||| ||||||||||||||||| ||||| || |||||||| Sbjct: 573 ctagccggtgttctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 514 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || ||||| || |||||| | ||| |||| ||||||| ||| ||||| |||| Sbjct: 513 caggcctggcgcatactcgctctgctggttcagctgcaccagctccgctggctgactctc 454 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 453 gtcggtgaactccttggaca 434
>gb|AY111910.1| Zea mays CL16446_1 mRNA sequence Length = 607 Score = 109 bits (55), Expect = 6e-21 Identities = 73/79 (92%) Strand = Plus / Plus Query: 235 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||||| ||||| ||||||||||||||||| |||||||| |||||||||| Sbjct: 141 agcccgtgttctgcatcccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 200 Query: 295 gccccggcgcgtattcgct 313 ||||||| ||||| ||||| Sbjct: 201 gccccggggcgtactcgct 219
>gb|M86661.1|SCFSCPEPCD Saccharum hybrid cultivar H32-8560 phosphoenolpyruvate carboxylase (SCPEPCD1) gene, complete cds Length = 8638 Score = 105 bits (53), Expect = 1e-19 Identities = 86/97 (88%) Strand = Plus / Minus Query: 235 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||| ||||||||||| ||||| ||||||||||||||||| |||||||| |||||||||| Sbjct: 8111 agccggtgttctgcattccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 8052 Query: 295 gccccggcgcgtattcgctcgccgcgttgagcttcac 331 | ||||| ||||| ||||||| | |||||||||||| Sbjct: 8051 gtcccggggcgtactcgctcgtggtgttgagcttcac 8015
>gb|AY107882.1| Zea mays PCO089178 mRNA sequence Length = 1373 Score = 101 bits (51), Expect = 2e-18 Identities = 72/79 (91%) Strand = Plus / Minus Query: 235 agcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||| ||||||||||| ||||| ||||||||||||||||| |||||||| |||||||||| Sbjct: 1242 agccggtgttctgcatcccggcagcgatgcccttcatggtcaggatgagggtgtcctcca 1183 Query: 295 gccccggcgcgtattcgct 313 ||||||| ||||| ||||| Sbjct: 1182 gccccggggcgtactcgct 1164
>emb|AJ312651.1|KPI312651 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform F Length = 1119 Score = 97.6 bits (49), Expect = 2e-17 Identities = 73/81 (90%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctc 314 |||||||||||||||||||| || ||||||||||||||||| ||||| ||||| |||||| Sbjct: 1118 gcggcgatgcccttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctc 1059 Query: 315 gccgcgttgagcttcaccagc 335 | | |||||||||||||||| Sbjct: 1058 gtggtgttgagcttcaccagc 1038
>emb|AJ344057.1|KPI344057 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (ppc gene), isogene 6 Length = 1119 Score = 97.6 bits (49), Expect = 2e-17 Identities = 73/81 (90%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctc 314 |||||||||||||||||||| || ||||||||||||||||| ||||| ||||| |||||| Sbjct: 1118 gcggcgatgcccttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctc 1059 Query: 315 gccgcgttgagcttcaccagc 335 | | |||||||||||||||| Sbjct: 1058 gtggtgttgagcttcaccagc 1038
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 97.6 bits (49), Expect = 2e-17 Identities = 82/93 (88%) Strand = Plus / Plus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| ||||| Sbjct: 8177149 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 8177208 Query: 290 ctccagccccggcgcgtattcgctcgccgcgtt 322 |||||| || || ||||| |||||||| ||||| Sbjct: 8177209 ctccaggccaggtgcgtactcgctcgcagcgtt 8177241
>gb|AF271995.1|AF271995 Oryza sativa phosphoenolpyruvate carboxylase mRNA, complete cds Length = 3307 Score = 97.6 bits (49), Expect = 2e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| ||||| Sbjct: 3070 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 3011 Query: 290 ctccagccccggcgcgtattcgctcgccgcgtt 322 |||||| || || ||||| |||||||| ||||| Sbjct: 3010 ctccaggccaggtgcgtactcgctcgcagcgtt 2978
>dbj|AP004117.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1134_F06 Length = 130968 Score = 97.6 bits (49), Expect = 2e-17 Identities = 82/93 (88%) Strand = Plus / Plus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| ||||| Sbjct: 9295 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 9354 Query: 290 ctccagccccggcgcgtattcgctcgccgcgtt 322 |||||| || || ||||| |||||||| ||||| Sbjct: 9355 ctccaggccaggtgcgtactcgctcgcagcgtt 9387
>dbj|AK065425.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013011N21, full insert sequence Length = 3809 Score = 97.6 bits (49), Expect = 2e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| ||||| Sbjct: 3080 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 3021 Query: 290 ctccagccccggcgcgtattcgctcgccgcgtt 322 |||||| || || ||||| |||||||| ||||| Sbjct: 3020 ctccaggccaggtgcgtactcgctcgcagcgtt 2988
>dbj|AK065029.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013001G17, full insert sequence Length = 3310 Score = 97.6 bits (49), Expect = 2e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| ||||| Sbjct: 3080 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 3021 Query: 290 ctccagccccggcgcgtattcgctcgccgcgtt 322 |||||| || || ||||| |||||||| ||||| Sbjct: 3020 ctccaggccaggtgcgtactcgctcgcagcgtt 2988
>dbj|AK062201.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-046-G07, full insert sequence Length = 1389 Score = 97.6 bits (49), Expect = 2e-17 Identities = 82/93 (88%) Strand = Plus / Minus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 ||||||||| ||||||||||||||||| || ||||||||||| || |||||||| ||||| Sbjct: 1159 aatctagcctgtgttctgcatgccggcagcaatgcccttcatcgtcaggatgagggtgtc 1100 Query: 290 ctccagccccggcgcgtattcgctcgccgcgtt 322 |||||| || || ||||| |||||||| ||||| Sbjct: 1099 ctccaggccaggtgcgtactcgctcgcagcgtt 1067
>emb|AJ318340.1|SSP318340 Saccharum hybrid cultivar R570 partial pepc gene for putative phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-1-2) Length = 714 Score = 95.6 bits (48), Expect = 1e-16 Identities = 117/140 (83%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||| |||||||||||| ||||||||||||||||| ||||| || |||||||| Sbjct: 582 ctagccggtgtcctgcatgccggcagcgatgcccttcatggtcaggatcagtgtgtcctc 523 Query: 293 cagccccggcgcgtattcgctcgccgcgttgagcttcaccagcgacgccggctggttctc 352 ||| || ||||| || |||||| | ||| |||| ||||||| || ||||| |||| Sbjct: 522 caggcctggcgcatactcgctctgctggttcagctgcaccagctctgctggctgactctc 463 Query: 353 gtcggcgaactccttggaca 372 ||||| |||||||||||||| Sbjct: 462 gtcggtgaactccttggaca 443
>emb|X61489.1|ZMPHOPCAR Zea mays pep gene for (C3 type) phosphoenolpyruvate carboxylase Length = 3213 Score = 91.7 bits (46), Expect = 2e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||| | |||||| || |||||||||||||| |||||||| ||||||||||||||| Sbjct: 2997 gtgttctggaggccggctgctatgcccttcatggtcaggatgagggtgtcctccagcccc 2938 Query: 300 ggcgcgtattcgct 313 || ||||||||||| Sbjct: 2937 ggtgcgtattcgct 2924
>ref|NM_188892.2| Oryza sativa (japonica cultivar-group), mRNA Length = 3158 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 2949 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2890 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 2889 agccccggcgcatactcactggtcgggttcagcttcaccagc 2848
>ref|XM_507204.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1484_G09.129-1 mRNA Length = 3539 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 3214 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 3155 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 3154 agccccggcgcatactcactggtcgggttcagcttcaccagc 3113
>emb|AJ312652.1|KPI312652 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform G Length = 1119 Score = 83.8 bits (42), Expect = 4e-13 Identities = 69/78 (88%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgcc 317 |||||||| |||||||| || ||||||||||||||||| ||||| ||||| ||||||| Sbjct: 1115 gcgatgcctttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctcgtg 1056 Query: 318 gcgttgagcttcaccagc 335 | |||||||||||||||| Sbjct: 1055 gtgttgagcttcaccagc 1038
>emb|AJ344058.1|KPI344058 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (ppc gene), isogene 7 Length = 1119 Score = 83.8 bits (42), Expect = 4e-13 Identities = 69/78 (88%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgcc 317 |||||||| |||||||| || ||||||||||||||||| ||||| ||||| ||||||| Sbjct: 1115 gcgatgcctttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctcgtg 1056 Query: 318 gcgttgagcttcaccagc 335 | |||||||||||||||| Sbjct: 1055 gtgttgagcttcaccagc 1038
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Plus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 16957794 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 16957853 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 16957854 agccccggcgcatactcactggtcgggttcagcttcaccagc 16957895
>dbj|AP003913.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC clone:OJ1484_G09 Length = 124695 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Plus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 104805 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 104864 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 104865 agccccggcgcatactcactggtcgggttcagcttcaccagc 104906
>dbj|AK073703.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033055B18, full insert sequence Length = 3538 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 3213 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 3154 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 3153 agccccggcgcatactcactggtcgggttcagcttcaccagc 3112
>dbj|AK070742.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023061C12, full insert sequence Length = 4317 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 4115 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 4056 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 4055 agccccggcgcatactcactggtcgggttcagcttcaccagc 4014
>dbj|AK067572.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013108G24, full insert sequence Length = 3158 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 2949 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2890 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 2889 agccccggcgcatactcactggtcgggttcagcttcaccagc 2848
>dbj|AK061683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-A07, full insert sequence Length = 1704 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 1505 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 1446 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 1445 agccccggcgcatactcactggtcgggttcagcttcaccagc 1404
>gb|AY187619.1| Oryza sativa (indica cultivar-group) phosphoenolpyruvate carboxylase (PEPC) mRNA, complete cds Length = 2981 Score = 83.8 bits (42), Expect = 4e-13 Identities = 87/102 (85%) Strand = Plus / Minus Query: 234 tagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcc 293 ||||| ||||||||||| || || || || ||||||||||| |||||||| ||||||||| Sbjct: 2955 tagccggtgttctgcattccagcagcaattcccttcatggtcaggatgagggtgtcctcc 2896 Query: 294 agccccggcgcgtattcgctcgccgcgttgagcttcaccagc 335 ||||||||||| || || || | || ||| |||||||||||| Sbjct: 2895 agccccggcgcatactcactggtcgggttcagcttcaccagc 2854
>emb|AJ318342.1|SSP318342 Saccharum hybrid cultivar R570 partial pepc gene for putative phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-2-1) Length = 573 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 252 ccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcg 311 ||||| || |||||||||||||| |||||||| ||||| ||||||||||| ||||||||| Sbjct: 471 ccggctgctatgcccttcatggtcaggatgagggtgtcttccagccccggtgcgtattcg 412 Query: 312 ctcgccgcgttgagcttcaccagc 335 || | | ||| |||||||||||| Sbjct: 411 ctgccagggttcagcttcaccagc 388
>gb|AY349322.1| Hordeum vulgare subsp. spontaneum NPGS PI 560559 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>gb|AY349321.1| Hordeum vulgare subsp. spontaneum NPGS PI 559556 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>gb|AY349316.1| Hordeum vulgare subsp. spontaneum NPGS PI 420916 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349312.1| Hordeum vulgare subsp. spontaneum NPGS PI 401371 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>gb|AY349311.1| Hordeum vulgare subsp. spontaneum NPGS PI 401370 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>gb|AY349310.1| Hordeum vulgare subsp. spontaneum NPGS PI 366446 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>gb|AY349308.1| Hordeum vulgare subsp. spontaneum NPGS PI 293411 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>gb|AY349306.1| Hordeum vulgare subsp. spontaneum NPGS PI 293402 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>gb|AY349304.1| Hordeum vulgare subsp. spontaneum NPGS PI 254894 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1153 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1140 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1081 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1080 ggcgcgtactcactcgccgggttcagcgtcac 1049
>gb|AY349303.1| Hordeum vulgare subsp. spontaneum NPGS PI 253933 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>gb|AY349302.1| Hordeum vulgare subsp. spontaneum NPGS PI 236388 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349298.1| Hordeum vulgare subsp. spontaneum NPGS PI 212305 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1151 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 1138 gtgttctgcaaaccggcagcaatgcccttcatggttaagatgagggtatcctccagcccc 1079 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1078 ggcgcgtactcactcgccgggttcagcgtcac 1047
>emb|AJ312627.1|VPL312627 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 4 Length = 1092 Score = 79.8 bits (40), Expect = 6e-12 Identities = 43/44 (97%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 1091 gcggcgatgcccttcatggtgaggatgagggtgtcctccagccc 1048
>emb|AJ318343.1|SSP318343 Saccharum hybrid cultivar R570 partial pepc gene for putative phosphoenolpyruvate carboxylase, exons 1-2, (PPCS-2-2) Length = 537 Score = 79.8 bits (40), Expect = 6e-12 Identities = 73/84 (86%) Strand = Plus / Minus Query: 252 ccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcg 311 ||||| || |||||||||||||| |||||||| ||||| ||||||||||| ||||||||| Sbjct: 478 ccggctgctatgcccttcatggtcaggatgagggtgtcttccagccccggtgcgtattcg 419 Query: 312 ctcgccgcgttgagcttcaccagc 335 || | | ||| |||||||||||| Sbjct: 418 ctgccagggttcagcttcaccagc 395
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| || || || |||||||||||||| |||||||| |||||||||||||| Sbjct: 8638305 gtgttctgcaaccctgcagcaatgcccttcatggtcaggatgagggtgtcctccagccct 8638364 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| ||||| ||| ||| |||||||| Sbjct: 8638365 ggcgcgtactcgctacccgggttcagcttcac 8638396
>dbj|AP005802.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBa0057D11 Length = 190790 Score = 79.8 bits (40), Expect = 6e-12 Identities = 79/92 (85%) Strand = Plus / Plus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| || || || |||||||||||||| |||||||| |||||||||||||| Sbjct: 68101 gtgttctgcaaccctgcagcaatgcccttcatggtcaggatgagggtgtcctccagccct 68160 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| ||||| ||| ||| |||||||| Sbjct: 68161 ggcgcgtactcgctacccgggttcagcttcac 68192
>emb|AJ312650.1|KPI312650 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform E Length = 1119 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 267 ttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgccgcgttgagc 326 |||||||| || ||||||||||||||||| ||||| ||||| ||||||| | ||||||| Sbjct: 1106 ttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctcgtggtgttgagc 1047 Query: 327 ttcaccagc 335 ||||||||| Sbjct: 1046 ttcaccagc 1038
>emb|AJ344056.1|KPI344056 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (ppc gene), isogene 5 Length = 1119 Score = 73.8 bits (37), Expect = 4e-10 Identities = 61/69 (88%) Strand = Plus / Minus Query: 267 ttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgccgcgttgagc 326 |||||||| || ||||||||||||||||| ||||| ||||| ||||||| | ||||||| Sbjct: 1106 ttcatggtcagaatgagcgtgtcctccagacccggagcgtactcgctcgtggtgttgagc 1047 Query: 327 ttcaccagc 335 ||||||||| Sbjct: 1046 ttcaccagc 1038
>gb|AY349319.1| Hordeum vulgare subsp. spontaneum NPGS PI 531853 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349318.1| Hordeum vulgare subsp. spontaneum NPGS PI 531851 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349317.1| Hordeum vulgare subsp. spontaneum NPGS PI 466460 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349315.1| Hordeum vulgare subsp. spontaneum NPGS PI 420913 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349314.1| Hordeum vulgare subsp. spontaneum NPGS PI 420911 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349313.1| Hordeum vulgare subsp. spontaneum NPGS PI 406276 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349309.1| Hordeum vulgare subsp. spontaneum NPGS PI 296926 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349307.1| Hordeum vulgare subsp. spontaneum NPGS PI 293409 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349305.1| Hordeum vulgare subsp. spontaneum NPGS PI 268242 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349301.1| Hordeum vulgare subsp. spontaneum NPGS PI 220523 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349299.1| Hordeum vulgare subsp. spontaneum NPGS PI 212306 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 71.9 bits (36), Expect = 1e-09 Identities = 78/92 (84%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 |||||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggcgcgtactcactcgccgggttcagcgtcac 1050
>emb|AJ007705.1|TAE7705 Triticum aestivum PEPC gene Length = 5845 Score = 71.9 bits (36), Expect = 1e-09 Identities = 69/80 (86%) Strand = Plus / Minus Query: 252 ccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcg 311 ||||| || |||||||||||||| | |||||| || |||||||||||||||||||| || Sbjct: 5540 ccggcagcaatgcccttcatggtcaagatgagggtatcctccagccccggcgcgtactca 5481 Query: 312 ctcgccgcgttgagcttcac 331 ||||||| ||| ||| |||| Sbjct: 5480 ctcgccgggttcagcgtcac 5461
>emb|AJ312626.1|VPL312626 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 1092 Score = 71.9 bits (36), Expect = 1e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 |||||||| |||||||||||||||||||| |||||||||||||| Sbjct: 1091 gcggcgatacccttcatggtgaggatgagggtgtcctccagccc 1048
>emb|AJ252929.1|VPAJ2929 Vanilla pompona partial mRNA for phosphoenolpyruvate carboxylase Length = 1092 Score = 71.9 bits (36), Expect = 1e-09 Identities = 42/44 (95%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 ||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 1091 gcggcgatgcctttcatggtgaggatgagggtgtcctccagccc 1048
>emb|AJ312663.1|MEX312663 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 4 Length = 1095 Score = 69.9 bits (35), Expect = 6e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||||||||||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1094 gcggcgatgcccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ312632.1|KDA312632 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 1 Length = 1092 Score = 69.9 bits (35), Expect = 6e-09 Identities = 53/59 (89%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||||||||||||||| |||||||| ||||||||||| || || || |||||||| Sbjct: 1091 gcggcgatgcccttcatggtcaggatgagggtgtcctccaggccaggggcatattcgct 1033
>emb|AJ252946.1|KGAJ2946 Kalanchoe gracilipes partial mRNA for phosphoenolpyruvate carboxylase Length = 1116 Score = 67.9 bits (34), Expect = 2e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||| |||||| ||||||||||||| |||||||| ||||||||||| Sbjct: 1103 tgcatgccagcggcgttgcccttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ252923.1|KSAJ2923 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate carboxylase Length = 1116 Score = 67.9 bits (34), Expect = 2e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||| ||||| |||||||||||||| |||||||| ||||||||||| Sbjct: 1103 tgcatgccagcggcaatgcccttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ231303.1|KSAJ1303 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate carboxylase Length = 1116 Score = 67.9 bits (34), Expect = 2e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||| ||||| |||||||||||||| |||||||| ||||||||||| Sbjct: 1103 tgcatgccagcggcaatgcccttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ231288.1|KGAJ1288 Kalanchoe gracilipes partial mRNA for phosphoenolpyruvate carboxylase Length = 1116 Score = 67.9 bits (34), Expect = 2e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||| |||||| ||||||||||||| |||||||| ||||||||||| Sbjct: 1103 tgcatgccagcggcgttgcccttcatggtcaggatgagggtgtcctccag 1054
>ref|NM_191306.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2901 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 ||||||||||| || || ||||||||||||||||| |||||||| |||||||| Sbjct: 2894 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 2842
>emb|AJ312680.1|KFE312680 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 1095 Score = 65.9 bits (33), Expect = 9e-08 Identities = 39/41 (95%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||||||||||||||| |||||||| ||||||||||| Sbjct: 1094 gcggcgatgcccttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ312624.1|VPL312624 Vanilla planifolia partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 1 Length = 1092 Score = 65.9 bits (33), Expect = 9e-08 Identities = 39/41 (95%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 ||||| |||||||||||||||||||| |||||||||||||| Sbjct: 1088 gcgatacccttcatggtgaggatgagggtgtcctccagccc 1048
>emb|AJ252928.1|VAAJ2928 Vanilla aphylla partial mRNA for phosphoenolpyruvate carboxylase Length = 1092 Score = 65.9 bits (33), Expect = 9e-08 Identities = 39/41 (95%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 ||||||||||||||||| |||||||| |||||||||||||| Sbjct: 1088 gcgatgcccttcatggttaggatgagggtgtcctccagccc 1048
>emb|AJ252924.1|KSAJ2924 Kalanchoe streptantha partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 65.9 bits (33), Expect = 9e-08 Identities = 39/41 (95%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||||||||||||||| |||||||| ||||||||||| Sbjct: 1094 gcggcgatgcccttcatggtcaggatgagggtgtcctccag 1054
>dbj|AP003409.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1131G08 Length = 158241 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Plus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 ||||||||||| || || ||||||||||||||||| |||||||| |||||||| Sbjct: 38881 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 38933
>dbj|AK101274.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033033B07, full insert sequence Length = 3056 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 ||||||||||| || || ||||||||||||||||| |||||||| |||||||| Sbjct: 2845 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 2793
>dbj|AK070480.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023049F03, full insert sequence Length = 2668 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 ||||||||||| || || ||||||||||||||||| |||||||| |||||||| Sbjct: 2456 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 2404
>dbj|AB055075.1| Oryza sativa (japonica cultivar-group) mRNA for phosphoenolpyruvate carboxylase, partial cds, clone:OsppcAUC-2 Length = 991 Score = 65.9 bits (33), Expect = 9e-08 Identities = 48/53 (90%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 ||||||||||| || || ||||||||||||||||| |||||||| |||||||| Sbjct: 791 gtgttctgcataccagcagcgatgcccttcatggtcaggatgagagtgtcctc 739
>gb|AY349320.1| Hordeum vulgare subsp. spontaneum NPGS PI 531957 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 63.9 bits (32), Expect = 3e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 || ||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggtgcgtactcactcgccgggttcagcgtcac 1050
>gb|AY349300.1| Hordeum vulgare subsp. spontaneum NPGS PI 219796 phosphoenolpyruvate carboxylase (Pepc) gene, exons 8, 9, 10, and partial cds Length = 1154 Score = 63.9 bits (32), Expect = 3e-07 Identities = 77/92 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || || ||||||||||| | |||||| || |||||||||||| Sbjct: 1141 gtgttctgcaaaccggcagcaattcccttcatggttaagatgagggtatcctccagcccc 1082 Query: 300 ggcgcgtattcgctcgccgcgttgagcttcac 331 || ||||| || ||||||| ||| ||| |||| Sbjct: 1081 ggtgcgtactcactcgccgggttcagcgtcac 1050
>emb|Y15897.1|TAPEPC Triticum aestivum mRNA for phosphoenolpyruvate carboxykinase, partial Length = 1148 Score = 63.9 bits (32), Expect = 3e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 |||||||||| ||||| || |||||||||||||| | |||||| || |||||||||||| Sbjct: 982 gtgttctgcagaccggcagcaatgcccttcatggtcaagatgagggtatcctccagcccc 923 Query: 300 ggcgcgta 307 || ||||| Sbjct: 922 ggtgcgta 915
>emb|X59925.1|SVPEPCG S.vulgare PEPC gene for phosphoenolpyruvate carboxylase Length = 6018 Score = 63.9 bits (32), Expect = 3e-07 Identities = 71/84 (84%) Strand = Plus / Minus Query: 252 ccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcg 311 ||||| || |||||||||||||| || ||||| ||||||||||||||||| || || ||| Sbjct: 5679 ccggctgctatgcccttcatggtcagaatgagggtgtcctccagccccggtgcatactcg 5620 Query: 312 ctcgccgcgttgagcttcaccagc 335 || | | ||| |||||||||||| Sbjct: 5619 ctgccagggttcagcttcaccagc 5596
>emb|AJ312644.1|MCR312644 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 5 Length = 1098 Score = 63.9 bits (32), Expect = 3e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 ||||||||||||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1094 gcgatgcccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1039
>emb|AJ252947.1|KPAJ2947 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase Length = 1116 Score = 63.9 bits (32), Expect = 3e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcg 305 |||||||| ||||||||||| ||||| || |||||||| ||||||||||| || || ||| Sbjct: 1103 tgcatgccagcggcgatgcctttcattgtcaggatgagggtgtcctccagaccaggagcg 1044 Query: 306 tattcgct 313 || ||||| Sbjct: 1043 tactcgct 1036
>emb|AJ231295.1|KPAJ1295 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase Length = 1116 Score = 63.9 bits (32), Expect = 3e-07 Identities = 59/68 (86%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcg 305 |||||||| ||||||||||| ||||| || |||||||| ||||||||||| || || ||| Sbjct: 1103 tgcatgccagcggcgatgcctttcattgtcaggatgagggtgtcctccagaccaggagcg 1044 Query: 306 tattcgct 313 || ||||| Sbjct: 1043 tactcgct 1036
>gb|AY517644.1| Chlamydomonas reinhardtii phosphoenolpyruvate carboxylase (Ppc1) mRNA, complete cds Length = 3902 Score = 63.9 bits (32), Expect = 3e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 237 cccgtgttctgcatgccggcggcgatgcccttcatggtga 276 ||||||||||||||||| |||||||||||||| ||||||| Sbjct: 2921 cccgtgttctgcatgcccgcggcgatgcccttgatggtga 2882
>emb|Z71976.1|FTPPCC F.trinervia ppcC gene (partial) Length = 692 Score = 61.9 bits (31), Expect = 1e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||||||||| || || ||||| ||||||||||| | |||||| ||||| ||||| ||| Sbjct: 107 gtgttctgcattcctgcagcgatacccttcatggtcaagatgagggtgtcttccagaccc 48 Query: 300 ggcgcgtattcgctc 314 || ||||| |||||| Sbjct: 47 ggggcgtactcgctc 33
>emb|AJ312681.1|KFE312681 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 4 Length = 714 Score = 61.9 bits (31), Expect = 1e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 ||||||||||| |||||||| |||||||| ||||||||||| || || || |||||||| Sbjct: 713 gcggcgatgcctttcatggtcaggatgagggtgtcctccaggccaggggcatattcgct 655
>emb|AJ312661.1|MEX312661 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 2 Length = 1095 Score = 61.9 bits (31), Expect = 1e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| ||||||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1094 gcggcgatacccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ400987.1|EST400987 Epidendrum stamfordianum partial mRNA for phosphoenolpyruvate carboxylase (ppc gene) Length = 1113 Score = 61.9 bits (31), Expect = 1e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| || || |||||||| |||||||||||||||||||| | || || ||||| || Sbjct: 1113 ctagccggtattttgcatgcctgcggcgatgcccttcatggtcaaaatcagggtgtcttc 1054 Query: 293 cagccccggcgcgta 307 |||||| |||||||| Sbjct: 1053 cagcccgggcgcgta 1039
>emb|AJ252921.1|KPAJ2921 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 61.9 bits (31), Expect = 1e-06 Identities = 52/59 (88%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| ||||||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1094 gcggcgatacccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ231294.1|PCAJ1294 Polytrichum commune partial mRNA for phosphoenolpyruvate carboxylase, clone pPC21.1 Length = 1110 Score = 61.9 bits (31), Expect = 1e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||||| || ||||||||||||||||| |||||||| |||||||| Sbjct: 1097 tgcatgccagcagcgatgcccttcatggtaaggatgagagtgtcctc 1051
>emb|AJ231280.1|BRAJ1280 Bucegia romanica partial mRNA for phosphoenolpyruvate carboxylase, clone pBR12.3 Length = 1104 Score = 61.9 bits (31), Expect = 1e-06 Identities = 43/47 (91%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||||| ||||||||||| ||||||||||| ||||| |||||||| Sbjct: 1091 tgcatgccagcggcgatgcctttcatggtgagaatgagagtgtcctc 1045
>gb|AF248080.1|AF248080 Flaveria trinervia phosphoenolpyruvate carboxylase (ppcC) mRNA, complete cds Length = 3372 Score = 61.9 bits (31), Expect = 1e-06 Identities = 64/75 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||||||||| || || ||||| ||||||||||| | |||||| ||||| ||||| ||| Sbjct: 3064 gtgttctgcattcctgcagcgatacccttcatggtcaagatgagggtgtcttccagaccc 3005 Query: 300 ggcgcgtattcgctc 314 || ||||| |||||| Sbjct: 3004 ggggcgtactcgctc 2990
>emb|AJ231284.1|DSAJ1284 Dicranum scoparium partial mRNA for phosphoenolpyruvate carboxylase, clone pDS23.3 Length = 1107 Score = 60.0 bits (30), Expect = 5e-06 Identities = 45/50 (90%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||| || || ||||| ||||||||||||||||| ||||||||||| Sbjct: 1094 tgcatgccagcagctatgcctttcatggtgaggatgagagtgtcctccag 1045
>emb|AJ312678.1|KFE312678 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 1 Length = 723 Score = 60.0 bits (30), Expect = 5e-06 Identities = 36/38 (94%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||||||||||||||| |||||||| ||||||||||| Sbjct: 719 gcgatgcccttcatggtcaggatgagggtgtcctccag 682
>emb|AJ312655.1|TUS312655 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 1089 Score = 60.0 bits (30), Expect = 5e-06 Identities = 48/54 (88%) Strand = Plus / Minus Query: 254 ggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 307 |||||||||||| |||||||| |||||||| |||||||||| || |||||||| Sbjct: 1089 ggcggcgatgcctttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1036
>emb|X91406.1|TUPPC T.usneoides mRNA for phosphoenolpyruvate decarboxylase Length = 2028 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 307 ||||| |||||||||||||| |||||||| |||||||||| || |||||||| Sbjct: 2027 gcggcaatgcccttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1975
>emb|AJ312682.1|KFE312682 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 5 Length = 1095 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 1094 gcggcgatgcctttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ312665.1|SAP312665 Solenangis aphylla partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 705 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 261 atgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 698 atgcccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 646
>emb|AJ312646.1|KPI312646 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform A Length = 1095 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 1094 gcggcgatgcctttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ312634.1|KDA312634 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 1095 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 1094 gcggcgatgcctttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ344052.1|KPI344052 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (ppc gene), isogene 1 Length = 1095 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||||||||| |||||||| |||||||| ||||||||||| Sbjct: 1094 gcggcgatgcctttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ252948.1|VPAJ2948 Vanilla phalaenopsis partial mRNA for phosphoenolpyruvate carboxylase Length = 1092 Score = 58.0 bits (29), Expect = 2e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 |||||||| ||||||||||||||||| |||||||| | |||||| || ||||| Sbjct: 1079 tgcatgccagcggcgatgcccttcattgtgaggatcaccgtgtcttcaagccc 1027
>emb|AJ252932.1|VPAJ2932 Vanilla phalaenopsis partial mRNA for phosphoenolpyruvate carboxylase Length = 1092 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 |||||||| |||||||| |||||||| |||||||||||||| Sbjct: 1088 gcgatgcctttcatggttaggatgagggtgtcctccagccc 1048
>emb|AJ252930.1|VPAJ2930 Vanilla phalaenopsis partial mRNA for phosphoenolpyruvate carboxylase Length = 1092 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 |||||||| |||||||| |||||||| |||||||||||||| Sbjct: 1088 gcgatgcctttcatggttaggatgagggtgtcctccagccc 1048
>emb|AJ252927.1|VAAJ2927 Vanilla aphylla partial mRNA for phosphoenolpyruvate carboxylase Length = 1086 Score = 58.0 bits (29), Expect = 2e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccc 298 ||||||||||||||||| |||||||| ||||| |||||||| Sbjct: 1082 gcgatgcccttcatggttaggatgagggtgtcttccagccc 1042
>gb|AF271161.2| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 1 mRNA, complete cds Length = 3368 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||||||||| || || || ||||||||||| | |||||| ||||||||||| Sbjct: 2965 gtgttctgcatgccagcagcaatacccttcatggtcaagatgagagtgtcctccag 2910
>emb|AJ312668.1|LBI312668 Leptotes bicolor partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 1 Length = 870 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 866 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 811
>emb|AJ312662.1|MEX312662 Microcoelia exilis partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 1095 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ312647.1|KPI312647 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform B Length = 1092 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| ||||||||||| ||||| ||||||||||| || || || |||||||| Sbjct: 1088 gcgatgcctttcatggtgagaatgagggtgtcctccaggccaggggcatattcgct 1033
>emb|AJ312635.1|KDA312635 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 4 Length = 1092 Score = 56.0 bits (28), Expect = 8e-05 Identities = 37/40 (92%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||||||||||||||| | |||||||||| Sbjct: 1091 gcggcgatgcccttcatggtgaggatcaaggtgtcctcca 1052
>emb|AJ312630.1|ACO312630 Ananas comosus partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 1089 Score = 56.0 bits (28), Expect = 8e-05 Identities = 67/80 (83%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctc 314 |||||||| ||||||||||| | |||||| ||||||||||| || || ||||| || || Sbjct: 1088 gcggcgatacccttcatggtcaagatgagggtgtcctccagtccgggggcgtactcactt 1029 Query: 315 gccgcgttgagcttcaccag 334 || | ||| ||||||||||| Sbjct: 1028 gcggggttcagcttcaccag 1009
>emb|AJ312628.1|ACO312628 Ananas comosus partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 2 Length = 1089 Score = 56.0 bits (28), Expect = 8e-05 Identities = 67/80 (83%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctc 314 |||||||| ||||||||||| | |||||| ||||||||||| || || ||||| || || Sbjct: 1088 gcggcgatccccttcatggtcaagatgagggtgtcctccagtccgggggcgtactcactt 1029 Query: 315 gccgcgttgagcttcaccag 334 || | ||| ||||||||||| Sbjct: 1028 gcggggttcagcttcaccag 1009
>emb|AJ312617.1|CRE312617 Cycas revoluta partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 2 Length = 1095 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ344053.1|KPI344053 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (ppc gene), isogene 2 Length = 1092 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| ||||||||||| ||||| ||||||||||| || || || |||||||| Sbjct: 1088 gcgatgcctttcatggtgagaatgagggtgtcctccaggccaggggcatattcgct 1033
>emb|AJ252922.1|KPAJ2922 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ252920.1|KPAJ2920 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ252919.1|KPAJ2919 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ252915.1|KKAJ2915 Kalanchoe kewensis partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 56.0 bits (28), Expect = 8e-05 Identities = 49/56 (87%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ231293.1|MHAJ1293 Mnium hornum partial mRNA for phosphoenolpyruvate carboxylase, clone pMH19.1 Length = 1116 Score = 56.0 bits (28), Expect = 8e-05 Identities = 40/44 (90%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 |||||||| |||||||| |||||||||||||| || |||||||| Sbjct: 1103 tgcatgccagcggcgatacccttcatggtgagaataagcgtgtc 1060
>emb|AJ312683.1|KFE312683 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 6 Length = 1092 Score = 54.0 bits (27), Expect = 3e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 ||||| ||||| |||||||| |||||||| ||||||||||| || || || |||||||| Sbjct: 1091 gcggctatgcctttcatggtcaggatgagggtgtcctccaggccaggggcatattcgct 1033
>emb|AJ312648.1|KPI312648 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform C Length = 1092 Score = 54.0 bits (27), Expect = 3e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| || ||||||||||| ||||| ||||||||||| || || || |||||||| Sbjct: 1091 gcggcgatacctttcatggtgagaatgagggtgtcctccaggccaggggcatattcgct 1033
>emb|AJ312641.1|MCR312641 Mesembryanthemum crystallinum partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 2 Length = 1098 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccgg 301 |||||||| || ||||||||||||||||| |||||||| || ||||| Sbjct: 1097 gcggcgatacctttcatggtgaggatgagtgtgtcctcaagacccgg 1051
>emb|AJ344054.1|KPI344054 Kalanchoe pinnata partial mRNA for phosphoenolpyruvate carboxylase (ppc gene), isogene 3 Length = 1092 Score = 54.0 bits (27), Expect = 3e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| || ||||||||||| ||||| ||||||||||| || || || |||||||| Sbjct: 1091 gcggcgatacctttcatggtgagaatgagggtgtcctccaggccaggggcatattcgct 1033
>emb|AJ252918.1|KGAJ2918 Kalanchoe grandiflora partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 54.0 bits (27), Expect = 3e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||| || |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1094 gcggcgatacctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ231296.1|PFAJ1296 Polytrichum formosum partial mRNA for phosphoenolpyruvate carboxylase, clone pPF20.1 Length = 1110 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||||| || |||||||||||||| || |||||||| |||||||| Sbjct: 1097 tgcatgccagcagcgatgcccttcattgtaaggatgagagtgtcctc 1051
>emb|AJ231289.1|LCAJ1289 Lunularia cruciata partial mRNA for phosphoenolpyruvate carboxylase, clone pLC13.8 Length = 1107 Score = 54.0 bits (27), Expect = 3e-04 Identities = 42/47 (89%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||||| || ||||| ||||||||||| |||||||| |||||||| Sbjct: 1094 tgcatgccagcagcgatacccttcatggtcaggatgagagtgtcctc 1048
>dbj|AP006654.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT31E21, TM0340, complete sequence Length = 120480 Score = 54.0 bits (27), Expect = 3e-04 Identities = 48/55 (87%) Strand = Plus / Plus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||| ||||||||||| || || |||||||||||||| ||||| ||||| |||| Sbjct: 103616 gtgttttgcatgccggcagcaatacccttcatggtgagaatgagggtgtcttcca 103670
>dbj|AB092821.1| Lotus japonicus LjPEPC2 mRNA for phosphoenolpyruvate carboxylase, complete cds Length = 3158 Score = 54.0 bits (27), Expect = 3e-04 Identities = 48/55 (87%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||| ||||||||||| || || |||||||||||||| ||||| ||||| |||| Sbjct: 2914 gtgttttgcatgccggcagcaatacccttcatggtgagaatgagggtgtcttcca 2860
>emb|X95856.1|NAPPC1 Neoregelia ampullacea mRNA for phosphoenolpyruvate carboxylase Length = 1104 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||| || |||||||| |||||||| | |||||| ||||||||||| Sbjct: 1091 tgcatgccagccgcgatgcctttcatggtcaagatgagggtgtcctccag 1042
>emb|X87149.1|VPPPCGE1 V.planifolia mRNA for phosphoenolpyruvate carboxylase, air roots Length = 3111 Score = 52.0 bits (26), Expect = 0.001 Identities = 53/62 (85%) Strand = Plus / Minus Query: 237 cccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagc 296 |||||||| ||||| || || || || |||||||| || |||||||| |||||||||||| Sbjct: 2867 cccgtgttttgcattccagctgctatccccttcattgtaaggatgagggtgtcctccagc 2808 Query: 297 cc 298 || Sbjct: 2807 cc 2806
>emb|X14588.1|MCPPCB Mesembryanthemum crystallinum ppc2 gene for phosphoenolpyruvate carboxylase (EC 4.1.1.31) Length = 8050 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 ||||||||||| || || || || |||||||||||||||||||| ||||| Sbjct: 7582 gtgttctgcattccagctgcaatacccttcatggtgaggatgagtgtgtc 7533
>emb|AJ312670.1|LBI312670 Leptotes bicolor partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 1092 Score = 52.0 bits (26), Expect = 0.001 Identities = 62/74 (83%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgctcgcc 317 |||||||| ||||| || |||||||| |||||||||||||| || || || ||||| | Sbjct: 1088 gcgatgcctttcattgtcaggatgagggtgtcctccagcccaggagcatactcgcttgtg 1029 Query: 318 gcgttgagcttcac 331 | |||||||||||| Sbjct: 1028 gggttgagcttcac 1015
>emb|AJ312654.1|TUS312654 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 2 Length = 1089 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 307 ||||| ||||||||||| |||||||| |||||||||| || |||||||| Sbjct: 1085 gcgatacccttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1036
>emb|AJ312653.1|TUS312653 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 1 Length = 1089 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 307 ||||| ||||||||||| |||||||| |||||||||| || |||||||| Sbjct: 1085 gcgatacccttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1036
>emb|AJ300742.1|PAM300742 Phalaenopsis amabilis partial ppc gene for phosphoenolpyruvate carboxylase Length = 2898 Score = 52.0 bits (26), Expect = 0.001 Identities = 56/66 (84%) Strand = Plus / Minus Query: 233 ctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||| |||||||||||||| || || || || ||||||| |||||||| || ||||| Sbjct: 2898 ctagccggtgttctgcatgccagcagcaatacctttcatggccaggatgagggtatcctc 2839 Query: 293 cagccc 298 |||||| Sbjct: 2838 cagccc 2833
>emb|AJ252926.1|KPAJ2926 Kalanchoe petitiana partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 52.0 bits (26), Expect = 0.001 Identities = 35/38 (92%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||| |||||||| |||||||| ||||||||||| Sbjct: 1091 gcgatgcctttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ252914.1|KKAJ2914 Kalanchoe kewensis partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 52.0 bits (26), Expect = 0.001 Identities = 44/50 (88%) Strand = Plus / Minus Query: 264 cccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 ||||||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1085 cccttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ231290.1|LJAJ1290 Leucobryum juniperoideum partial mRNA for phosphoenolpyruvate carboxylase, clone pLU24.2 Length = 1119 Score = 52.0 bits (26), Expect = 0.001 Identities = 50/58 (86%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcg 303 |||||||| || || ||||||||||| || |||||||| |||||||| ||||| |||| Sbjct: 1106 tgcatgccagcagctatgcccttcattgtaaggatgagggtgtcctcgagcccgggcg 1049
>emb|Z48966.1|FPPPCAMR F.pringlei ppcA mRNA for phosphoenolpyruvate carboxylase Length = 3256 Score = 50.1 bits (25), Expect = 0.005 Identities = 55/65 (84%) Strand = Plus / Minus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 |||||| || ||||||||||| || || || || || |||||||| | |||||||||||| Sbjct: 3039 aatctaaccggtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtc 2980 Query: 290 ctcca 294 ||||| Sbjct: 2979 ctcca 2975
>emb|X64144.2|FPPPCA Flaveria pringlei ppcA1 gene for phosphoenolpyruvate carboxylase Length = 10108 Score = 50.1 bits (25), Expect = 0.005 Identities = 55/65 (84%) Strand = Plus / Minus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 |||||| || ||||||||||| || || || || || |||||||| | |||||||||||| Sbjct: 9625 aatctaaccggtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtc 9566 Query: 290 ctcca 294 ||||| Sbjct: 9565 ctcca 9561 Score = 50.1 bits (25), Expect = 0.005 Identities = 55/65 (84%) Strand = Plus / Minus Query: 230 aatctagcccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 |||||| || ||||||||||| || || || || || |||||||| | |||||||||||| Sbjct: 8561 aatctaaccggtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtc 8502 Query: 290 ctcca 294 ||||| Sbjct: 8501 ctcca 8497
>emb|AJ312660.1|ETI312660 Euphorbia tirucalli partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 4 Length = 1095 Score = 50.1 bits (25), Expect = 0.005 Identities = 37/41 (90%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||| ||||| |||||||| |||||||| ||||||||||| Sbjct: 1094 gcggcaatgcctttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ312656.1|TUS312656 Tillandsia usneoides partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 4 Length = 1089 Score = 50.1 bits (25), Expect = 0.005 Identities = 46/53 (86%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgta 307 ||||| || ||||||||||| |||||||| |||||||||| || |||||||| Sbjct: 1088 gcggcaatccccttcatggtcaggatgagggtgtcctccaatccgggcgcgta 1036
>emb|AJ312638.1|CUV312638 Clusia uvitana partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 3 Length = 1092 Score = 50.1 bits (25), Expect = 0.005 Identities = 34/37 (91%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||||||||| | |||||| |||||||||| Sbjct: 1088 gcgatgcccttcatggtcaagatgagggtgtcctcca 1052
>emb|AJ252945.1|KGAJ2945 Kalanchoe grandiflora partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 50.1 bits (25), Expect = 0.005 Identities = 46/53 (86%) Strand = Plus / Minus Query: 261 atgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 ||||| |||||||| |||||||| ||||||||||| || || ||||| ||||| Sbjct: 1088 atgcctttcatggtcaggatgagggtgtcctccagaccaggagcgtactcgct 1036
>emb|AJ231291.1|LPAJ1291 Leptobryum pyriforme partial mRNA for phosphoenolpyruvate carboxylase, clone pLP1.1 Length = 1101 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||| || ||||| || |||||||||||||||| |||||||||| Sbjct: 1088 tgcatgccagcagcgatccctttcatggtgaggatgacggtgtcctcca 1040
>emb|AJ231283.1|DHAJ1283 Dicranella heteromalla partial mRNA for phosphoenolpyruvate carboxylase, clone pDH18.3 Length = 1206 Score = 50.1 bits (25), Expect = 0.005 Identities = 43/49 (87%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||| |||||||| || |||||||||||||| | |||||||||| Sbjct: 1193 tgcatgccagcggcgatacctttcatggtgaggatcacggtgtcctcca 1145
>dbj|AB078718.1| Nicotiana sylvestris Nsppc1 gene for phosphoenolpyruvate carboxylase, partial cds Length = 4589 Score = 50.1 bits (25), Expect = 0.005 Identities = 73/89 (82%) Strand = Plus / Minus Query: 243 ttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggc 302 |||||||| || || || || ||||||||||| | |||||| |||||||||| || || Sbjct: 4055 ttctgcattccagcagcaatacccttcatggtcaagatgagtgtgtcctccaagccaggg 3996 Query: 303 gcgtattcgctcgccgcgttgagcttcac 331 ||||||||||| | || ||| |||||||| Sbjct: 3995 gcgtattcgctagtcgggttcagcttcac 3967
>emb|AJ001028.1|KFPEPC458 Kalanchoe fedtschenkoi mRNA for phosphoenolpyruvate carboxylase (458bp) Length = 458 Score = 50.1 bits (25), Expect = 0.005 Identities = 37/41 (90%) Strand = Plus / Plus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||| || |||||||| |||||||| ||||||||||| Sbjct: 1 gcggcgatacctttcatggtcaggatgagggtgtcctccag 41
>gb|AF271163.1| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 3 mRNA, complete cds Length = 3218 Score = 48.1 bits (24), Expect = 0.020 Identities = 48/56 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||| |||||||| || || || ||||||||||| | |||||| ||||||||||| Sbjct: 2956 gtgttttgcatgccagcagcaatacccttcatggtcaagatgagagtgtcctccag 2901
>gb|AF271162.1| Hydrilla verticillata phosphoenolpyruvate carboxylase isoform 2 mRNA, complete cds Length = 3212 Score = 48.1 bits (24), Expect = 0.020 Identities = 48/56 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccag 295 |||||||||||||| || || || |||||||| || | |||||| ||||||||||| Sbjct: 2961 gtgttctgcatgccagcagcaatacccttcatagtcaagatgagggtgtcctccag 2906
>emb|X87821.1|KBRNAPCC4 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase (Kb4) Length = 1092 Score = 48.1 bits (24), Expect = 0.020 Identities = 48/56 (85%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||||||||| || || ||||| ||||||||||| || || || |||||||| Sbjct: 1088 gcgatgcccttcattgtcagaatgagggtgtcctccaggccaggggcatattcgct 1033
>emb|X87820.1|KBRNAPPC3 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase (Kb3) Length = 1092 Score = 48.1 bits (24), Expect = 0.020 Identities = 48/56 (85%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 |||||||||||||| || || ||||| ||||||||||| || || || |||||||| Sbjct: 1088 gcgatgcccttcattgtcagaatgagggtgtcctccaggccaggggcatattcgct 1033
>gb|DQ320105.1| Clusia minor phosphoenolpyruvate carboxylase (pepc) mRNA, partial cds Length = 1092 Score = 48.1 bits (24), Expect = 0.020 Identities = 36/40 (90%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||| |||||||| | |||||| |||||||||| Sbjct: 1091 gcggcgatgcctttcatggtcaagatgagggtgtcctcca 1052
>emb|AJ312637.1|CUV312637 Clusia uvitana partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 2 Length = 1092 Score = 48.1 bits (24), Expect = 0.020 Identities = 36/40 (90%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||| |||||||| | |||||| |||||||||| Sbjct: 1091 gcggcgatgcctttcatggtcaagatgagggtgtcctcca 1052
>emb|AJ252917.1|KTAJ2917 Kalanchoe tomentosa partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 48.1 bits (24), Expect = 0.020 Identities = 36/40 (90%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||| ||||||||||| || ||||| |||||||||| Sbjct: 1094 gcggcgatacccttcatggtcagtatgagggtgtcctcca 1055
>emb|AJ252916.1|KTAJ2916 Kalanchoe tomentosa partial mRNA for phosphoenolpyruvate carboxylase Length = 1095 Score = 48.1 bits (24), Expect = 0.020 Identities = 36/40 (90%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||| ||||||||||| || ||||| |||||||||| Sbjct: 1094 gcggcgatccccttcatggtcagtatgagggtgtcctcca 1055
>emb|AJ231292.1|MCAJ1292 Marchantia calcarata partial mRNA for phosphoenolpyruvate carboxylase, clone pMC14.1 Length = 1107 Score = 48.1 bits (24), Expect = 0.020 Identities = 48/56 (85%) Strand = Plus / Minus Query: 237 cccgtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 ||||| || |||||||| || || ||||| ||||| ||||||||||| |||||||| Sbjct: 1103 cccgtattttgcatgccagctgctatgcctttcattgtgaggatgagagtgtcctc 1048
>emb|BX511072.8| Zebrafish DNA sequence from clone CH211-63A11 in linkage group 12, complete sequence Length = 165932 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 86 attttatttttatttctcaaaaca 109 |||||||||||||||||||||||| Sbjct: 48267 attttatttttatttctcaaaaca 48290
>emb|BX682557.11| Zebrafish DNA sequence from clone DKEY-288D17 in linkage group 3, complete sequence Length = 103591 Score = 48.1 bits (24), Expect = 0.020 Identities = 24/24 (100%) Strand = Plus / Plus Query: 86 attttatttttatttctcaaaaca 109 |||||||||||||||||||||||| Sbjct: 44865 attttatttttatttctcaaaaca 44888
>gb|AY663388.1| Lupinus albus phosphoenolpyruvate carboxylase 4 mRNA, complete cds Length = 3288 Score = 48.1 bits (24), Expect = 0.020 Identities = 39/44 (88%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgag 283 |||||||||||||| || || || |||||||||||||| ||||| Sbjct: 3033 gtgttctgcatgccagcagcaatacccttcatggtgagaatgag 2990
>emb|AM237200.1| Lupinus luteus mRNA for phosphoenolpyrovate carboxylase (pepc2 gene) Length = 2907 Score = 48.1 bits (24), Expect = 0.020 Identities = 39/44 (88%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgag 283 |||||||||||||| || || || |||||||||||||| ||||| Sbjct: 2900 gtgttctgcatgccagcagcaatacccttcatggtgagaatgag 2857
>ref|NM_180042.1| Arabidopsis thaliana ATPPC2 (PHOSPHOENOLPYRUVATE CARBOXYLASE 2); phosphoenolpyruvate carboxylase AT2G42600 (ATPPC2) transcript variant AT2G42600.2 mRNA, complete cds Length = 3309 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || ||| Sbjct: 3085 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 3026 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 3025 ggtgcgtattc 3015
>ref|NM_180041.1| Arabidopsis thaliana ATPPC2 (PHOSPHOENOLPYRUVATE CARBOXYLASE 2); phosphoenolpyruvate carboxylase AT2G42600 (ATPPC2) transcript variant AT2G42600.1 mRNA, complete cds Length = 3414 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || ||| Sbjct: 3190 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 3131 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 3130 ggtgcgtattc 3120
>emb|CR356245.25| Zebrafish DNA sequence from clone CH211-257I15 in linkage group 8, complete sequence Length = 153042 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 111235 attttatttttatttctcaaaac 111213
>emb|CR759774.13| Zebrafish DNA sequence from clone CH211-147P17 in linkage group 18, complete sequence Length = 149156 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Plus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 92298 attttatttttatttctcaaaac 92320
>gb|AC125474.16| Medicago truncatula clone mth2-16l11, complete sequence Length = 127369 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || ||||||||||| || ||||| ||||| |||| Sbjct: 47576 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 47522
>emb|CR405713.7| Zebrafish DNA sequence from clone DKEY-12D5 in linkage group 8, complete sequence Length = 99181 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 84135 attttatttttatttctcaaaac 84113
>gb|AY074346.2| Arabidopsis thaliana At2g42600 mRNA sequence Length = 3342 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || ||| Sbjct: 3191 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 3132 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 3131 ggtgcgtattc 3121
>emb|Z71974.1|FTPPCB F.trinervia ppcB gene (partial) Length = 814 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||| || || || || ||||||||||| | |||||| |||||||||| Sbjct: 196 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 142
>emb|Z71973.1|FPPPCB F.pringlei ppcB gene (partial) Length = 714 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||| || || || || ||||||||||| | |||||| |||||||||| Sbjct: 196 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 142
>emb|Z25853.1|FAPHOCAR F.australasica mRNA for phosphoenolpyruvate carboxylase Length = 3169 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||| || || || || || |||||||| | ||||||||||||||||| Sbjct: 2928 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 2874
>emb|X95861.1|VPPPC1 Vanilla planifolia mRNA for phosphoenolpyruvate carboxylase Length = 1089 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Minus Query: 264 cccttcatggtgaggatgagcgtgtcctccagccc 298 |||||||| || |||||||| |||||||||||||| Sbjct: 1079 cccttcattgtaaggatgagggtgtcctccagccc 1045
>emb|X64143.2|FTPPCA Flaveria trinervia ppcA1 gene for phosphoenolpyruvate carboxylase Length = 9015 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||| || || || || || |||||||| | ||||||||||||||||| Sbjct: 8291 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 8237
>emb|X61304.1|FTPEPC F.trinervia mRNA for phosphoenolpyruvate carboxylase Length = 3174 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||| || || || || || |||||||| | ||||||||||||||||| Sbjct: 2938 gtgttctgcattccagcagcaatccctttcatggtcaagatgagcgtgtcctcca 2884
>emb|AJ312675.1|PLO312675 Pyrrosia longifolia partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 1 Length = 1071 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 261 atgcccttcatggtgaggatgag 283 ||||||||||||||||||||||| Sbjct: 1064 atgcccttcatggtgaggatgag 1042
>emb|AJ312633.1|KDA312633 Kalanchoe daigremontiana partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 2 Length = 1092 Score = 46.1 bits (23), Expect = 0.080 Identities = 50/59 (84%) Strand = Plus / Minus Query: 255 gcggcgatgcccttcatggtgaggatgagcgtgtcctccagccccggcgcgtattcgct 313 ||||| ||||| ||||| || |||||||| ||||||||||| || || || |||||||| Sbjct: 1091 gcggctatgcctttcattgtcaggatgagggtgtcctccaggccaggggcatattcgct 1033
>emb|AJ532902.1|ATH532902 Arabidopsis thaliana mRNA for phosphoenolpyruvate carboxylase (ppc2 gene) Length = 2892 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || ||| Sbjct: 2885 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 2826 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 2825 ggtgcgtattc 2815
>emb|AJ417435.1|CSA417435 Cucumis sativus partial mRNA for phosphoenolpyruvate carboxylase (pepc1 gene) Length = 932 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||||||||| || || || || ||||||||||| | ||| || |||||||| ||||| Sbjct: 590 gtgttctgcattccagcagcaatacccttcatggtcaagatcagggtgtcctctagccca 531 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 530 ggtgcgtattc 520
>emb|AJ286750.1|SRO286750 Sesbania rostrata mRNA for phosphoenolpyruvate carboxylase (pepc gene) Length = 3344 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || |||||||| ||||| ||||| ||||| |||| Sbjct: 3012 gtgttctgcatgccagctgcaatacccttcatagtgagaatgagggtgtcttcca 2958
>emb|AJ231297.1|PQAJ1297 Preissia quadrata partial mRNA for phosphoenolpyruvate carboxylase, clone pPQ29.2 Length = 1104 Score = 46.1 bits (23), Expect = 0.080 Identities = 41/47 (87%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctc 292 |||||||| || ||||| ||||||||||||| ||||| |||||||| Sbjct: 1091 tgcatgccagcagcgatacccttcatggtgataatgagagtgtcctc 1045
>emb|AJ231281.1|BSAJ1281 Brachythecium salebrosum partial mRNA for phosphoenolpyruvate carboxylase, clone pBS26.3 Length = 1116 Score = 46.1 bits (23), Expect = 0.080 Identities = 32/35 (91%) Strand = Plus / Minus Query: 246 tgcatgccggcggcgatgcccttcatggtgaggat 280 |||||||| || ||||||||||||||||| ||||| Sbjct: 1103 tgcatgcccgcagcgatgcccttcatggtaaggat 1069
>emb|AJ011302.1|VFA011302 Vicia faba mRNA for phosphoenolpyruvate-carboxylase, pepc1 isoform Length = 3152 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || ||||||||||| || ||||| ||||| |||| Sbjct: 2911 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 2857
>emb|BX908769.7| Zebrafish DNA sequence from clone DKEY-78I1 in linkage group 13, complete sequence Length = 68094 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 5178 tatacattattttcaagattttatttt 5152
>emb|BX324226.16| Zebrafish DNA sequence from clone DKEY-202B10 in linkage group 5, complete sequence Length = 121419 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 30366 tatacattattttcaagattttatttt 30392 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 8953 tatacattattttcaagattttatttt 8979
>emb|BX510990.32| Zebrafish DNA sequence from clone CH211-67F13 in linkage group 13, complete sequence Length = 210138 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 128511 attttatttttatttctcaaaac 128489
>gb|AC007087.7| Arabidopsis thaliana chromosome 2 clone F14N22 map mi551, complete sequence Length = 96685 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || ||| Sbjct: 51278 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 51219 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 51218 ggtgcgtattc 51208
>gb|AC104533.3| Homo sapiens chromosome 19 clone LLNLR-276C7, complete sequence Length = 32074 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 85 gattttatttttatttctcaaaa 107 ||||||||||||||||||||||| Sbjct: 24079 gattttatttttatttctcaaaa 24057
>emb|BX001025.23| Zebrafish DNA sequence from clone CH211-240D20, complete sequence Length = 179475 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 38237 tatacattattttcaagattttatttt 38263 Score = 40.1 bits (20), Expect = 5.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 72 acattattttcacgattttatttt 95 |||||||||||| ||||||||||| Sbjct: 20591 acattattttcaagattttatttt 20614
>emb|BX511164.11| Zebrafish DNA sequence from clone DKEY-63J1 in linkage group 19, complete sequence Length = 214001 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 174758 tatacattattttcaagattttatttt 174732 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Minus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 163265 tatacattattttcaagattttatttt 163239
>gb|AC004597.1|AC004597 Homo sapiens chromosome 19, cosmid F20722, complete sequence Length = 43310 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 85 gattttatttttatttctcaaaa 107 ||||||||||||||||||||||| Sbjct: 7233 gattttatttttatttctcaaaa 7211
>emb|BX248115.12| Zebrafish DNA sequence from clone CH211-208K15 in linkage group 16, complete sequence Length = 211852 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Plus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 127950 attttatttttatttctcaaaac 127972
>gb|AF288382.1|AF288382 Phaseolus vulgaris phosphoenolpyruvate carboxylase mRNA, complete cds Length = 3289 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || |||||||| ||||| ||||| ||||| |||| Sbjct: 2974 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagggtgtcttcca 2920
>emb|BX821882.1|CNS0A9A6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL81ZG02 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 582 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || ||| Sbjct: 444 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 385 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 384 ggtgcgtattc 374
>gb|AF248079.1|AF248079 Flaveria trinervia phosphoenolpyruvate carboxylase (ppcB) mRNA, complete cds Length = 3266 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 ||||||||||| || || || || ||||||||||| | |||||| |||||||||| Sbjct: 2991 gtgttctgcattccagcagcaatccccttcatggtcaagatgagtgtgtcctcca 2937
>emb|BX255962.9| Zebrafish DNA sequence from clone CH211-269C21 in linkage group 25, complete sequence Length = 151830 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 27895 attttatttttatttctcaaaac 27873
>emb|BX510916.7| Zebrafish DNA sequence from clone DKEY-208B17 in linkage group 5, complete sequence Length = 174866 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 171266 tatacattattttcaagattttatttt 171292 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 160716 tatacattattttcaagattttatttt 160742
>emb|BX005129.6| Zebrafish DNA sequence from clone CH211-241D24 in linkage group 6, complete sequence Length = 166885 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 70950 tatacattattttcaagattttatttt 70976 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 59578 tatacattattttcaagattttatttt 59604 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 39197 tatacattattttcaagattttatttt 39223 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 28805 tatacattattttcaagattttatttt 28831
>dbj|AB097087.1| Glycine max GmPEPC15 gene for phosphoenolpyruvate carboxylase, complete cds Length = 7205 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || |||||||| ||||| ||||| ||||| |||| Sbjct: 7083 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagtgtgtcttcca 7029
>emb|BX957233.8| Zebrafish DNA sequence from clone DKEY-224H10 in linkage group 18, complete sequence Length = 68884 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 56889 attttatttttatttctcaaaac 56867
>gb|AF145301.1|AF145301 Arabidopsis thaliana 14-3-3 protein GF14 mu (GRF9) gene, complete cds Length = 3604 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || ||| Sbjct: 235 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 176 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 175 ggtgcgtattc 165
>gb|AF135371.1|AF135371 Lotus corniculatus phosphoenol pyruvate carboxylase mRNA, complete cds Length = 3184 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || |||||||||||||| || || ||||| |||| Sbjct: 2936 gtgttctgcatgccagcagcaattcccttcatggtgagaatcagggtgtcttcca 2882
>emb|AM235211.1| Lupinus luteus mRNA for phosphoenolpyruvate carboxylase (PEPC1 gene), clone LUP1 Length = 2904 Score = 46.1 bits (23), Expect = 0.080 Identities = 29/31 (93%) Strand = Plus / Minus Query: 264 cccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||||||||| ||||| |||| Sbjct: 2873 cccttcatggtgaggatgagggtgtcttcca 2843
>gb|AY210895.1| Arabidopsis thaliana phosphoenolpyruvate carboxylase mRNA, complete cds Length = 3178 Score = 46.1 bits (23), Expect = 0.080 Identities = 59/71 (83%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctccagcccc 299 ||||| ||||| || || ||||| ||||||||||||||||| | ||| || || || ||| Sbjct: 3054 gtgttttgcataccagcagcgatacccttcatggtgaggataaccgtatcttcaagtccc 2995 Query: 300 ggcgcgtattc 310 || |||||||| Sbjct: 2994 ggtgcgtattc 2984
>dbj|D13998.1|SOYPEPC Glycine max gmppc1 mRNA for phosphoenolpyruvate carboxylase, complete cds Length = 3048 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || |||||||| ||||| ||||| ||||| |||| Sbjct: 2924 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagtgtgtcttcca 2870
>emb|CR352262.23| Zebrafish DNA sequence from clone DKEY-39F23 in linkage group 24, complete sequence Length = 223466 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Minus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 41443 attttatttttatttctcaaaac 41421
>emb|CR759821.9| Zebrafish DNA sequence from clone DKEY-190C14 in linkage group 5, complete sequence Length = 169089 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 167715 tatacattattttcaagattttatttt 167741 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 157169 tatacattattttcaagattttatttt 157195 Score = 46.1 bits (23), Expect = 0.080 Identities = 26/27 (96%) Strand = Plus / Plus Query: 69 tatacattattttcacgattttatttt 95 ||||||||||||||| ||||||||||| Sbjct: 146626 tatacattattttcaagattttatttt 146652
>emb|BX936386.9| Zebrafish DNA sequence from clone CH211-232P21 in linkage group 3, complete sequence Length = 158520 Score = 46.1 bits (23), Expect = 0.080 Identities = 23/23 (100%) Strand = Plus / Plus Query: 86 attttatttttatttctcaaaac 108 ||||||||||||||||||||||| Sbjct: 24694 attttatttttatttctcaaaac 24716
>gb|M83086.1|ALFPPPCA Medicago sativa phosphoenolpyruvate carboxylase mRNA, complete cds Length = 3317 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || ||||||||||| || ||||| ||||| |||| Sbjct: 2999 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 2945
>gb|L39371.1|ALFPEPC Medicago sativa phosphoenolpyruvate carboxylase (PEPC) gene, complete cds Length = 7490 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || ||||||||||| || ||||| ||||| |||| Sbjct: 6941 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 6887
>dbj|D64037.1|PEASPARKLE Pea mRNA for phosphoenolpyruvate carboxylase, complete cds Length = 3212 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || ||||||||||| || ||||| ||||| |||| Sbjct: 2986 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtcttcca 2932
>dbj|AB008542.1| Glycine max mRNA for phosphoenolpyruvate carboxylase, partial cds, clone:GmPEPC15 Length = 292 Score = 46.1 bits (23), Expect = 0.080 Identities = 47/55 (85%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtcctcca 294 |||||||||||||| || || || |||||||| ||||| ||||| ||||| |||| Sbjct: 114 gtgttctgcatgccagcagcaatacccttcatagtgagaatgagtgtgtcttcca 60
>gb|AY830136.1| Synechococcus sp. PCC 7002 phosphoenolpyruvate carboxylase (pepc) gene, complete cds Length = 2988 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 237 cccgtgttctgcatgccggcggcgatgcccttcatggt 274 ||||||||| |||| |||||||||||||| || ||||| Sbjct: 2984 cccgtgttccgcattccggcggcgatgccattgatggt 2947
>gb|AC163492.3| Mus musculus chromosome 18, clone RP23-411L20, complete sequence Length = 201822 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 85 gattttatttttatttctcaaa 106 |||||||||||||||||||||| Sbjct: 48092 gattttatttttatttctcaaa 48113
>gb|AC102432.9| Mus musculus chromosome 19, clone RP24-114A21, complete sequence Length = 199240 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 atttttatttctcaaaacaaaa 112 |||||||||||||||||||||| Sbjct: 173384 atttttatttctcaaaacaaaa 173405 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 91 atttttatttctcaaaacaaaa 112 |||||||||||||||||||||| Sbjct: 173250 atttttatttctcaaaacaaaa 173271
>gb|AC025260.29| Homo sapiens 12 BAC RP11-356O22 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 164872 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 86 attttatttttatttctcaaaa 107 |||||||||||||||||||||| Sbjct: 33043 attttatttttatttctcaaaa 33022
>gb|AC121246.28| Medicago truncatula clone mth2-35m8, complete sequence Length = 124137 Score = 44.1 bits (22), Expect = 0.32 Identities = 43/50 (86%) Strand = Plus / Minus Query: 240 gtgttctgcatgccggcggcgatgcccttcatggtgaggatgagcgtgtc 289 |||||||||||||| || || || ||||||||||| || ||||| ||||| Sbjct: 104197 gtgttctgcatgccagcagcaatacccttcatggtaagaatgagtgtgtc 104148
>emb|BX901897.6| Zebrafish DNA sequence from clone DKEY-115H20 in linkage group 1, complete sequence Length = 180979 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 87 ttttatttttatttctcaaaac 108 |||||||||||||||||||||| Sbjct: 99639 ttttatttttatttctcaaaac 99660
>emb|Z99758.8|HS800F24 Human DNA sequence from clone RP4-800F24 on chromosome 1q24 Contains part of the NME7 gene for protein expressed in non-metastatic cells 7 (nucleoside-diphosphate kinase) and a novel gene, complete sequence Length = 140788 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Plus Query: 85 gattttatttttatttctcaaa 106 |||||||||||||||||||||| Sbjct: 12357 gattttatttttatttctcaaa 12378
>emb|AL353787.21| Human DNA sequence from clone RP11-667H17 on chromosome 9 Contains the 5' end of the SLC28A3 gene for solute carrier family 28 (sodium-coupled nucleoside transporter), member 3, (CNT3), complete sequence Length = 83639 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 88 tttatttttatttctcaaaaca 109 |||||||||||||||||||||| Sbjct: 8908 tttatttttatttctcaaaaca 8887
>emb|AL136109.11| Human DNA sequence from clone RP5-924G13 on chromosome 1 Contains a novel gene (KIAA1221) and a ribosomal protein L5 (RPL5) pseudogene, complete sequence Length = 126367 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 86 attttatttttatttctcaaaa 107 |||||||||||||||||||||| Sbjct: 12561 attttatttttatttctcaaaa 12540
>emb|AL138815.6| Human DNA sequence from clone RP11-141F12 on chromosome 13 Contains part of the ATP8A2 gene for ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2 (ML-1 protein (IB, ATP, ML-1, ATPIB, DKFZP434B1913)), a novel pseudogene and a CpG island, complete sequence Length = 160210 Score = 44.1 bits (22), Expect = 0.32 Identities = 22/22 (100%) Strand = Plus / Minus Query: 85 gattttatttttatttctcaaa 106 |||||||||||||||||||||| Sbjct: 121599 gattttatttttatttctcaaa 121578
>emb|X91634.1|VAPPCGENE V.aphylla mRNA for phosphoenolpyruvate carboxylase Length = 1086 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 261 atgcccttcatggtgaggatgagcgtgtcctccagccc 298 |||||||||||||| ||||| || ||||| |||||||| Sbjct: 1079 atgcccttcatggtaaggataagggtgtcttccagccc 1042
>emb|X87819.1|KBRNAPPC2 K.blossfeldiana mRNA for phosphoenolpyruvate carboxylase (Kb2) Length = 1095 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||| || |||||||| |||||||| ||||||||||| Sbjct: 1091 gcgatacctttcatggtcaggatgagggtgtcctccag 1054
>emb|AJ312679.1|KFE312679 Kalanchoe fedtschenkoi partial mRNA for phosphoenolpyruvate carboxylase (pepc gene), isoform 2 Length = 1095 Score = 44.1 bits (22), Expect = 0.32 Identities = 34/38 (89%) Strand = Plus / Minus Query: 258 gcgatgcccttcatggtgaggatgagcgtgtcctccag 295 ||||| || |||||||| |||||||| ||||||||||| Sbjct: 1091 gcgatacctttcatggtcaggatgagggtgtcctccag 1054 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 5,327,692 Number of Sequences: 3902068 Number of extensions: 5327692 Number of successful extensions: 319781 Number of sequences better than 10.0: 438 Number of HSP's better than 10.0 without gapping: 439 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 317959 Number of HSP's gapped (non-prelim): 1801 length of query: 372 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 350 effective length of database: 17,147,199,772 effective search space: 6001519920200 effective search space used: 6001519920200 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)