ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah61i24
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AK098979.1| Oryza sativa (japonica cultivar-group) cDNA clon... 147 5e-32
2dbj|AK120175.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 1e-29
3dbj|AK065285.1| Oryza sativa (japonica cultivar-group) cDNA clon... 139 1e-29
4dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 86 2e-13
5dbj|AP006616.2| Oryza sativa (japonica cultivar-group) genomic D... 86 2e-13
6gb|AY106965.1| Zea mays PCO085091 mRNA sequence 62 2e-06
7gb|AC131761.4| Mus musculus BAC clone RP24-228J4 from chromosome... 42 2.1
8gb|AC124393.5| Mus musculus BAC clone RP24-331E1 from chromosome... 42 2.1
9gb|AC161511.3| Mus musculus chromosome 18, clone RP23-37O16, com... 42 2.1
10emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete g... 42 2.1
11gb|AF424783.1| Staphylococcus aureus phage phi 13, complete genome 42 2.1
12dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, co... 42 2.1
13gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, co... 42 2.1
14dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, com... 42 2.1
15emb|AL163636.7|CNS01RIK Human chromosome 14 DNA sequence BAC R-9... 42 2.1
16emb|AL672247.8| Mouse DNA sequence from clone RP23-95I19 on chro... 42 2.1
17ref|XM_512462.1| PREDICTED: Pan troglodytes similar to tropomyos... 40 8.2
18ref|XM_528508.1| PREDICTED: Pan troglodytes similar to tropomyos... 40 8.2
19gb|BT019634.1| Homo sapiens tropomyosin 4 mRNA, complete cds 40 8.2
20gb|BT019633.1| Synthetic construct Homo sapiens tropomyosin 4 mR... 40 8.2
21gb|AC107447.5| Rattus norvegicus 4 BAC CH230-46D21 (Children's H... 40 8.2
22gb|BC067225.1| Homo sapiens tropomyosin 4, mRNA (cDNA clone MGC:... 40 8.2
23gb|BC037576.1| Homo sapiens tropomyosin 4, mRNA (cDNA clone MGC:... 40 8.2
24ref|XM_881767.1| PREDICTED: Bos taurus similar to tropomyosin 4,... 40 8.2
25ref|XM_615314.2| PREDICTED: Bos taurus similar to tropomyosin 4,... 40 8.2
26ref|XM_868523.1| PREDICTED: Bos taurus similar to tropomyosin 4,... 40 8.2
27gb|AF201337.4| Homo sapiens chromosome 8 clone GS1-44D20 map q13... 40 8.2
28gb|AC183602.2| Pan troglodytes BAC clone CH251-350L8 from chromo... 40 8.2
29emb|AL034488.2|CEY54G11A Caenorhabditis elegans YAC Y54G11A, com... 40 8.2
30ref|XM_745050.1| Aspergillus fumigatus Af293 translation regulat... 40 8.2
31gb|CP000001.1| Bacillus cereus E33L, complete genome 40 8.2
32emb|AL158077.15| Human DNA sequence from clone RP11-471J7 on chr... 40 8.2
33emb|X05276.1|HSTM30R Human mRNA for fibroblast tropomyosin TM30 ... 40 8.2
34emb|AL355775.1|ATF12M12 Arabidopsis thaliana DNA chromosome 3, B... 40 8.2
35gb|AC008894.9| Homo sapiens chromosome 19 clone CTD-2231E14, com... 40 8.2
36gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome 40 8.2
37emb|BX511190.8| Zebrafish DNA sequence from clone RP71-80D18 in ... 40 8.2
38emb|CR599958.1| full-length cDNA clone CS0DK009YA24 of HeLa cell... 40 8.2
39tpg|BK002395.1| TPA: TPA_inf: Drosophila melanogaster HDC12482 (... 40 8.2
40dbj|AK023385.1| Homo sapiens cDNA FLJ13323 fis, clone OVARC10017... 40 8.2
41ref|NM_003290.1| Homo sapiens tropomyosin 4 (TPM4), mRNA 40 8.2
42dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 40 8.2
43ref|XM_939054.1| PREDICTED: Homo sapiens similar to tropomyosin ... 40 8.2
44ref|XM_372046.2| PREDICTED: Homo sapiens similar to tropomyosin ... 40 8.2
45gb|AC009808.8| Homo sapiens chromosome 8, clone RP11-138K8, comp... 40 8.2
46ref|NM_001027305.1| Caenorhabditis elegans Daf-16-Dependent Long... 40 8.2
47ref|NM_001027304.1| Caenorhabditis elegans Daf-16-Dependent Long... 40 8.2
48gb|AC012646.6|AC012646 Drosophila melanogaster, chromosome 3R, r... 40 8.2
49gb|AC009539.6|AC009539 Drosophila melanogaster, chromosome 3R, r... 40 8.2
50gb|AF310722.1|AF310722 Homo sapiens tropomyosin 4-anaplastic lym... 40 8.2
51gb|AF186110.1|AF186110 Homo sapiens TPM4-ALK fusion oncoprotein ... 40 8.2
52gb|AF186109.1|AF186109 Homo sapiens TPM4-ALK fusion oncoprotein ... 40 8.2
53gb|AC116849.11| Mus musculus chromosome 19, clone RP24-395F1, co... 40 8.2
54gb|AY888321.1| Synthetic construct Homo sapiens clone FLH008636.... 40 8.2
55gb|AY890921.1| Synthetic construct Homo sapiens clone FLH008631.... 40 8.2
56gb|AC104632.10| Mus musculus strain C57BL/6J clone rp23-368d24 m... 40 8.2
57gb|AF109296.1|AF109296 Leishmania donovani proton motive P-type ... 40 8.2
58gb|AE003679.2| Drosophila melanogaster chromosome 3R, section 17... 40 8.2
59emb|Z82256.1|CEB0513 Caenorhabditis elegans Cosmid B0513, comple... 40 8.2
60gb|AC134590.5| Mus musculus BAC clone RP23-368K22 from 9, comple... 40 8.2
61gb|AC171273.1| Mus musculus BAC clone RP23-137J12 from chromosom... 40 8.2
62gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 40 8.2

>dbj|AK098979.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013093C17, full
           insert sequence
          Length = 1120

 Score =  147 bits (74), Expect = 5e-32
 Identities = 163/192 (84%), Gaps = 3/192 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgcattttgatccagtgtgttgtaggtgtagtcgcttgtggagttcaatccatacttttg 235
           ||||||| |||||||||||||||||||||||| |||||   |||||||||||||||| ||
Sbjct: 796 tgcatttggatccagtgtgttgtaggtgtagttgcttg---agttcaatccatacttgtg 740

                                                                       
Query: 236 cctcatcgatgagctccataggccaggctgggcacctcttgggtcggccgtggtagggat 295
            |||||   ||||||||||||||| || |||  |||||| |  ||||| |||||||| | 
Sbjct: 739 tctcattcttgagctccataggcctggatggaaacctctagtatcggcggtggtaggaag 680

                                                                       
Query: 296 ataggctggagcaccttgggcaagaagcagcggcctccttatgaccacaaaatcttcttc 355
           ||| || ||||||||||||||||  || || |||||||||||||||||||||||||| ||
Sbjct: 679 ataagcgggagcaccttgggcaaccagaagtggcctccttatgaccacaaaatcttcatc 620

                       
Query: 356 gctatcatagtc 367
            || ||||||||
Sbjct: 619 actgtcatagtc 608



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 498 tcgagctctccggtgcggtcatacggcagatcctggatccagtg 541
           ||||| ||||| ||||||||||| |||| |||||||||||||||
Sbjct: 477 tcgagttctccagtgcggtcatatggcaaatcctggatccagtg 434



to top

>dbj|AK120175.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013033B05, full
           insert sequence
          Length = 1693

 Score =  139 bits (70), Expect = 1e-29
 Identities = 162/192 (84%), Gaps = 3/192 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgcattttgatccagtgtgttgtaggtgtagtcgcttgtggagttcaatccatacttttg 235
           ||||||| |||||||||||||||||||||||| |||||   |||||||||||||||| ||
Sbjct: 924 tgcatttggatccagtgtgttgtaggtgtagttgcttg---agttcaatccatacttgtg 868

                                                                       
Query: 236 cctcatcgatgagctccataggccaggctgggcacctcttgggtcggccgtggtagggat 295
            |||||   ||||||||||||| | || |||  |||||| |  ||||| |||||||| | 
Sbjct: 867 tctcattcttgagctccataggtctggatggaaacctctagtatcggcggtggtaggaag 808

                                                                       
Query: 296 ataggctggagcaccttgggcaagaagcagcggcctccttatgaccacaaaatcttcttc 355
           ||| || ||||||||||||||||  || || |||||||||||||||||||||||||| ||
Sbjct: 807 ataagcgggagcaccttgggcaaccagaagtggcctccttatgaccacaaaatcttcatc 748

                       
Query: 356 gctatcatagtc 367
            || ||||||||
Sbjct: 747 actgtcatagtc 736



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 498 tcgagctctccggtgcggtcatacggcagatcctggatccagtg 541
           ||||| ||||| ||||||||||| |||| |||||||||||||||
Sbjct: 605 tcgagttctccagtgcggtcatatggcaaatcctggatccagtg 562



to top

>dbj|AK065285.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002M13, full
           insert sequence
          Length = 1136

 Score =  139 bits (70), Expect = 1e-29
 Identities = 162/192 (84%), Gaps = 3/192 (1%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgcattttgatccagtgtgttgtaggtgtagtcgcttgtggagttcaatccatacttttg 235
           ||||||| |||||||||||||||||||||||| |||||   |||||||||||||||| ||
Sbjct: 796 tgcatttggatccagtgtgttgtaggtgtagttgcttg---agttcaatccatacttgtg 740

                                                                       
Query: 236 cctcatcgatgagctccataggccaggctgggcacctcttgggtcggccgtggtagggat 295
            |||||   ||||||||||||| | || |||  |||||| |  ||||| |||||||| | 
Sbjct: 739 tctcattcttgagctccataggtctggatggaaacctctagtatcggcggtggtaggaag 680

                                                                       
Query: 296 ataggctggagcaccttgggcaagaagcagcggcctccttatgaccacaaaatcttcttc 355
           ||| || ||||||||||||||||  || || |||||||||||||||||||||||||| ||
Sbjct: 679 ataagcgggagcaccttgggcaaccagaagtggcctccttatgaccacaaaatcttcatc 620

                       
Query: 356 gctatcatagtc 367
            || ||||||||
Sbjct: 619 actgtcatagtc 608



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 498 tcgagctctccggtgcggtcatacggcagatcctggatccagtg 541
           ||||| ||||| ||||||||||| |||| |||||||||||||||
Sbjct: 477 tcgagttctccagtgcggtcatatggcaaatcctggatccagtg 434



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 103/123 (83%)
 Strand = Plus / Minus

                                                                            
Query: 245      tgagctccataggccaggctgggcacctcttgggtcggccgtggtagggatataggctgg 304
                ||||||||||||| | || |||  |||||| |  ||||| |||||||| | ||| || ||
Sbjct: 30666901 tgagctccataggtctggatggaaacctctagtatcggcggtggtaggaagataagcggg 30666842

                                                                            
Query: 305      agcaccttgggcaagaagcagcggcctccttatgaccacaaaatcttcttcgctatcata 364
                ||||||||||||||  || || |||||||||||||||||||||||||| || || |||||
Sbjct: 30666841 agcaccttgggcaaccagaagtggcctccttatgaccacaaaatcttcatcactgtcata 30666782

                   
Query: 365      gtc 367
                |||
Sbjct: 30666781 gtc 30666779



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 51/56 (91%), Gaps = 3/56 (5%)
 Strand = Plus / Minus

                                                                        
Query: 176      tgcattttgatccagtgtgttgtaggtgtagtcgcttgtggagttcaatccatact 231
                ||||||| |||||||||||||||||||||||| ||||   ||||||||||||||||
Sbjct: 30668057 tgcatttggatccagtgtgttgtaggtgtagttgctt---gagttcaatccatact 30668005



to top

>dbj|AP006616.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
             clone:B1206D04
          Length = 130176

 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 103/123 (83%)
 Strand = Plus / Minus

                                                                         
Query: 245   tgagctccataggccaggctgggcacctcttgggtcggccgtggtagggatataggctgg 304
             ||||||||||||| | || |||  |||||| |  ||||| |||||||| | ||| || ||
Sbjct: 69557 tgagctccataggtctggatggaaacctctagtatcggcggtggtaggaagataagcggg 69498

                                                                         
Query: 305   agcaccttgggcaagaagcagcggcctccttatgaccacaaaatcttcttcgctatcata 364
             ||||||||||||||  || || |||||||||||||||||||||||||| || || |||||
Sbjct: 69497 agcaccttgggcaaccagaagtggcctccttatgaccacaaaatcttcatcactgtcata 69438

                
Query: 365   gtc 367
             |||
Sbjct: 69437 gtc 69435



 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 51/56 (91%), Gaps = 3/56 (5%)
 Strand = Plus / Minus

                                                                     
Query: 176   tgcattttgatccagtgtgttgtaggtgtagtcgcttgtggagttcaatccatact 231
             ||||||| |||||||||||||||||||||||| ||||   ||||||||||||||||
Sbjct: 70713 tgcatttggatccagtgtgttgtaggtgtagttgctt---gagttcaatccatact 70661



to top

>gb|AY106965.1| Zea mays PCO085091 mRNA sequence
          Length = 928

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 82/99 (82%)
 Strand = Plus / Minus

                                                                       
Query: 500 gagctctccggtgcggtcatacggcagatcctggatccagtgctcgttgaggaggagttg 559
           |||||| ||||||||||| |  ||||| |||||||||||||||| ||||||    || ||
Sbjct: 534 gagctcgccggtgcggtcctctggcagttcctggatccagtgctggttgagcgccagatg 475

                                                  
Query: 560 gccggccacggcagcttccagcagcatcatcgtcatggc 598
           | |||| |  |||||||||||||||||||| | ||||||
Sbjct: 474 ggcggcgagagcagcttccagcagcatcatagccatggc 436



to top

>gb|AC131761.4| Mus musculus BAC clone RP24-228J4 from chromosome 18, complete sequence
          Length = 167442

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 248    gctccataggccaggctgggc 268
              |||||||||||||||||||||
Sbjct: 158470 gctccataggccaggctgggc 158490



to top

>gb|AC124393.5| Mus musculus BAC clone RP24-331E1 from chromosome 18, complete sequence
          Length = 171769

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 248    gctccataggccaggctgggc 268
              |||||||||||||||||||||
Sbjct: 137247 gctccataggccaggctgggc 137227



to top

>gb|AC161511.3| Mus musculus chromosome 18, clone RP23-37O16, complete sequence
          Length = 186860

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 248   gctccataggccaggctgggc 268
             |||||||||||||||||||||
Sbjct: 18642 gctccataggccaggctgggc 18662



to top

>emb|BX571857.1| Staphylococcus aureus strain MSSA476, complete genome
          Length = 2799802

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 133     tgtgcttcgtcatcagtcaca 153
               |||||||||||||||||||||
Sbjct: 2035838 tgtgcttcgtcatcagtcaca 2035858



to top

>gb|AF424783.1| Staphylococcus aureus phage phi 13, complete genome
          Length = 42722

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 133   tgtgcttcgtcatcagtcaca 153
             |||||||||||||||||||||
Sbjct: 32802 tgtgcttcgtcatcagtcaca 32782



to top

>dbj|BA000017.4| Staphylococcus aureus subsp. aureus Mu50 DNA, complete genome
          Length = 2878529

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 133     tgtgcttcgtcatcagtcaca 153
               |||||||||||||||||||||
Sbjct: 2093500 tgtgcttcgtcatcagtcaca 2093520



to top

>gb|CP000253.1| Staphylococcus aureus subsp. aureus NCTC 8325, complete genome
          Length = 2821361

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 133     tgtgcttcgtcatcagtcaca 153
               |||||||||||||||||||||
Sbjct: 2041831 tgtgcttcgtcatcagtcaca 2041851



to top

>dbj|BA000033.2| Staphylococcus aureus subsp. aureus MW2 DNA, complete genome, strain:MW2
          Length = 2820462

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 133     tgtgcttcgtcatcagtcaca 153
               |||||||||||||||||||||
Sbjct: 2056592 tgtgcttcgtcatcagtcaca 2056612



to top

>emb|AL163636.7|CNS01RIK Human chromosome 14 DNA sequence BAC R-903H12 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 202337

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 31     attttatccagattgacagaa 51
              |||||||||||||||||||||
Sbjct: 128769 attttatccagattgacagaa 128789



to top

>emb|AL672247.8| Mouse DNA sequence from clone RP23-95I19 on chromosome X, complete
             sequence
          Length = 224241

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 386   catggctcgtagagtcattgccaag 410
             ||||||| |||||||||||||||||
Sbjct: 49544 catggctagtagagtcattgccaag 49520



to top

>ref|XM_512462.1| PREDICTED: Pan troglodytes similar to tropomyosin 4 (LOC455805),
           mRNA
          Length = 1338

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 651 gctcgttgaggaggagttgg 670



to top

>ref|XM_528508.1| PREDICTED: Pan troglodytes similar to tropomyosin 4 (LOC473138),
           mRNA
          Length = 663

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 285 gctcgttgaggaggagttgg 304



to top

>gb|BT019634.1| Homo sapiens tropomyosin 4 mRNA, complete cds
          Length = 747

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 171 gctcgttgaggaggagttgg 190



to top

>gb|BT019633.1| Synthetic construct Homo sapiens tropomyosin 4 mRNA, partial cds
          Length = 747

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 171 gctcgttgaggaggagttgg 190



to top

>gb|AC107447.5| Rattus norvegicus 4 BAC CH230-46D21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 133054

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 477   ttgacaaaggagacgaggct 496
             ||||||||||||||||||||
Sbjct: 51199 ttgacaaaggagacgaggct 51218



to top

>gb|BC067225.1| Homo sapiens tropomyosin 4, mRNA (cDNA clone MGC:72041
           IMAGE:4772340), complete cds
          Length = 1685

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 241 gctcgttgaggaggagttgg 260



to top

>gb|BC037576.1| Homo sapiens tropomyosin 4, mRNA (cDNA clone MGC:45298
           IMAGE:5582453), complete cds
          Length = 1716

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 287 gctcgttgaggaggagttgg 306



to top

>ref|XM_881767.1| PREDICTED: Bos taurus similar to tropomyosin 4, transcript variant
           3 (LOC535277), mRNA
          Length = 2335

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 405 gctcgttgaggaggagttgg 424



to top

>ref|XM_615314.2| PREDICTED: Bos taurus similar to tropomyosin 4, transcript variant
           1 (LOC535277), mRNA
          Length = 2083

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 153 gctcgttgaggaggagttgg 172



to top

>ref|XM_868523.1| PREDICTED: Bos taurus similar to tropomyosin 4, transcript variant
           2 (LOC535277), mRNA
          Length = 2251

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 321 gctcgttgaggaggagttgg 340



to top

>gb|AF201337.4| Homo sapiens chromosome 8 clone GS1-44D20 map q13.3, complete sequence
          Length = 93479

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 541   gctcgttgaggaggagttgg 560
             ||||||||||||||||||||
Sbjct: 58792 gctcgttgaggaggagttgg 58811



to top

>gb|AC183602.2| Pan troglodytes BAC clone CH251-350L8 from chromosome 9, complete
             sequence
          Length = 165959

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 541   gctcgttgaggaggagttgg 560
             ||||||||||||||||||||
Sbjct: 52676 gctcgttgaggaggagttgg 52695



to top

>emb|AL034488.2|CEY54G11A Caenorhabditis elegans YAC Y54G11A, complete sequence
          Length = 99415

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 578   cagcagcatcatcgtcatgg 597
             ||||||||||||||||||||
Sbjct: 92801 cagcagcatcatcgtcatgg 92782



to top

>ref|XM_745050.1| Aspergillus fumigatus Af293 translation regulator Cya5 (Afu1g03930)
            partial mRNA
          Length = 3888

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 134  gtgcttcgtcatcagtcaca 153
            ||||||||||||||||||||
Sbjct: 3535 gtgcttcgtcatcagtcaca 3516



to top

>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 116     gtactgcatatatgatatgt 135
               ||||||||||||||||||||
Sbjct: 1925488 gtactgcatatatgatatgt 1925469



to top

>emb|AL158077.15| Human DNA sequence from clone RP11-471J7 on chromosome 9 Contains the 5'
              end of the SLC24A2 gene for solute carrier family 24
              (sodium/potassium/calcium exchanger), member 2 (NCKX2) and
              a CpG island, complete sequence
          Length = 159900

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 523    gcagatcctggatccagtgc 542
              ||||||||||||||||||||
Sbjct: 103529 gcagatcctggatccagtgc 103510



to top

>emb|X05276.1|HSTM30R Human mRNA for fibroblast tropomyosin TM30 (pl)
          Length = 2049

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 221 gctcgttgaggaggagttgg 240



to top

>emb|AL355775.1|ATF12M12 Arabidopsis thaliana DNA chromosome 3, BAC clone F12M12
          Length = 106730

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 108   tgacttatgtactgcatatatgat 131
             |||| |||||||||||||||||||
Sbjct: 87003 tgacctatgtactgcatatatgat 86980



to top

>gb|AC008894.9| Homo sapiens chromosome 19 clone CTD-2231E14, complete sequence
          Length = 112067

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 541   gctcgttgaggaggagttgg 560
             ||||||||||||||||||||
Sbjct: 41218 gctcgttgaggaggagttgg 41237



to top

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 577   ccagcagcatcatcgtcatg 596
             ||||||||||||||||||||
Sbjct: 14162 ccagcagcatcatcgtcatg 14181



to top

>emb|BX511190.8| Zebrafish DNA sequence from clone RP71-80D18 in linkage group 5,
             complete sequence
          Length = 156408

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 59    acatacaaatgtatacagtg 78
             ||||||||||||||||||||
Sbjct: 81123 acatacaaatgtatacagtg 81142



to top

>emb|CR599958.1| full-length cDNA clone CS0DK009YA24 of HeLa cells Cot 25-normalized
           of Homo sapiens (human)
          Length = 1551

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 357 gctcgttgaggaggagttgg 376



to top

>tpg|BK002395.1| TPA: TPA_inf: Drosophila melanogaster HDC12482 (HDC12482) gene,
            complete cds
          Length = 3279

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 581  cagcatcatcgtcatggcca 600
            ||||||||||||||||||||
Sbjct: 2908 cagcatcatcgtcatggcca 2927



to top

>dbj|AK023385.1| Homo sapiens cDNA FLJ13323 fis, clone OVARC1001731, highly similar
           to TROPOMYOSIN ALPHA CHAIN, FIBROBLAST ISOFORM F2
          Length = 1543

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 366 gctcgttgaggaggagttgg 385



to top

>ref|NM_003290.1| Homo sapiens tropomyosin 4 (TPM4), mRNA
          Length = 2049

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 221 gctcgttgaggaggagttgg 240



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 572    agcttccagcagcatcatcg 591
              ||||||||||||||||||||
Sbjct: 851875 agcttccagcagcatcatcg 851856



to top

>ref|XM_939054.1| PREDICTED: Homo sapiens similar to tropomyosin 4 (LOC649969), mRNA
          Length = 645

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 138 gctcgttgaggaggagttgg 157



to top

>ref|XM_372046.2| PREDICTED: Homo sapiens similar to tropomyosin 4 (LOC389667), mRNA
          Length = 645

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 138 gctcgttgaggaggagttgg 157



to top

>gb|AC009808.8| Homo sapiens chromosome 8, clone RP11-138K8, complete sequence
          Length = 173805

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 541    gctcgttgaggaggagttgg 560
              ||||||||||||||||||||
Sbjct: 112366 gctcgttgaggaggagttgg 112385



to top

>ref|NM_001027305.1| Caenorhabditis elegans Daf-16-Dependent Longevity (WT but not
           daf-16 lifespan increased) family member (ddl-3) (ddl-3)
           mRNA, complete cds
          Length = 1188

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 578 cagcagcatcatcgtcatgg 597
           ||||||||||||||||||||
Sbjct: 106 cagcagcatcatcgtcatgg 125



to top

>ref|NM_001027304.1| Caenorhabditis elegans Daf-16-Dependent Longevity (WT but not
           daf-16 lifespan increased) family member (ddl-3) (ddl-3)
           mRNA, complete cds
          Length = 1316

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 578 cagcagcatcatcgtcatgg 597
           ||||||||||||||||||||
Sbjct: 116 cagcagcatcatcgtcatgg 135



to top

>gb|AC012646.6|AC012646 Drosophila melanogaster, chromosome 3R, region 85A-85B, BAC clone
              BACR03F16, complete sequence
          Length = 204681

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 581    cagcatcatcgtcatggcca 600
              ||||||||||||||||||||
Sbjct: 129103 cagcatcatcgtcatggcca 129084



to top

>gb|AC009539.6|AC009539 Drosophila melanogaster, chromosome 3R, region 85A-85A, BAC clone
            BACR33N15, complete sequence
          Length = 187701

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 581  cagcatcatcgtcatggcca 600
            ||||||||||||||||||||
Sbjct: 2540 cagcatcatcgtcatggcca 2521



to top

>gb|AF310722.1|AF310722 Homo sapiens tropomyosin 4-anaplastic lymphoma kinase fusion
           protein (TPM4-ALK) mRNA, partial cds
          Length = 966

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 177 gctcgttgaggaggagttgg 196



to top

>gb|AF186110.1|AF186110 Homo sapiens TPM4-ALK fusion oncoprotein type 1 (TPM4-ALK fusion)
           mRNA, partial cds
          Length = 883

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 102 gctcgttgaggaggagttgg 121



to top

>gb|AF186109.1|AF186109 Homo sapiens TPM4-ALK fusion oncoprotein type 2 (TPM4-ALK fusion)
           mRNA, partial cds
          Length = 716

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 174 gctcgttgaggaggagttgg 193



to top

>gb|AC116849.11| Mus musculus chromosome 19, clone RP24-395F1, complete sequence
          Length = 168486

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   attttgatccagtgtgttgt 198
             ||||||||||||||||||||
Sbjct: 78940 attttgatccagtgtgttgt 78921



to top

>gb|AY888321.1| Synthetic construct Homo sapiens clone FLH008636.01X tropomyosin 4
           (TPM4) mRNA, complete cds
          Length = 747

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 171 gctcgttgaggaggagttgg 190



to top

>gb|AY890921.1| Synthetic construct Homo sapiens clone FLH008631.01L tropomyosin 4
           (TPM4) mRNA, partial cds
          Length = 747

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 541 gctcgttgaggaggagttgg 560
           ||||||||||||||||||||
Sbjct: 171 gctcgttgaggaggagttgg 190



to top

>gb|AC104632.10| Mus musculus strain C57BL/6J clone rp23-368d24 map 3, complete sequence
          Length = 210499

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 432   gcgacagtagcgacagcagc 451
             ||||||||||||||||||||
Sbjct: 88937 gcgacagtagcgacagcagc 88918



to top

>gb|AF109296.1|AF109296 Leishmania donovani proton motive P-type ATPase gene locus, complete
             sequence
          Length = 15413

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   agcaccttgggcaagaagca 324
             ||||||||||||||||||||
Sbjct: 11361 agcaccttgggcaagaagca 11342



to top

>gb|AE003679.2| Drosophila melanogaster chromosome 3R, section 17 of 118 of the
             complete sequence
          Length = 216994

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 581   cagcatcatcgtcatggcca 600
             ||||||||||||||||||||
Sbjct: 14644 cagcatcatcgtcatggcca 14663



to top

>emb|Z82256.1|CEB0513 Caenorhabditis elegans Cosmid B0513, complete sequence
          Length = 42614

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 578  cagcagcatcatcgtcatgg 597
            ||||||||||||||||||||
Sbjct: 2218 cagcagcatcatcgtcatgg 2199



to top

>gb|AC134590.5| Mus musculus BAC clone RP23-368K22 from 9, complete sequence
          Length = 180271

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 522    ggcagatcctggatccagtg 541
              ||||||||||||||||||||
Sbjct: 107626 ggcagatcctggatccagtg 107607



to top

>gb|AC171273.1| Mus musculus BAC clone RP23-137J12 from chromosome 3, complete sequence
          Length = 234363

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 432    gcgacagtagcgacagcagc 451
              ||||||||||||||||||||
Sbjct: 222329 gcgacagtagcgacagcagc 222310



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 572    agcttccagcagcatcatcg 591
              ||||||||||||||||||||
Sbjct: 768993 agcttccagcagcatcatcg 769012


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,997,928
Number of Sequences: 3902068
Number of extensions: 4997928
Number of successful extensions: 86623
Number of sequences better than 10.0: 62
Number of HSP's better than 10.0 without gapping: 62
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 86384
Number of HSP's gapped (non-prelim): 234
length of query: 601
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 578
effective length of database: 17,143,297,704
effective search space: 9908826072912
effective search space used: 9908826072912
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top