ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah61i12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC011411.4| Homo sapiens chromosome 5 clone CTB-78O21, comple... 44 0.33
2ref|XM_671767.1| Plasmodium berghei strain ANKA hypothetical pro... 42 1.3
3emb|AL163763.1|ATF18O21 Arabidopsis thaliana DNA chromosome 3, B... 42 1.3
4gb|AC094571.8| Rattus norvegicus 20 BAC CH230-4L21 (Children's H... 40 5.2
5gb|AC069309.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 5.2
6ref|NM_001025372.1| Mus musculus adenylate cyclase activating po... 40 5.2
7ref|NM_007407.3| Mus musculus adenylate cyclase activating polyp... 40 5.2
8ref|NM_001118.3| Homo sapiens adenylate cyclase activating polyp... 40 5.2
9gb|AC144633.3| Mus musculus BAC clone RP23-26J4 from chromosome ... 40 5.2
10gb|AY495952.1| Homo sapiens pituitary adenylate cyclase activati... 40 5.2
11gb|AY495951.1| Homo sapiens pituitary adenylate cyclase activati... 40 5.2
12gb|AY462279.1| Homo sapiens pituitary adenylate cyclase activati... 40 5.2
13gb|AY462278.1| Homo sapiens pituitary adenylate cyclase activati... 40 5.2
14gb|AC123946.4| Mus musculus BAC clone RP23-97L17 from chromosome... 40 5.2
15gb|AC129213.4| Mus musculus BAC clone RP24-391M2 from chromosome... 40 5.2
16gb|AY366498.1| Homo sapiens pituitary adenyl cyclase activating ... 40 5.2
17emb|AL353657.26| Human DNA sequence from clone RP11-100C24 on ch... 40 5.2
18emb|AL354776.15| Human DNA sequence from clone RP11-196N14 on ch... 40 5.2
19gb|AF443846.1| Vibrio cholerae type 2 strain V208 putative core ... 40 5.2
20dbj|AK147291.1| Mus musculus cDNA, RIKEN full-length enriched li... 40 5.2
21dbj|AK147609.1| Mus musculus adult male brain UNDEFINED_CELL_LIN... 40 5.2
22gb|AC160534.5| Mus musculus chromosome 7, clone RP24-265E12, com... 40 5.2
23dbj|AK042820.1| Mus musculus 7 days neonate cerebellum cDNA, RIK... 40 5.2
24dbj|AK081121.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 40 5.2
25gb|AC102298.14| Mus musculus chromosome 7, clone RP24-396N13, co... 40 5.2
26dbj|AK083108.1| Mus musculus adult male hippocampus cDNA, RIKEN ... 40 5.2
27dbj|AK047304.1| Mus musculus 10 days neonate cerebellum cDNA, RI... 40 5.2
28gb|AC006466.3|AC006466 Homo sapiens BAC clone CTA-471E18 from 7p... 40 5.2
29gb|AE004701.1| Pseudomonas aeruginosa PAO1, section 262 of 529 o... 40 5.2
30gb|AC092758.3| Papio anubis clone RP41-22J16, complete sequence 40 5.2
31gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-... 40 5.2
32emb|BX247879.5| Zebrafish DNA sequence from clone CH211-195N15, ... 40 5.2
33dbj|AB008268.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 40 5.2
34emb|Z22735.1|RNPACAPA R.norvegicus PACAP-like receptor mRNA 40 5.2
35emb|Z23282.1|RNPACAPAB R.norvegicus PACAP mRNA, complete CDS 40 5.2
36emb|Z23279.1|RNPACAPAA R.norvegicus PACAP receptor, complete CDS 40 5.2
37emb|Z23275.1|RNPACHOPB R.norvegicus PACAP receptor, hop2 splice ... 40 5.2
38emb|Z23274.1|RNPACHOPA R.norvegicus PACAP receptor, hop1 splice ... 40 5.2
39emb|Z23273.1|RNPACHIPA R.norvegicus PACAP receptor, hip splice v... 40 5.2
40emb|Z23272.1|RNPACHH1A R.norvegicus PACAP receptor, hip-hop1 spl... 40 5.2
41ref|NM_133511.1| Rattus norvegicus adenylate cyclase activating ... 40 5.2
42dbj|D16465.1|RATRPACAP1 Rattus norvegicus mRNA for PACAP recepto... 40 5.2
43dbj|D14909.1|RATPACAP2 Rattus norvegicus mRNA for PACAP receptor... 40 5.2
44dbj|D14908.1|RATPACAP1 Rattus norvegicus mRNA for PACAP receptor... 40 5.2
45gb|BC067039.1| Mus musculus adenylate cyclase activating polypep... 40 5.2
46emb|CR848815.7| Zebrafish DNA sequence from clone CH211-197C11 i... 40 5.2
47gb|L16680.1|RATPACAPI Rat pituitary adenylate cyclase activating... 40 5.2
48dbj|D82935.1| Mus musculus mRNA for pituitary adenylate cyclase-... 40 5.2
49gb|L16506.1|RATPACAPLR Rat PACAP-like receptor mRNA, 3' end 40 5.2
50dbj|D17516.1|HUMPACAPR Homo sapiens mRNA for PACAP receptor, com... 40 5.2
51dbj|AB065700.1| Homo sapiens gene for seven transmembrane helix ... 40 5.2

>gb|AC011411.4| Homo sapiens chromosome 5 clone CTB-78O21, complete sequence
          Length = 163864

 Score = 44.1 bits (22), Expect = 0.33
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 254   acactatttccttaattataag 275
             ||||||||||||||||||||||
Sbjct: 31626 acactatttccttaattataag 31647



to top

>ref|XM_671767.1| Plasmodium berghei strain ANKA hypothetical protein (PB100656.00.0)
            partial mRNA
          Length = 4578

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 117  cagtgttgtagaaaatttatt 137
            |||||||||||||||||||||
Sbjct: 4272 cagtgttgtagaaaatttatt 4292



to top

>emb|AL163763.1|ATF18O21 Arabidopsis thaliana DNA chromosome 3, BAC clone F18O21
          Length = 99492

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 258   tatttccttaattataagaac 278
             |||||||||||||||||||||
Sbjct: 72221 tatttccttaattataagaac 72201



to top

>gb|AC094571.8| Rattus norvegicus 20 BAC CH230-4L21 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 230137

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 189    ctaagctcagcataccaaac 208
              ||||||||||||||||||||
Sbjct: 207234 ctaagctcagcataccaaac 207253



to top

>gb|AC069309.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-154D15, complete
             sequence
          Length = 174754

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   cagcacagctctgtggtggg 312
             ||||||||||||||||||||
Sbjct: 58883 cagcacagctctgtggtggg 58902



to top

>ref|NM_001025372.1| Mus musculus adenylate cyclase activating polypeptide 1 receptor 1
            (Adcyap1r1), transcript variant 2, mRNA
          Length = 6176

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1371 cagcacagctctgtggtggg 1390



to top

>ref|NM_007407.3| Mus musculus adenylate cyclase activating polypeptide 1 receptor 1
            (Adcyap1r1), transcript variant 1, mRNA
          Length = 6260

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1371 cagcacagctctgtggtggg 1390



to top

>ref|NM_001118.3| Homo sapiens adenylate cyclase activating polypeptide 1 (pituitary)
            receptor type I (ADCYAP1R1), mRNA
          Length = 1643

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1126 cagcacagctctgtggtggg 1145



to top

>gb|AC144633.3| Mus musculus BAC clone RP23-26J4 from chromosome 7, complete sequence
          Length = 223362

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 297    acagctctgtggtgggacca 316
              ||||||||||||||||||||
Sbjct: 163022 acagctctgtggtgggacca 163003



to top

>gb|AY495952.1| Homo sapiens pituitary adenylate cyclase activating polypeptide 1
           receptor type I HopII variant (ADCYAP1R1) mRNA, partial
           cds, alternatively spliced
          Length = 342

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 52  cagcacagctctgtggtggg 71



to top

>gb|AY495951.1| Homo sapiens pituitary adenylate cyclase activating polypeptide 1
           receptor type I Hip variant (ADCYAP1R1) mRNA, partial
           cds, alternatively spliced
          Length = 345

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 52  cagcacagctctgtggtggg 71



to top

>gb|AY462279.1| Homo sapiens pituitary adenylate cyclase activating polypeptide 1
           receptor type I Hop splice variant (ADCYAP1R1) mRNA,
           partial cds; alternatively spliced
          Length = 345

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 52  cagcacagctctgtggtggg 71



to top

>gb|AY462278.1| Homo sapiens pituitary adenylate cyclase activating polypeptide 1
           receptor type I Hiphop splice variant (ADCYAP1R1) mRNA,
           partial cds; alternatively spliced
          Length = 429

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 52  cagcacagctctgtggtggg 71



to top

>gb|AC123946.4| Mus musculus BAC clone RP23-97L17 from chromosome 12, complete sequence
          Length = 193610

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 94    tttggatacaatggaaagaa 113
             ||||||||||||||||||||
Sbjct: 53420 tttggatacaatggaaagaa 53401



to top

>gb|AC129213.4| Mus musculus BAC clone RP24-391M2 from chromosome 6, complete sequence
          Length = 154613

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 293    cagcacagctctgtggtggg 312
              ||||||||||||||||||||
Sbjct: 149758 cagcacagctctgtggtggg 149777



to top

>gb|AY366498.1| Homo sapiens pituitary adenyl cyclase activating polypeptide 1
           receptor type 1 (ADCYAP1R1) mRNA, complete cds
          Length = 1407

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 903 cagcacagctctgtggtggg 922



to top

>emb|AL353657.26| Human DNA sequence from clone RP11-100C24 on chromosome 13q14.3-21.2
             Contains a mitochondrial cytochrome c oxidase II (MTCO2)
             pseudogene, complete sequence
          Length = 79600

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 128   aaaatttattattgctaaga 147
             ||||||||||||||||||||
Sbjct: 10352 aaaatttattattgctaaga 10371



to top

>emb|AL354776.15| Human DNA sequence from clone RP11-196N14 on chromosome 20 Contains the
              3' end of the PPP4R1L gene for protein phosphatase 4
              regulatory subunit 1-like, the C20orf85 gene for an ankyrin
              domain-containing protein, the C20orf86 gene and three CpG
              islands, complete sequence
          Length = 146208

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 292    ccagcacagctctgtggtgg 311
              ||||||||||||||||||||
Sbjct: 107536 ccagcacagctctgtggtgg 107517



to top

>gb|AF443846.1| Vibrio cholerae type 2 strain V208 putative core OS biosynthesis
            (wav) gene cluster, partial sequence
          Length = 4162

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 113  atcccagtgttgtagaaaat 132
            ||||||||||||||||||||
Sbjct: 2197 atcccagtgttgtagaaaat 2216



to top

>dbj|AK147291.1| Mus musculus cDNA, RIKEN full-length enriched library,
            clone:M5C1008L20 product:adenylate cyclase activating
            polypeptide 1 receptor 1, full insert sequence
          Length = 6105

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1324 cagcacagctctgtggtggg 1343



to top

>dbj|AK147609.1| Mus musculus adult male brain UNDEFINED_CELL_LINE cDNA, RIKEN
            full-length enriched library, clone:M5C1088G18
            product:adenylate cyclase activating polypeptide 1
            receptor 1, full insert sequence
          Length = 5889

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1114 cagcacagctctgtggtggg 1133



to top

>gb|AC160534.5| Mus musculus chromosome 7, clone RP24-265E12, complete sequence
          Length = 176921

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 297   acagctctgtggtgggacca 316
             ||||||||||||||||||||
Sbjct: 40896 acagctctgtggtgggacca 40877



to top

>dbj|AK042820.1| Mus musculus 7 days neonate cerebellum cDNA, RIKEN full-length
            enriched library, clone:A730027C01 product:PITUITARY
            ADENYLATE CYCLASE ACTIVATING POLYPEPTIDE TYPE I RECEPTOR
            PRECURSOR (PACAP TYPE I RECEPTOR), full insert sequence
          Length = 3688

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1365 cagcacagctctgtggtggg 1384



to top

>dbj|AK081121.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930090H13 product:PITUITARY
           ADENYLATE CYCLASE ACTIVATING POLYPEPTIDE TYPE I RECEPTOR
           PRECURSOR (PACAP TYPE I RECEPTOR), full insert sequence
          Length = 3093

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 876 cagcacagctctgtggtggg 895



to top

>gb|AC102298.14| Mus musculus chromosome 7, clone RP24-396N13, complete sequence
          Length = 187811

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 297    acagctctgtggtgggacca 316
              ||||||||||||||||||||
Sbjct: 109177 acagctctgtggtgggacca 109196



to top

>dbj|AK083108.1| Mus musculus adult male hippocampus cDNA, RIKEN full-length enriched
            library, clone:C630015A01 product:PITUITARY ADENYLATE
            CYCLASE ACTIVATING POLYPEPTIDE TYPE I RECEPTOR PRECURSOR
            (PACAP TYPE I RECEPTOR), full insert sequence
          Length = 3459

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1372 cagcacagctctgtggtggg 1391



to top

>dbj|AK047304.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930047C21 product:PITUITARY
           ADENYLATE CYCLASE ACTIVATING POLYPEPTIDE TYPE I RECEPTOR
           PRECURSOR (PACAP TYPE I RECEPTOR), full insert sequence
          Length = 3093

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 876 cagcacagctctgtggtggg 895



to top

>gb|AC006466.3|AC006466 Homo sapiens BAC clone CTA-471E18 from 7p11.2-p21, complete sequence
          Length = 156880

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   cagcacagctctgtggtggg 312
             ||||||||||||||||||||
Sbjct: 47166 cagcacagctctgtggtggg 47185



to top

>gb|AE004701.1| Pseudomonas aeruginosa PAO1, section 262 of 529 of the complete
            genome
          Length = 10551

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 113  atcccagtgttgtagaaaat 132
            ||||||||||||||||||||
Sbjct: 9175 atcccagtgttgtagaaaat 9194



to top

>gb|AC092758.3| Papio anubis clone RP41-22J16, complete sequence
          Length = 171690

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   cagcacagctctgtggtggg 312
             ||||||||||||||||||||
Sbjct: 47315 cagcacagctctgtggtggg 47334



to top

>gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-29N16, complete
             sequence
          Length = 141898

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   cagcacagctctgtggtggg 312
             ||||||||||||||||||||
Sbjct: 66176 cagcacagctctgtggtggg 66195



to top

>emb|BX247879.5| Zebrafish DNA sequence from clone CH211-195N15, complete sequence
          Length = 184509

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 219    aaaatgatgtacagatttgt 238
              ||||||||||||||||||||
Sbjct: 159822 aaaatgatgtacagatttgt 159803



to top

>dbj|AB008268.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1
          Length = 83594

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 91    aaatttggatacaatggaaa 110
             ||||||||||||||||||||
Sbjct: 25309 aaatttggatacaatggaaa 25290



to top

>emb|Z22735.1|RNPACAPA R.norvegicus PACAP-like receptor mRNA
          Length = 1370

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 558 cagcacagctctgtggtggg 577



to top

>emb|Z23282.1|RNPACAPAB R.norvegicus PACAP mRNA, complete CDS
          Length = 2468

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1293 cagcacagctctgtggtggg 1312



to top

>emb|Z23279.1|RNPACAPAA R.norvegicus PACAP receptor, complete CDS
          Length = 1640

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 990  cagcacagctctgtggtggg 1009



to top

>emb|Z23275.1|RNPACHOPB R.norvegicus PACAP receptor, hop2 splice variant, complete CDS
          Length = 1721

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 990  cagcacagctctgtggtggg 1009



to top

>emb|Z23274.1|RNPACHOPA R.norvegicus PACAP receptor, hop1 splice variant, complete CDS
          Length = 1724

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 990  cagcacagctctgtggtggg 1009



to top

>emb|Z23273.1|RNPACHIPA R.norvegicus PACAP receptor, hip splice variant, complete CDS
          Length = 1724

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 990  cagcacagctctgtggtggg 1009



to top

>emb|Z23272.1|RNPACHH1A R.norvegicus PACAP receptor, hip-hop1 splice variant, complete CDS
          Length = 1808

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 990  cagcacagctctgtggtggg 1009



to top

>ref|NM_133511.1| Rattus norvegicus adenylate cyclase activating polypeptide 1 receptor
            1 (Adcyap1r1), mRNA
          Length = 2681

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1237 cagcacagctctgtggtggg 1256



to top

>dbj|D16465.1|RATRPACAP1 Rattus norvegicus mRNA for PACAP receptor, complete cds
          Length = 2681

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1237 cagcacagctctgtggtggg 1256



to top

>dbj|D14909.1|RATPACAP2 Rattus norvegicus mRNA for PACAP receptor, complete cds
          Length = 2599

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1027 cagcacagctctgtggtggg 1046



to top

>dbj|D14908.1|RATPACAP1 Rattus norvegicus mRNA for PACAP receptor, complete cds
          Length = 2122

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1229 cagcacagctctgtggtggg 1248



to top

>gb|BC067039.1| Mus musculus adenylate cyclase activating polypeptide 1 receptor 1,
            transcript variant 2, mRNA (cDNA clone MGC:85983
            IMAGE:6852762), complete cds
          Length = 6157

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1306 cagcacagctctgtggtggg 1325



to top

>emb|CR848815.7| Zebrafish DNA sequence from clone CH211-197C11 in linkage group 15,
              complete sequence
          Length = 161902

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 77     ttacaacgagcatcaaattt 96
              ||||||||||||||||||||
Sbjct: 117740 ttacaacgagcatcaaattt 117759



to top

>gb|L16680.1|RATPACAPI Rat pituitary adenylate cyclase activating polypeptide (PACAP) type
           I receptor mRNA, complete cds
          Length = 1996

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 930 cagcacagctctgtggtggg 949



to top

>dbj|D82935.1| Mus musculus mRNA for pituitary adenylate cyclase-activating
            polypeptide receptor, complete cds
          Length = 1644

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1056 cagcacagctctgtggtggg 1075



to top

>gb|L16506.1|RATPACAPLR Rat PACAP-like receptor mRNA, 3' end
          Length = 1370

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 293 cagcacagctctgtggtggg 312
           ||||||||||||||||||||
Sbjct: 558 cagcacagctctgtggtggg 577



to top

>dbj|D17516.1|HUMPACAPR Homo sapiens mRNA for PACAP receptor, complete cds
          Length = 1664

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 293  cagcacagctctgtggtggg 312
            ||||||||||||||||||||
Sbjct: 1147 cagcacagctctgtggtggg 1166



to top

>dbj|AB065700.1| Homo sapiens gene for seven transmembrane helix receptor, complete cds,
             isolate:CBRC7TM_263
          Length = 43818

 Score = 40.1 bits (20), Expect = 5.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 293   cagcacagctctgtggtggg 312
             ||||||||||||||||||||
Sbjct: 24579 cagcacagctctgtggtggg 24598


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,168,657
Number of Sequences: 3902068
Number of extensions: 4168657
Number of successful extensions: 75747
Number of sequences better than 10.0: 51
Number of HSP's better than 10.0 without gapping: 51
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75681
Number of HSP's gapped (non-prelim): 66
length of query: 388
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 366
effective length of database: 17,147,199,772
effective search space: 6275875116552
effective search space used: 6275875116552
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top