ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah61h07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor ... 1092 0.0
2emb|AJ222783.1|HVJ222783 Hordeum vulgare mRNA for cytochrome b6/... 537 e-149
3dbj|AK071634.1| Oryza sativa (japonica cultivar-group) cDNA clon... 521 e-145
4gb|AF093631.1|AF093631 Oryza sativa Rieske Fe-S precursor protei... 521 e-145
5gb|BT016255.1| Zea mays clone Contig88 mRNA sequence 507 e-140
6gb|AY104934.1| Zea mays PCO071754 mRNA sequence 507 e-140
7gb|AY581830.1| Cynodon dactylon putative Rieske Fe-S precursor p... 315 1e-82
8dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 194 3e-46
9dbj|AP005125.3| Oryza sativa (japonica cultivar-group) genomic D... 194 3e-46
10gb|DQ427777.1| Sorghum propinquum locus HHU30 genomic sequence 103 7e-19
11gb|DQ427776.1| Sorghum bicolor voucher PI585454 locus HHU30 geno... 103 7e-19
12gb|DQ427775.1| Sorghum bicolor voucher PI267539 locus HHU30 geno... 103 7e-19
13gb|DQ427774.1| Sorghum bicolor voucher PI267408 locus HHU30 geno... 103 7e-19
14gb|DQ427773.1| Sorghum bicolor voucher PI221607 locus HHU30 geno... 103 7e-19
15gb|DQ427772.1| Sorghum bicolor voucher PI152702 locus HHU30 geno... 103 7e-19
16gb|DQ427771.1| Sorghum bicolor voucher NSL92371 locus HHU30 geno... 103 7e-19
17gb|DQ427770.1| Sorghum bicolor voucher NSL87902 locus HHU30 geno... 103 7e-19
18gb|DQ427769.1| Sorghum bicolor voucher NSL87666 locus HHU30 geno... 103 7e-19
19gb|DQ427768.1| Sorghum bicolor voucher NSL77217 locus HHU30 geno... 103 7e-19
20gb|DQ427767.1| Sorghum bicolor voucher NSL77034 locus HHU30 geno... 103 7e-19
21gb|DQ427766.1| Sorghum bicolor voucher NSL56174 locus HHU30 geno... 103 7e-19
22gb|DQ427765.1| Sorghum bicolor voucher NSL56003 locus HHU30 geno... 103 7e-19
23gb|DQ427764.1| Sorghum bicolor voucher NSL55243 locus HHU30 geno... 103 7e-19
24gb|DQ427763.1| Sorghum bicolor voucher NSL51365 locus HHU30 geno... 103 7e-19
25gb|DQ427762.1| Sorghum bicolor voucher NSL51030 locus HHU30 geno... 103 7e-19
26gb|DQ427761.1| Sorghum bicolor voucher NSL50875 locus HHU30 geno... 103 7e-19
27gb|DQ427760.1| Sorghum bicolor voucher BTx623 locus HHU30 genomi... 103 7e-19
28gb|DQ122916.1| Chlamydomonas incerta chloroplast cytochrome B6/F... 90 1e-14
29dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rie... 90 1e-14
30emb|AL731601.3|OSJN00245 Oryza sativa genomic DNA, chromosome 4,... 88 4e-14
31gb|DQ384526.1| Panax ginseng clone PG6L-3 photosynthetic electro... 88 4e-14
32dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 88 4e-14
33ref|NM_193963.1| Oryza sativa (japonica cultivar-group), predic... 82 3e-12
34dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 82 3e-12
35gb|AY826845.1| Pavlova lutheri clone PLCB61 chloroplast cytochro... 82 3e-12
36dbj|AP002870.1| Oryza sativa (japonica cultivar-group) genomic D... 82 3e-12
37gb|AY300039.1| Solanum tuberosum putative Rieske Fe-S protein pr... 80 1e-11
38gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21... 80 1e-11
39dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
40dbj|AP004875.3| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
41dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic D... 80 1e-11
42gb|AF037456.1|AF037456 Fritillaria agrestis cytochrome B6-F comp... 78 4e-11
43ref|NM_116566.3| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECT... 76 2e-10
44ref|NM_178964.1| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECT... 76 2e-10
45gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromosome IV... 76 2e-10
46emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome 4, c... 76 2e-10
47emb|AJ292972.1|ATH292972 Arabidopsis thaliana petC gene for Ries... 76 2e-10
48emb|AJ243702.1|ATH243702 Arabidopsis thaliana mRNA for rieske ir... 76 2e-10
49gb|AY093726.1| Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, com... 76 2e-10
50gb|AF410296.1|AF410296 Arabidopsis thaliana AT4g03280/F4C21_21 m... 76 2e-10
51gb|AF370566.1|AF370566 Arabidopsis thaliana putative component o... 76 2e-10
52emb|BX827560.1|CNS0A2RQ Arabidopsis thaliana Full-length cDNA Co... 76 2e-10
53emb|AJ784852.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur... 74 6e-10
54dbj|AB025003.1| Cicer arietinum mRNA for plastoquinol-plastocyan... 74 6e-10
55gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome... 70 1e-08
56dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 70 1e-08
57dbj|AU066527.1| Chlamydomonas sp. HS-5 mRNA for hypothetical pro... 64 6e-07
58emb|BX826362.1|CNS0A4FZ Arabidopsis thaliana Full-length cDNA Co... 60 1e-05
59emb|X63605.1|PSPETC P.sativum petC mRNA for chloroplast Rieske F... 58 4e-05
60gb|AY826843.1| Heterocapsa triquetra clone HTCB61 chloroplast cy... 54 6e-04
61emb|AJ784853.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur... 52 0.002
62emb|BX826457.1|CNS0A4G1 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
63emb|BX826302.1|CNS0A381 Arabidopsis thaliana Full-length cDNA Co... 52 0.002
64emb|X06244.1|SORFES Spinach mRNA for Rieske FeS-precursor protein 52 0.002
65gb|AF110783.1|AF110783 Volvox carteri f. nagariensis clone G9 ri... 50 0.009
66gb|AY267656.1| Bigelowiella natans Fe-S subunit of cytochrome c6... 48 0.037
67emb|X76299.1|CRPETC C.reinhardtii petC gene 48 0.037
68emb|X66009.1|NTRFES1 N.tabacum mRNA for chloroplast Rieske FeS p... 46 0.15
69emb|X64353.1|NTRFSCBFC N.tabacum mRNA for Rieske Fe/S protein of... 46 0.15
70emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome;... 46 0.15
71emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segmen... 46 0.15
72gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence 44 0.57
73dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete g... 44 0.57
74gb|AY826844.1| Isochrysis galbana clone ISCB61 chloroplast cytoc... 44 0.57
75dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 44 0.57
76gb|AY487229.1| Mycobacterium fortuitum PgaE gene, partial cds; p... 44 0.57
77gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome 44 0.57
78dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic... 44 0.57
79gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete... 42 2.3
80ref|NM_135169.2| Drosophila melanogaster Pez CG9493-RA (Pez), mRNA 42 2.3
81gb|AF217284.1|AF217284 Drosophila melanogaster protein tyrosine ... 42 2.3
82gb|AE003613.4| Drosophila melanogaster chromosome 2L, section 22... 42 2.3
83gb|AC005285.1|AC005285 Drosophila melanogaster DNA sequence (P1s... 42 2.3
84ref|NM_018094.2| Homo sapiens G1 to S phase transition 2 (GSPT2)... 40 9.0
85gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, co... 40 9.0
86gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome 40 9.0
87ref|XM_659574.1| Aspergillus nidulans FGSC A4 hypothetical prote... 40 9.0
88ref|XM_754954.1| Ustilago maydis 521 hypothetical protein (UM039... 40 9.0
89gb|AC125332.3| Mus musculus BAC clone RP23-113I20 from 3, comple... 40 9.0
90gb|AC121928.2| Mus musculus BAC clone RP24-204F1 from 3, complet... 40 9.0
91emb|AL929101.4| Human DNA sequence from clone RP11-22B10 on chro... 40 9.0
92emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chr... 40 9.0
93emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on ch... 40 9.0
94ref|XM_783177.1| PREDICTED: Strongylocentrotus purpuratus simila... 40 9.0
95gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 ma... 40 9.0
96gb|BC036077.1| Homo sapiens G1 to S phase transition 2, mRNA (cD... 40 9.0
97emb|AJ251548.1|HSA251548 Homo sapiens mRNA for polypeptide chain... 40 9.0
98emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chro... 40 9.0
99emb|CR861342.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1511 (from cl... 40 9.0
100gb|AC087892.16| Homo sapiens 12q BAC RP11-3L23 (Roswell Park Can... 40 9.0
101gb|AE005819.1| Caulobacter crescentus CB15 section 145 of 359 of... 40 9.0
102gb|AC098615.2| Homo sapiens chromosome 3 clone RP11-268I20, comp... 40 9.0
103dbj|AK023155.1| Homo sapiens cDNA FLJ13093 fis, clone NT2RP30021... 40 9.0
104dbj|AK001303.1| Homo sapiens cDNA FLJ10441 fis, clone NT2RP10007... 40 9.0
105gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 9.0
106gb|AF336983.1|AF336983 Vaucheria litorea cytochrome b6f complex ... 40 9.0
107emb|AL606597.4|OSJN00042 Oryza sativa genomic DNA, chromosome 4,... 40 9.0
108gb|AC012451.8| Homo sapiens BAC clone RP11-414K19 from 2, comple... 40 9.0
109dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 40 9.0
110gb|AE005063.1| Halobacterium sp. NRC-1 section 94 of 170 of the ... 40 9.0
111gb|AF203698.1|AF203698 Rattus norvegicus T calcium channel alpha... 40 9.0
112gb|U04283.1|SAPHSA Streptomyces antibioticus IMRU3720 phenoxazin... 40 9.0

>gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor protein mRNA,
           complete cds
          Length = 866

 Score = 1092 bits (551), Expect = 0.0
 Identities = 621/644 (96%), Gaps = 2/644 (0%)
 Strand = Plus / Minus

                                                                       
Query: 16  tagactgtatacatataactggatacaagaaacaggtgcatttatagcaggagtactctt 75
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 857 tagactgtatacatataactggatacaagaaacaggtgcatttatagcaggagtagtctt 798

                                                                       
Query: 76  at--agcagcgttcttaggactggcaggaggcttaacatatcacacgagtgagctttgct 133
           ||  ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||
Sbjct: 797 atgtagcagcgttcttaggactggcaggaggcttaacatatcacaggagtgagcattgct 738

                                                                       
Query: 134 gccggagcttgtgtcgcttatttccaccacgggttctcgccggtcctgaagtcggtctcc 193
           ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||
Sbjct: 737 gccggagcttgcgtcgcttatttccaccacgggttgtcgccggtcctgaagtcggtctcc 678

                                                                       
Query: 194 acccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253
           ||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 677 acccacggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaaccagggccagcgac 618

                                                                       
Query: 254 agaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaaggg 313
           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||
Sbjct: 617 agaggtgcaggcccacggacaaccttgccctggttgttgtactgggatccatggcagggg 558

                                                                       
Query: 314 cagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacg 373
           ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||
Sbjct: 557 cagaggaacttgttctcggcggcgttccacggcacgacgcatccaagatgcgtgcacacg 498

                                                                       
Query: 374 gcgttgatcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatca 433
           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct: 497 gcgttgatcccgtaggtggcaagggtcttgtcggactccaccacaaggtaggtaggatca 438

                                                                       
Query: 434 cccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcg 493
           ||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||
Sbjct: 437 cccttgagcccctgggccagcgtgcggtcgttggggccgtgcgtcttgagccagtcctcg 378

                                                                       
Query: 494 acgaggatgtcgttgccgagcttgtccttggcggcgacccctccggcgttgctcccggag 553
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 377 acgaggatgtcgttgccgagcttgtccttggcggcgacccctccggcgttgctcccggag 318

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 317 ccggcggggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 258

                                                       
Query: 614 gcgcccagcagcangagggtcatcagctncctcttgctcatgtc 657
           ||||||||||| |  ||| ||||||||| |||||||||||||||
Sbjct: 257 gcgcccagcaggagcaggttcatcagctccctcttgctcatgtc 214



to top

>emb|AJ222783.1|HVJ222783 Hordeum vulgare mRNA for cytochrome b6/f-complex iron-sulfur
           like-protein, clone RG115
          Length = 275

 Score =  537 bits (271), Expect = e-149
 Identities = 271/271 (100%)
 Strand = Plus / Minus

                                                                       
Query: 170 tcgccggtcctgaagtcggtctccacccatggcacgaagacgaccttgccgtcgtcgacg 229
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 275 tcgccggtcctgaagtcggtctccacccatggcacgaagacgaccttgccgtcgtcgacg 216

                                                                       
Query: 230 tcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaaccttgccctggttg 289
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 215 tcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaaccttgccctggttg 156

                                                                       
Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 155 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 96

                                                                       
Query: 350 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 95  acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 36

                                          
Query: 410 tccaccacaaggtaggtaggatcacccttga 440
           |||||||||||||||||||||||||||||||
Sbjct: 35  tccaccacaaggtaggtaggatcacccttga 5



to top

>dbj|AK071634.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100K03, full
           insert sequence
          Length = 1082

 Score =  521 bits (263), Expect = e-145
 Identities = 441/501 (88%)
 Strand = Plus / Minus

                                                                       
Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216
           |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 725 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 666

                                                                       
Query: 217 gccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaac 276
           ||||||||||||||||||||| || |  ||||||||||| || |||||||||||||| ||
Sbjct: 665 gccgtcgtcgacgtcggcgtgcaccaatgccagcgacaggggagcaggtccacggacgac 606

                                                                       
Query: 277 cttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggc 336
           | ||||||||||||||||||| || || ||||| ||||||| ||||||||||||||||||
Sbjct: 605 cctgccctggttgttgtactgcgagccgtggcaggggcagatgaacttgttctcggcggc 546

                                                                       
Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgag 396
           |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| ||||| ||
Sbjct: 545 gttccacggcacgacgcacccaaggtgcgtgcacacggcgttgatcccgtacgtggccag 486

                                                                       
Query: 397 ggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagcgt 456
            |||||||||| |||||| || ||||| || || ||||||||||||||||||| ||| ||
Sbjct: 485 cgtcttgtcggcctccacgacgaggtacgtcgggtcacccttgagcccctgggtgagggt 426

                                                                       
Query: 457 gcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagctt 516
           |||||||||||||||||| ||||||||||| |||||| |||| | |||||||||||||||
Sbjct: 425 gcggtcgttggggccgtgtgtcttgagccactcctcggcgagcacgtcgttgccgagctt 366

                                                                       
Query: 517 gtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggagcc 576
           |||||||||| |   ||| ||| ||  | ||||||| ||||| |||| || ||||| |||
Sbjct: 365 gtccttggcgacctgcccgccgccggcgttcccggacccggcggggatgaagaaggcgcc 306

                                                                       
Query: 577 gtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcangagggtcat 636
           |||||||||||||||||||| ||||||||||||||||||||| ||||| | |||| ||||
Sbjct: 305 gtaggggacgagcatgccgacggtggggagcgagatggcgccgagcaggaggaggttcat 246

                                
Query: 637 cagctncctcttgctcatgtc 657
           |||||  | ||||| ||||||
Sbjct: 245 cagctggcgcttgcccatgtc 225



to top

>gb|AF093631.1|AF093631 Oryza sativa Rieske Fe-S precursor protein (RISP) mRNA, complete
           cds
          Length = 919

 Score =  521 bits (263), Expect = e-145
 Identities = 441/501 (88%)
 Strand = Plus / Minus

                                                                       
Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216
           |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 713 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 654

                                                                       
Query: 217 gccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaac 276
           ||||||||||||||||||||| || |  ||||||||||| || |||||||||||||| ||
Sbjct: 653 gccgtcgtcgacgtcggcgtgcaccaatgccagcgacaggggagcaggtccacggacgac 594

                                                                       
Query: 277 cttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggc 336
           | ||||||||||||||||||| || || ||||| ||||||| ||||||||||||||||||
Sbjct: 593 cctgccctggttgttgtactgcgagccgtggcaggggcagatgaacttgttctcggcggc 534

                                                                       
Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgag 396
           |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| ||||| ||
Sbjct: 533 gttccacggcacgacgcacccaaggtgcgtgcacacggcgttgatcccgtacgtggccag 474

                                                                       
Query: 397 ggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagcgt 456
            |||||||||| |||||| || ||||| || || ||||||||||||||||||| ||| ||
Sbjct: 473 cgtcttgtcggcctccacgacgaggtacgtcgggtcacccttgagcccctgggtgagggt 414

                                                                       
Query: 457 gcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagctt 516
           |||||||||||||||||| ||||||||||| |||||| |||| | |||||||||||||||
Sbjct: 413 gcggtcgttggggccgtgtgtcttgagccactcctcggcgagcacgtcgttgccgagctt 354

                                                                       
Query: 517 gtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggagcc 576
           |||||||||| |   ||| ||| ||  | ||||||| ||||| |||| || ||||| |||
Sbjct: 353 gtccttggcgacctgcccgccgccggcgttcccggacccggcggggatgaagaaggcgcc 294

                                                                       
Query: 577 gtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcangagggtcat 636
           |||||||||||||||||||| ||||||||||||||||||||| ||||| | |||| ||||
Sbjct: 293 gtaggggacgagcatgccgacggtggggagcgagatggcgccgagcaggaggaggttcat 234

                                
Query: 637 cagctncctcttgctcatgtc 657
           |||||  | ||||| ||||||
Sbjct: 233 cagctggcgcttgcccatgtc 213



to top

>gb|BT016255.1| Zea mays clone Contig88 mRNA sequence
          Length = 998

 Score =  507 bits (256), Expect = e-140
 Identities = 429/487 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214
           ||||||||||||| |||||||||||||||||||||||||||||| || ||||||| ||||
Sbjct: 746 ttccaccacgggtcctcgccggtcctgaagtcggtctccacccacgggacgaagaggacc 687

                                                                       
Query: 215 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274
           |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 686 ttgccgtcgtcgacgtcggcgtgaaccagggccagcgacagaggcgccggtccacggacc 627

                                                                       
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334
           ||||||||||||||||||||||||||||| ||||| ||||||| ||||||||||||||||
Sbjct: 626 accttgccctggttgttgtactgggatccgtggcatgggcagatgaacttgttctcggcg 567

                                                                       
Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394
            ||||||| |||||||||||||| || || ||||| ||||||||||||||||||||||| 
Sbjct: 566 ccgttccacggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggcc 507

                                                                       
Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454
           || ||||||||   ||||||||| ||||| || || ||||||||||||||||| ||||||
Sbjct: 506 agcgtcttgtcctgctccaccaccaggtacgtggggtcacccttgagcccctgcgcgagc 447

                                                                       
Query: 455 gtgcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagc 514
           ||||| |||||||| |||||||| ||||||||  |||| ||   |||||||||||| |||
Sbjct: 446 gtgcgatcgttgggaccgtgcgtgttgagccacgcctccaccgtgatgtcgttgcccagc 387

                                                                       
Query: 515 ttgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggag 574
           ||||||||||||  |  ||| ||| ||  | ||||||||||||| ||||||| ||||| |
Sbjct: 386 ttgtccttggcgtaggtcccgccgccggcgttcccggagccggcagggacgaagaaggcg 327

                                                                       
Query: 575 ccgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcangagggtc 634
           ||||||||||||| |||||||| |||||| | |||||||||||| || || | |||| ||
Sbjct: 326 ccgtaggggacgaccatgccgacggtgggcaacgagatggcgccgaggaggaggaggttc 267

                  
Query: 635 atcagct 641
           |||||||
Sbjct: 266 atcagct 260



to top

>gb|AY104934.1| Zea mays PCO071754 mRNA sequence
          Length = 1058

 Score =  507 bits (256), Expect = e-140
 Identities = 429/487 (88%)
 Strand = Plus / Minus

                                                                       
Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214
           |||||||| |||| |||||||||||||||||||||||||||||| || ||||||| ||||
Sbjct: 805 ttccaccatgggtcctcgccggtcctgaagtcggtctccacccacgggacgaagaggacc 746

                                                                       
Query: 215 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274
           |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| 
Sbjct: 745 ttgccgtcgtcgacgtcggcgtgaaccagggccagcgacagaggcgccggtccacggacc 686

                                                                       
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334
           ||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| |||
Sbjct: 685 accttgccctggttgttgtactgggatccgtggcaggggcagatgaacttgttctcagcg 626

                                                                       
Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394
            ||||||| |||||||||||||| || || ||||| ||||||||||||||||||||||| 
Sbjct: 625 ccgttccacggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggcc 566

                                                                       
Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454
           || ||||||||   ||||||||| ||||| || || ||||||||||||||||| ||||||
Sbjct: 565 agcgtcttgtcctgctccaccaccaggtacgtggggtcacccttgagcccctgcgcgagc 506

                                                                       
Query: 455 gtgcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagc 514
           |||||||||||||| |||||||| |||||||| ||||| ||   |||||||||||| |||
Sbjct: 505 gtgcggtcgttgggaccgtgcgtgttgagccactcctccaccgtgatgtcgttgcccagc 446

                                                                       
Query: 515 ttgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggag 574
           ||||||||||||  |  ||| ||| ||  | ||||||||||||| ||||||| ||||| |
Sbjct: 445 ttgtccttggcgtaggtcccgccgccggcgttcccggagccggcagggacgaagaaggcg 386

                                                                       
Query: 575 ccgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcangagggtc 634
           ||||||||||||| |||||||| |||||| | |||||||||||| || || | |||| ||
Sbjct: 385 ccgtaggggacgaccatgccgacggtgggcaacgagatggcgccgaggaggaggaggttc 326

                  
Query: 635 atcagct 641
           |||||||
Sbjct: 325 atcagct 319



to top

>gb|AY581830.1| Cynodon dactylon putative Rieske Fe-S precursor protein mRNA,
           partial cds
          Length = 511

 Score =  315 bits (159), Expect = 1e-82
 Identities = 285/327 (87%)
 Strand = Plus / Minus

                                                                       
Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214
           |||||||| |||| |||||||||||||||||||||||||||||| || ||||| | | ||
Sbjct: 327 ttccaccaggggtcctcgccggtcctgaagtcggtctccacccacgggacgaaaagggcc 268

                                                                       
Query: 215 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274
           |||||||||||||||||||||||||| | |||||||||||| || || ||||||||||| 
Sbjct: 267 ttgccgtcgtcgacgtcggcgtgaaccaaggccagcgacagtggcgccggtccacggacg 208

                                                                       
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334
           ||||||||||||||||||||||||||||| ||||| ||| | | |||||||||||||| |
Sbjct: 207 accttgccctggttgttgtactgggatccgtggcatgggtacatgaacttgttctcgggg 148

                                                                       
Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394
           |  ||||| ||||||||||| || || || |||||||| |||||||| ||||||||||| 
Sbjct: 147 ggattccacggcacgacgcatcccaggtgggtgcagaccgcgttgatgccgtaggtggcc 88

                                                                       
Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454
           || ||||||||    ||||| || ||||| || || ||||||||||||||||| | ||||
Sbjct: 87  agcgtcttgtccttgtccacgaccaggtacgtggggtcacccttgagcccctgcgtgagc 28

                                      
Query: 455 gtgcggtcgttggggccgtgcgtcttg 481
           |||||||| ||||||||||||||||||
Sbjct: 27  gtgcggtctttggggccgtgcgtcttg 1



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score =  194 bits (98), Expect = 3e-46
 Identities = 158/178 (88%)
 Strand = Plus / Minus

                                                                            
Query: 260      gcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagagg 319
                |||||||||||||| ||| ||||||||||||||||||| || || ||||| ||||||| |
Sbjct: 22132649 gcaggtccacggacgaccctgccctggttgttgtactgcgagccgtggcaggggcagatg 22132590

                                                                            
Query: 320      aacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttg 379
                ||||||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 22132589 aacttgttctcggcggcgttccacggcacgacgcacccaaggtgcgtgcacacggcgttg 22132530

                                                                          
Query: 380      atcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatcaccct 437
                |||||||| ||||| || |||||||||| |||||| || ||||| || || |||||||
Sbjct: 22132529 atcccgtacgtggccagcgtcttgtcggcctccacgacgaggtacgtcgggtcaccct 22132472



 Score =  129 bits (65), Expect = 1e-26
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                            
Query: 157      ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216
                |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 22132954 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 22132895

                                     
Query: 217      gccgtcgtcgacgtcggcgtg 237
                |||||||||||||||||||||
Sbjct: 22132894 gccgtcgtcgacgtcggcgtg 22132874



 Score =  127 bits (64), Expect = 5e-26
 Identities = 85/92 (92%)
 Strand = Plus / Minus

                                                                            
Query: 435      ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
                ||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |||||| 
Sbjct: 22132386 ccttgagcccctgggtgagggtgcggtcgttggggccgtgtgtcttgagccactcctcgg 22132327

                                                
Query: 495      cgaggatgtcgttgccgagcttgtccttggcg 526
                |||| | |||||||||||||||||||||||||
Sbjct: 22132326 cgagcacgtcgttgccgagcttgtccttggcg 22132295



 Score =  107 bits (54), Expect = 5e-20
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                            
Query: 554      ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
                ||||| |||| || ||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 22132170 ccggcggggatgaagaaggcgccgtaggggacgagcatgccgacggtggggagcgagatg 22132111

                                                            
Query: 614      gcgcccagcagcangagggtcatcagctncctcttgctcatgtc 657
                ||||| ||||| | |||| |||||||||  | ||||| ||||||
Sbjct: 22132110 gcgccgagcaggaggaggttcatcagctggcgcttgcccatgtc 22132067



to top

>dbj|AP005125.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OSJNBa0058I18
          Length = 151453

 Score =  194 bits (98), Expect = 3e-46
 Identities = 158/178 (88%)
 Strand = Plus / Minus

                                                                         
Query: 260   gcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagagg 319
             |||||||||||||| ||| ||||||||||||||||||| || || ||||| ||||||| |
Sbjct: 86305 gcaggtccacggacgaccctgccctggttgttgtactgcgagccgtggcaggggcagatg 86246

                                                                         
Query: 320   aacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttg 379
             ||||||||||||||||||||||| ||||||||||| ||||| |||||||| |||||||||
Sbjct: 86245 aacttgttctcggcggcgttccacggcacgacgcacccaaggtgcgtgcacacggcgttg 86186

                                                                       
Query: 380   atcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatcaccct 437
             |||||||| ||||| || |||||||||| |||||| || ||||| || || |||||||
Sbjct: 86185 atcccgtacgtggccagcgtcttgtcggcctccacgacgaggtacgtcgggtcaccct 86128



 Score =  129 bits (65), Expect = 1e-26
 Identities = 77/81 (95%)
 Strand = Plus / Minus

                                                                         
Query: 157   ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216
             |||||||||||| ||||||||||||||||||||||||||||| ||||||||||  |||||
Sbjct: 86610 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 86551

                                  
Query: 217   gccgtcgtcgacgtcggcgtg 237
             |||||||||||||||||||||
Sbjct: 86550 gccgtcgtcgacgtcggcgtg 86530



 Score =  127 bits (64), Expect = 5e-26
 Identities = 85/92 (92%)
 Strand = Plus / Minus

                                                                         
Query: 435   ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
             ||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |||||| 
Sbjct: 86042 ccttgagcccctgggtgagggtgcggtcgttggggccgtgtgtcttgagccactcctcgg 85983

                                             
Query: 495   cgaggatgtcgttgccgagcttgtccttggcg 526
             |||| | |||||||||||||||||||||||||
Sbjct: 85982 cgagcacgtcgttgccgagcttgtccttggcg 85951



 Score =  107 bits (54), Expect = 5e-20
 Identities = 91/104 (87%)
 Strand = Plus / Minus

                                                                         
Query: 554   ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
             ||||| |||| || ||||| ||||||||||||||||||||||| ||||||||||||||||
Sbjct: 85826 ccggcggggatgaagaaggcgccgtaggggacgagcatgccgacggtggggagcgagatg 85767

                                                         
Query: 614   gcgcccagcagcangagggtcatcagctncctcttgctcatgtc 657
             ||||| ||||| | |||| |||||||||  | ||||| ||||||
Sbjct: 85766 gcgccgagcaggaggaggttcatcagctggcgcttgcccatgtc 85723



to top

>gb|DQ427777.1| Sorghum propinquum locus HHU30 genomic sequence
          Length = 742

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 524 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 465

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 464 ccgtgatgtcgttgcccagcttgtccttggcg 433



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 320 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 261

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 260 gcgccgaggaggaggaggttcatcagct 233



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 739 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 680

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 679 tcctgctccaccaccaggtacgtcgggtcaccct 646



to top

>gb|DQ427776.1| Sorghum bicolor voucher PI585454 locus HHU30 genomic sequence
          Length = 728

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632



to top

>gb|DQ427775.1| Sorghum bicolor voucher PI267539 locus HHU30 genomic sequence
          Length = 731

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635



to top

>gb|DQ427774.1| Sorghum bicolor voucher PI267408 locus HHU30 genomic sequence
          Length = 731

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635



to top

>gb|DQ427773.1| Sorghum bicolor voucher PI221607 locus HHU30 genomic sequence
          Length = 725

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 722 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 663

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 662 tcctgctccaccaccaggtacgtcgggtcaccct 629



to top

>gb|DQ427772.1| Sorghum bicolor voucher PI152702 locus HHU30 genomic sequence
          Length = 731

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635



to top

>gb|DQ427771.1| Sorghum bicolor voucher NSL92371 locus HHU30 genomic sequence
          Length = 731

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635



to top

>gb|DQ427770.1| Sorghum bicolor voucher NSL87902 locus HHU30 genomic sequence
          Length = 728

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632



to top

>gb|DQ427769.1| Sorghum bicolor voucher NSL87666 locus HHU30 genomic sequence
          Length = 733

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 521 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 462

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 461 ccgtgatgtcgttgcccagcttgtccttggcg 430



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 730 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 671

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 670 tcctgctccaccaccaggtacgtcgggtcaccct 637



to top

>gb|DQ427768.1| Sorghum bicolor voucher NSL77217 locus HHU30 genomic sequence
          Length = 731

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635



to top

>gb|DQ427767.1| Sorghum bicolor voucher NSL77034 locus HHU30 genomic sequence
          Length = 723

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627



to top

>gb|DQ427766.1| Sorghum bicolor voucher NSL56174 locus HHU30 genomic sequence
          Length = 723

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627



to top

>gb|DQ427765.1| Sorghum bicolor voucher NSL56003 locus HHU30 genomic sequence
          Length = 723

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627



to top

>gb|DQ427764.1| Sorghum bicolor voucher NSL55243 locus HHU30 genomic sequence
          Length = 723

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627



to top

>gb|DQ427763.1| Sorghum bicolor voucher NSL51365 locus HHU30 genomic sequence
          Length = 723

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627



to top

>gb|DQ427762.1| Sorghum bicolor voucher NSL51030 locus HHU30 genomic sequence
          Length = 728

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632



to top

>gb|DQ427761.1| Sorghum bicolor voucher NSL50875 locus HHU30 genomic sequence
          Length = 725

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 722 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 663

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 662 tcctgctccaccaccaggtacgtcgggtcaccct 629



to top

>gb|DQ427760.1| Sorghum bicolor voucher BTx623 locus HHU30 genomic sequence
          Length = 731

 Score =  103 bits (52), Expect = 7e-19
 Identities = 82/92 (89%)
 Strand = Plus / Minus

                                                                       
Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494
           ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || |
Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460

                                           
Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526
           |   |||||||||||| |||||||||||||||
Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428



 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 77/88 (87%)
 Strand = Plus / Minus

                                                                       
Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613
           ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| |||||||||
Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253

                                       
Query: 614 gcgcccagcagcangagggtcatcagct 641
           ||||| || || | |||| |||||||||
Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 81/94 (86%)
 Strand = Plus / Minus

                                                                       
Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403
           |||||||||||||| || || ||||| ||||||||||||||||||||||| || ||||||
Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669

                                             
Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437
           ||   ||||||||| ||||| || || |||||||
Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635



to top

>gb|DQ122916.1| Chlamydomonas incerta chloroplast cytochrome B6/F complex rieske
           iron-sulfur protein (PetC) mRNA, partial cds; nuclear
           gene for chloroplast product
          Length = 1178

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 114/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301
           |||||||||||||| || || || |||||||| ||||||||||    ||||||||| || 
Sbjct: 443 agggccagcgacaggggagcggggccacggaccaccttgccctcagcgttgtactgagag 384

                                                                       
Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361
           || |||||||||||   ||||||||||||||| ||   |||||||||||||||||| || 
Sbjct: 383 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggcacgacgcagcccagg 324

                            
Query: 362 tgcgtgcagacggcgtt 378
           || ||||| ||||||||
Sbjct: 323 tgagtgcacacggcgtt 307



to top

>dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rieske Fe-S
           precursor protein, complete cds
          Length = 1436

 Score = 89.7 bits (45), Expect = 1e-14
 Identities = 114/137 (83%)
 Strand = Plus / Minus

                                                                       
Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301
           |||||||||||||| || || || |||||||| ||||||||||    ||||||||| || 
Sbjct: 576 agggccagcgacaggggagcggggccacggaccaccttgccctcagcgttgtactgagag 517

                                                                       
Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361
           || |||||||||||   ||||||||||||||| ||   |||||||||||||||||| || 
Sbjct: 516 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggcacgacgcagcccagg 457

                            
Query: 362 tgcgtgcagacggcgtt 378
           || ||||| ||||||||
Sbjct: 456 tgagtgcacacggcgtt 440



to top

>emb|AL731601.3|OSJN00245 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0044M19,
             complete sequence
          Length = 188317

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 88/103 (85%), Gaps = 6/103 (5%)
 Strand = Plus / Plus

                                                                         
Query: 157   ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210
             |||||||||||| ||||| ||||||||||||||||||||      ||| |||||||||| 
Sbjct: 53046 ccaccacgggttgtcgccagtcctgaagtcggtctccactcacacccacggcacgaagag 53105

                                                        
Query: 211   gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253
              |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 53106 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 53148



to top

>gb|DQ384526.1| Panax ginseng clone PG6L-3 photosynthetic electron transfer-like
           protein mRNA, complete cds
          Length = 770

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 116/140 (82%)
 Strand = Plus / Minus

                                                                       
Query: 251 gacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaa 310
           |||||||| ||||| || |  ||||||||||| |||||||||||||| ||||||||||| 
Sbjct: 528 gacagaggagcagggcctctaacaaccttgccttggttgttgtactgagatccatggcat 469

                                                                       
Query: 311 gggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcag 370
           ||||| | |||||||||||| ||    ||||| ||||| || || |||||||||||||| 
Sbjct: 468 gggcacatgaacttgttctctgctttattccatggcacaacacaaccaagatgcgtgcac 409

                               
Query: 371 acggcgttgatcccgtaggt 390
           || || ||||| || |||||
Sbjct: 408 actgcattgataccataggt 389



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 88/103 (85%), Gaps = 6/103 (5%)
 Strand = Plus / Plus

                                                                            
Query: 157      ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210
                |||||||||||| ||||| ||||||||||||||||||||      ||| |||||||||| 
Sbjct: 18961122 ccaccacgggttgtcgccagtcctgaagtcggtctccactcacacccacggcacgaagag 18961181

                                                           
Query: 211      gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253
                 |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 18961182 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 18961224



 Score = 40.1 bits (20), Expect = 9.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                      
Query: 3       tttctcttctttntagactgtat 25
               |||||||||||| ||||||||||
Sbjct: 8169878 tttctcttctttttagactgtat 8169856



to top

>ref|NM_193963.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 705

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                       
Query: 189 tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 248
           |||||||||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||
Sbjct: 160 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 101

                
Query: 249 gcgac 253
           |||||
Sbjct: 100 gcgac 96



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                            
Query: 189      tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 248
                |||||||||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||
Sbjct: 14242662 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 14242603

                     
Query: 249      gcgac 253
                |||||
Sbjct: 14242602 gcgac 14242598



to top

>gb|AY826845.1| Pavlova lutheri clone PLCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 640

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 77/89 (86%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351
           |||||| || || ||||| ||||||| |||||| | ||  ||||||||||| ||||||||
Sbjct: 310 gtactgcgagccgtggcaggggcagatgaacttctgctgcgcggcgttccacggcacgac 251

                                        
Query: 352 gcagccaagatgcgtgcagacggcgttga 380
           ||||||||| ||||||||||| |||||||
Sbjct: 250 gcagccaaggtgcgtgcagaccgcgttga 222



to top

>dbj|AP002870.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0458A05
          Length = 120593

 Score = 81.8 bits (41), Expect = 3e-12
 Identities = 59/65 (90%)
 Strand = Plus / Minus

                                                                         
Query: 189   tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 248
             |||||||||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||
Sbjct: 38352 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 38293

                  
Query: 249   gcgac 253
             |||||
Sbjct: 38292 gcgac 38288



to top

>gb|AY300039.1| Solanum tuberosum putative Rieske Fe-S protein precursor (FeS)
           mRNA, complete cds; nuclear gene for chloroplast product
          Length = 693

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 124/152 (81%)
 Strand = Plus / Minus

                                                                       
Query: 287 ttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggc 346
           |||||||| || ||||||||||||||||| | |||||||||||| || |  ||||| |||
Sbjct: 557 ttgttgtattgagatccatggcaagggcaaatgaacttgttctcagcagtattccacggc 498

                                                                       
Query: 347 acgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
           ||||| || ||||| || ||||| || |||||||| || ||||| ||||| ||    |||
Sbjct: 497 acgacacaaccaaggtgagtgcacacagcgttgataccataggtcgcgagtgttccatcg 438

                                           
Query: 407 gactccaccacaaggtaggtaggatcaccctt 438
             |||||| |||||||| |||||||| |||||
Sbjct: 437 ttctccacaacaaggtaagtaggatctccctt 406



to top

>gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21H13, complete sequence
          Length = 101563

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 121/148 (81%)
 Strand = Plus / Minus

                                                                          
Query: 290    ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349
              ||||| ||||||||||||||||| || |||||||||||||| ||   |||||| ||||| 
Sbjct: 101211 ttgtattgggatccatggcaaggacataggaacttgttctcagctttgttccatggcaca 101152

                                                                          
Query: 350    acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409
              || || |||||||| ||||| || ||||| || ||||| || || || |||||||||  |
Sbjct: 101151 acacatccaagatgtgtgcatactgcgtttataccgtatgtcgctagtgtcttgtcgttc 101092

                                          
Query: 410    tccaccacaaggtaggtaggatcaccct 437
              ||||| || ||||| || ||||| ||||
Sbjct: 101091 tccacaactaggtaagttggatctccct 101064



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
               sequence
          Length = 35954743

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 87/103 (84%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                           
Query: 157     ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210
               |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 8732264 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 8732205

                                                          
Query: 211     gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253
                |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 8732204 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 8732162



to top

>dbj|AP004875.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0463G12
          Length = 145403

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 87/103 (84%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                          
Query: 157    ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210
              |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 139311 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 139252

                                                         
Query: 211    gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253
               |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 139251 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 139209



to top

>dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OSJNBa0052K15
          Length = 156250

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 87/103 (84%), Gaps = 6/103 (5%)
 Strand = Plus / Minus

                                                                         
Query: 157   ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210
             |||||||||||| ||||| ||||||||||| ||||||||      ||| |||||||||| 
Sbjct: 31343 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 31284

                                                        
Query: 211   gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253
              |||||| |||||||||||||||||||||| |  |||||||||
Sbjct: 31283 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 31241



to top

>gb|AF037456.1|AF037456 Fritillaria agrestis cytochrome B6-F complex iron-sulfur subunit
           precursor (petC) mRNA, complete cds
          Length = 881

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 72/83 (86%)
 Strand = Plus / Minus

                                                                       
Query: 245 gccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatcca 304
           ||||||||||  ||||||||||| | ||||||||| || || |||||||| || ||||| 
Sbjct: 605 gccagcgacaacggtgcaggtcccctgacaaccttcccttgattgttgtattgcgatccg 546

                                  
Query: 305 tggcaagggcagaggaacttgtt 327
           ||||| |||||||||||||||||
Sbjct: 545 tggcaggggcagaggaacttgtt 523



to top

>ref|NM_116566.3| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C)
           AT4G03280 (PETC) transcript variant AT4G03280.1 mRNA,
           complete cds
          Length = 963

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 678 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 619

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 618 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 561



to top

>ref|NM_178964.1| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C)
           AT4G03280 (PETC) transcript variant AT4G03280.2 mRNA,
           complete cds
          Length = 1062

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 777 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 718

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 717 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 660



to top

>gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromosome IV, top arm, near 17 cM,
             complete sequence
          Length = 136335

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                         
Query: 289   gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
             |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 74269 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 74210

                                                                       
Query: 349   gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
              || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 74209 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 74152



to top

>emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 8
          Length = 195429

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                         
Query: 289   gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
             |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 92641 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 92582

                                                                       
Query: 349   gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
              || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 92581 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 92524



to top

>emb|AJ292972.1|ATH292972 Arabidopsis thaliana petC gene for Rieske FeS protein, exons 1-5
          Length = 2145

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                        
Query: 289  gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
            |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 1917 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 1858

                                                                      
Query: 349  gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
             || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 1857 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 1800



to top

>emb|AJ243702.1|ATH243702 Arabidopsis thaliana mRNA for rieske iron-sulfur protein precursor
           (petC gene)
          Length = 957

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 654 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 595

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 594 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 537



to top

>gb|AY093726.1| Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, complete cds
          Length = 633

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 492 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 433

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 432 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 375



to top

>gb|AF410296.1|AF410296 Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, complete cds
          Length = 1061

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 780 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 721

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 720 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 663



to top

>gb|AF370566.1|AF370566 Arabidopsis thaliana putative component of cytochrome B6-F complex
           (F4C21.21) mRNA, complete cds
          Length = 732

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 549 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 490

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 489 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 432



to top

>emb|BX827560.1|CNS0A2RQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS74ZE01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1358

 Score = 75.8 bits (38), Expect = 2e-10
 Identities = 98/118 (83%)
 Strand = Plus / Minus

                                                                        
Query: 289  gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
            |||||| ||||||||||||||||| || || ||||||||||| ||   |||||| |||||
Sbjct: 1133 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 1074

                                                                      
Query: 349  gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
             || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 1073 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 1016



to top

>emb|AJ784852.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur protein (petC-1
           gene)
          Length = 864

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351
           ||||||||| || ||||| ||||| | |||||||||||| |  |||||||| || |||||
Sbjct: 615 gtactgggagccgtggcacgggcacatgaacttgttctccgacgcgttccacgggacgac 556

                                        
Query: 352 gcagccaagatgcgtgcagacggcgttga 380
           ||| ||||| || ||||||||||||||||
Sbjct: 555 gcacccaaggtgagtgcagacggcgttga 527



to top

>dbj|AB025003.1| Cicer arietinum mRNA for plastoquinol-plastocyanin reductase,
           partial cds
          Length = 479

 Score = 73.8 bits (37), Expect = 6e-10
 Identities = 121/149 (81%)
 Strand = Plus / Minus

                                                                       
Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349
           |||||||| ||||||||||| |||||||  |||||||||||||||| |||  | ||||||
Sbjct: 361 ttgtactgagatccatggcaggggcagataaacttgttctcggcggtgttaaacggcacg 302

                                                                       
Query: 350 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409
           || || || || || ||||| || || || ||||| || || || || ||  ||||   |
Sbjct: 301 acacacccgaggtgagtgcatactgcattaatcccatatgttgcaagtgttctgtctttc 242

                                        
Query: 410 tccaccacaaggtaggtaggatcaccctt 438
           ||||||||||||||||||||||| |||||
Sbjct: 241 tccaccacaaggtaggtaggatccccctt 213



to top

>gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05,
             complete sequence
          Length = 143400

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                         
Query: 191   tccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagc 250
             |||| ||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||||
Sbjct: 64199 tccatccacggcacgaagataaccttgccgtcgtcgacgtcggcgtgaaccaatgccagc 64258

                
Query: 251   gac 253
             |||
Sbjct: 64259 gac 64261



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 56/63 (88%)
 Strand = Plus / Plus

                                                                            
Query: 191      tccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagc 250
                |||| ||| ||||||||||  ||||||||||||||||||||||||||||| |  ||||||
Sbjct: 16113029 tccatccacggcacgaagataaccttgccgtcgtcgacgtcggcgtgaaccaatgccagc 16113088

                   
Query: 251      gac 253
                |||
Sbjct: 16113089 gac 16113091



to top

>dbj|AU066527.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl
           inducible, complete cds, clone:NaEX96-104
          Length = 578

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330
           ||||||||||||||||||||||| ||||| ||||| |||||   ||||||||||||
Sbjct: 474 accttgccctggttgttgtactgcgatccgtggcaggggcacttgaacttgttctc 419



to top

>emb|BX826362.1|CNS0A4FZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB19ZF07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 714

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 96/118 (81%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| ||  | ||||||| ||| ||   |||||| |||||
Sbjct: 678 gttgtattgggatccatggcaaggacatggaaacttgtactcagctttgttccatggcac 619

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||||| ||||| || |||||||| ||||| || || || |||||||||
Sbjct: 618 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 561



to top

>emb|X63605.1|PSPETC P.sativum petC mRNA for chloroplast Rieske FeS protein
          Length = 880

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 38/41 (92%)
 Strand = Plus / Minus

                                                    
Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctc 330
           |||||||| ||||||||||| ||||||| ||||||||||||
Sbjct: 591 ttgtactgagatccatggcaggggcagatgaacttgttctc 551



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 413 accacaaggtaggtaggatcaccctt 438
           ||||||||||||||||||||||||||
Sbjct: 468 accacaaggtaggtaggatcaccctt 443



to top

>gb|AY826843.1| Heterocapsa triquetra clone HTCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 531

 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 87/107 (81%)
 Strand = Plus / Minus

                                                                       
Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334
           |||||||||| || ||||||||| ||||| ||||| ||||||| |||   |||| ||   
Sbjct: 276 accttgccctcgtcgttgtactgcgatccgtggcacgggcagatgaagcggttcgcgttc 217

                                                          
Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgat 381
             |||||| |||||||||||||| || || |||||||| ||||||||
Sbjct: 216 ctgttccagggcacgacgcagcccaggtgggtgcagaccgcgttgat 170



to top

>emb|AJ784853.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur protein (petC-2
           gene)
          Length = 874

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgtt 378
           |||||| || |||||||||||||| || ||||||||||||||
Sbjct: 554 gttccagggaacgacgcagccaaggtgagtgcagacggcgtt 513



 Score = 50.1 bits (25), Expect = 0.009
 Identities = 40/45 (88%)
 Strand = Plus / Minus

                                                        
Query: 419 aggtaggtaggatcacccttgagcccctgggcgagcgtgcggtcg 463
           |||||||| | ||| |||||||| ||||||||||||| |||||||
Sbjct: 472 aggtaggtggcatcgcccttgaggccctgggcgagcgagcggtcg 428



to top

>emb|BX826457.1|CNS0A4G1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB28ZC01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 532

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 38/42 (90%)
 Strand = Plus / Minus

                                                     
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctc 330
           |||||| ||||||||||||||||| || || |||||||||||
Sbjct: 252 gttgtattgggatccatggcaaggacatagaaacttgttctc 211



to top

>emb|BX826302.1|CNS0A381 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZB05 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 790

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 95/118 (80%)
 Strand = Plus / Minus

                                                                       
Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           |||||| ||||||||||||||||| || |  ||||||||||| ||   |||||| |||||
Sbjct: 553 gttgtattgggatccatggcaaggacataaaaacttgttctcagctttgttccatggcac 494

                                                                     
Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406
            || || |||||| | || || || |||||||| ||||| || || || |||||||||
Sbjct: 493 aacacatccaagaagagttcacactgcgttgataccgtatgtcgctagagtcttgtcg 436



to top

>emb|X06244.1|SORFES Spinach mRNA for Rieske FeS-precursor protein
          Length = 1024

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 98/122 (80%)
 Strand = Plus / Minus

                                                                       
Query: 251 gacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaa 310
           |||| ||||||||| || || |||||  |||| ||||| ||||| |||||||||||||| 
Sbjct: 683 gacaaaggtgcagggcctcgaacaactctgccttggttattgtattgggatccatggcat 624

                                                                       
Query: 311 gggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcag 370
           || || | ||| |||||||| || || ||  | ||||| || || |||||||| ||||||
Sbjct: 623 ggacaaatgaatttgttctcagcagcattaaatggcaccacacatccaagatgtgtgcag 564

             
Query: 371 ac 372
           ||
Sbjct: 563 ac 562



to top

>gb|AF110783.1|AF110783 Volvox carteri f. nagariensis clone G9 rieske iron-sulfur protein
           precursor (petC) mRNA, nuclear gene encoding chloroplast
           protein, complete cds
          Length = 1159

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 109/137 (79%)
 Strand = Plus / Minus

                                                                       
Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301
           |||||||  ||||| || ||||| |||||||| ||||||||||     |||||||| || 
Sbjct: 553 agggccaaagacagcggagcagggccacggaccaccttgccctcagcattgtactgagag 494

                                                                       
Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361
           || |||||||||||   ||||||||||||||| ||   |||||| ||||| ||||| |  
Sbjct: 493 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggaacgacacagcccaag 434

                            
Query: 362 tgcgtgcagacggcgtt 378
           || ||||| ||||||||
Sbjct: 433 tgggtgcacacggcgtt 417



to top

>gb|AY267656.1| Bigelowiella natans Fe-S subunit of cytochrome c6f complex mRNA,
           complete cds; nuclear gene for plastid product
          Length = 1025

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                   
Query: 292 gtactgggatccatggcaagggca 315
           ||||||||||||||||||||||||
Sbjct: 653 gtactgggatccatggcaagggca 630



to top

>emb|X76299.1|CRPETC C.reinhardtii petC gene
          Length = 1608

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 57/68 (83%)
 Strand = Plus / Minus

                                                                        
Query: 266  ccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagaggaacttg 325
            |||||||| ||||||||||    ||||||||| || || |||||||||||   |||||||
Sbjct: 1171 ccacggaccaccttgccctcagcgttgtactgagagccgtggcaagggcacttgaacttg 1112

                    
Query: 326  ttctcggc 333
            ||||||||
Sbjct: 1111 ttctcggc 1104



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 340 ccaaggcacgacgcagccaagatgcgtgcagacggcgtt 378
           |||||||||||||||||| || || ||||| ||||||||
Sbjct: 959 ccaaggcacgacgcagcccaggtgagtgcacacggcgtt 921



to top

>emb|X66009.1|NTRFES1 N.tabacum mRNA for chloroplast Rieske FeS precursor protein 1
          Length = 814

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 284 tggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330
           ||||||||||| || ||||||||||| ||||| |  |||||||||||
Sbjct: 592 tggttgttgtattgagatccatggcaggggcaaataaacttgttctc 546



to top

>emb|X64353.1|NTRFSCBFC N.tabacum mRNA for Rieske Fe/S protein of cytochrome b6/f complex
          Length = 833

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                          
Query: 284 tggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330
           ||||||||||| || ||||||||||| ||||| |  |||||||||||
Sbjct: 556 tggttgttgtattgagatccatggcaggggcaaataaacttgttctc 510



to top

>emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome; segment 5/7
          Length = 349746

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 337   gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgta 387
             |||||||||||| |||||||| || || |||||||  |||||||| |||||
Sbjct: 12422 gttccaaggcaccacgcagccgaggtgggtgcagatcgcgttgattccgta 12372



to top

>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7
          Length = 349122

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                         
Query: 305   tggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgc 364
             ||||||||||| | |||||||||  || ||  |||||| ||||| |||||||| || || 
Sbjct: 17548 tggcaagggcacatgaacttgttggcgccgctgttccagggcaccacgcagcccaggtgg 17489

                                    
Query: 365   gtgcagacggcgttgatcccgta 387
             ||||||| |||||| || |||||
Sbjct: 17488 gtgcagatggcgttaatgccgta 17466



to top

>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence
          Length = 3694126

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 208     gacgaccttgccgtcgtcgacg 229
               ||||||||||||||||||||||
Sbjct: 1061182 gacgaccttgccgtcgtcgacg 1061203



to top

>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome
          Length = 2696255

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 46/54 (85%)
 Strand = Plus / Minus

                                                                    
Query: 335    gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtag 388
              |||||||||||||| |||||||| |  || ||||| || |||||||| ||||||
Sbjct: 367671 gcgttccaaggcaccacgcagcccaagtgggtgcaaactgcgttgatgccgtag 367618



to top

>gb|AY826844.1| Isochrysis galbana clone ISCB61 chloroplast cytochrome b6 mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 1010

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 91/114 (79%)
 Strand = Plus / Minus

                                                                       
Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351
           |||||| || || ||||| ||||||| | |||||  || ||||  |||||| || |||||
Sbjct: 521 gtactgcgagccgtggcacgggcagatgtacttgagctgggcgcggttccatgggacgac 462

                                                                 
Query: 352 gcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtc 405
           |||||| || || ||||| || ||||||||  ||||| |  |||||||||||||
Sbjct: 461 gcagccgaggtgggtgcaaacagcgttgatggcgtagttctcgagggtcttgtc 408



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 202     cacgaagacgaccttgccgtcg 223
               ||||||||||||||||||||||
Sbjct: 3591632 cacgaagacgaccttgccgtcg 3591653



to top

>gb|AY487229.1| Mycobacterium fortuitum PgaE gene, partial cds; putative
            transcription regulator, hypothetical protein, Erm(39),
            3355, and FolD genes, complete cds; and 3359 gene,
            partial cds
          Length = 4803

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 217  gccgtcgtcgacgtcggcgtga 238
            ||||||||||||||||||||||
Sbjct: 3357 gccgtcgtcgacgtcggcgtga 3336



to top

>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome
          Length = 2695903

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 46/54 (85%)
 Strand = Plus / Plus

                                                                     
Query: 335     gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtag 388
               |||||||||||||| |||||||| |  || ||||| || |||||||| ||||||
Sbjct: 1253134 gcgttccaaggcaccacgcagcccaagtgggtgcaaactgcgttgatgccgtag 1253187



to top

>dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic gene cluster
          Length = 104326

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 202   cacgaagacgaccttgccgtcg 223
             ||||||||||||||||||||||
Sbjct: 46173 cacgaagacgaccttgccgtcg 46152



to top

>gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete sequence
          Length = 214621

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 506    ttgccgagcttgtccttggcggcga 530
              ||||||||| |||||||||||||||
Sbjct: 148179 ttgccgagcgtgtccttggcggcga 148155



to top

>ref|NM_135169.2| Drosophila melanogaster Pez CG9493-RA (Pez), mRNA
          Length = 4527

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 506  ttgccgagcttgtccttggcggcga 530
            ||||||||| |||||||||||||||
Sbjct: 1064 ttgccgagcgtgtccttggcggcga 1040



to top

>gb|AF217284.1|AF217284 Drosophila melanogaster protein tyrosine phosphatase Pez (Pez)
           mRNA, complete cds
          Length = 4433

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 506 ttgccgagcttgtccttggcggcga 530
           ||||||||| |||||||||||||||
Sbjct: 955 ttgccgagcgtgtccttggcggcga 931



to top

>gb|AE003613.4| Drosophila melanogaster chromosome 2L, section 22 of 83 of the complete
              sequence
          Length = 280095

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 506    ttgccgagcttgtccttggcggcga 530
              ||||||||| |||||||||||||||
Sbjct: 119693 ttgccgagcgtgtccttggcggcga 119717



to top

>gb|AC005285.1|AC005285 Drosophila melanogaster DNA sequence (P1s DS00121 (D128), DS05470 (D270),
              and DS00108 (D120)), complete sequence
          Length = 209071

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 506    ttgccgagcttgtccttggcggcga 530
              ||||||||| |||||||||||||||
Sbjct: 133047 ttgccgagcgtgtccttggcggcga 133071



to top

>ref|NM_018094.2| Homo sapiens G1 to S phase transition 2 (GSPT2), mRNA
          Length = 2503

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 540 cgttgctcccggagccggccggga 563
           ||||||| ||||||||||||||||
Sbjct: 464 cgttgctgccggagccggccggga 441



to top

>gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, complete sequence
          Length = 215810

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 88    ttaggactggcaggaggctt 107
             ||||||||||||||||||||
Sbjct: 14455 ttaggactggcaggaggctt 14436



to top

>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome
          Length = 2467205

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 510     cgagcttgtccttggcggcg 529
               ||||||||||||||||||||
Sbjct: 1291092 cgagcttgtccttggcggcg 1291073



to top

>ref|XM_659574.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7062.2), mRNA
          Length = 1668

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 204 cgaagacgaccttgccgtcg 223
           ||||||||||||||||||||
Sbjct: 976 cgaagacgaccttgccgtcg 957



to top

>ref|XM_754954.1| Ustilago maydis 521 hypothetical protein (UM03900.1) partial mRNA
          Length = 3015

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 306  ggcaagggcagaggaacttg 325
            ||||||||||||||||||||
Sbjct: 1647 ggcaagggcagaggaacttg 1628



to top

>gb|AC125332.3| Mus musculus BAC clone RP23-113I20 from 3, complete sequence
          Length = 220068

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 303    catggcaagggcagaggaac 322
              ||||||||||||||||||||
Sbjct: 148711 catggcaagggcagaggaac 148730



to top

>gb|AC121928.2| Mus musculus BAC clone RP24-204F1 from 3, complete sequence
          Length = 178387

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 303    catggcaagggcagaggaac 322
              ||||||||||||||||||||
Sbjct: 151789 catggcaagggcagaggaac 151770



to top

>emb|AL929101.4| Human DNA sequence from clone RP11-22B10 on chromosome X Contains the
             GSPT2 gene for G1 to S phase transition 2, a pseudogene
             similar to part of p30 (nuclear protein p30), a zinc
             finger protein pseudogene, the 5' end of a variant of the
             MAGED1 gene for melanoma antigen, family D, 1 and two CpG
             islands, complete sequence
          Length = 157110

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 540   cgttgctcccggagccggccggga 563
             ||||||| ||||||||||||||||
Sbjct: 40236 cgttgctgccggagccggccggga 40213



to top

>emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chromosome 6 contains the
             HLA-DPA1 gene for major histocompatibility complex, class
             II, DP alpha 1, the HLA-DPB1 gene for major
             histocompatibility complex, class II, DP beta 1, a
             ribosomal protein L32 (RPL32) pseudogene, the HLA-DPA2
             pseudogene for major histocompatibility complex, class II,
             DP alpha 2, a pseudogene similar to part of collagens, a
             novel protein similar to major histocompatibility complex,
             class II, DP beta 2 (pseudogene), a major
             histocompatibility complex, class II, DP beta 1
             pseudogene, two putative novel transcripts, the COL11A2
             gene for collagen, type XI, alpha 2, the RXRB gene for
             retinoid X receptor, beta, the HKE4 gene for HLA-class II
             region expressed gene KE4, the 5' end of the HSD17B8 gene
             for hydroxysteroid (17-beta) dehydrogenase 8 and four CpG
             islands, complete sequence
          Length = 187964

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   tggcaagggcagaggaactt 324
             ||||||||||||||||||||
Sbjct: 38046 tggcaagggcagaggaactt 38027



to top

>emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on chromosome 6 Contains the
             HLA-DOA, HLA-DPA1 and HLA-DPB1 genes for major
             histocompatibility complex class II proteins DO alpha, DP
             alpha 1 and DP beta 1, the HLA-DPA2 major
             histocompatibility complex class II DP alpha 2 pseudogene,
             ribosomal protein L32 pseudogene RPL32P1, a pseudogene
             similar to part of collagens, the 5' end of an HLA class
             II histocompatibility antigen D or S beta pseudogene, the
             5' end of a novel protein similar to major
             histocompatibility complex class II DP beta 1 precursor
             and a CpG island, complete sequence
          Length = 124899

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   tggcaagggcagaggaactt 324
             ||||||||||||||||||||
Sbjct: 63756 tggcaagggcagaggaactt 63737



to top

>ref|XM_783177.1| PREDICTED: Strongylocentrotus purpuratus similar to tripartite
           motif protein TRIM2 (LOC583257), mRNA
          Length = 1002

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 485 caatcctcgacgaggatgtc 504
           ||||||||||||||||||||
Sbjct: 776 caatcctcgacgaggatgtc 757



to top

>gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 map 14, complete sequence
          Length = 180338

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 88     ttaggactggcaggaggctt 107
              ||||||||||||||||||||
Sbjct: 173120 ttaggactggcaggaggctt 173101



to top

>gb|BC036077.1| Homo sapiens G1 to S phase transition 2, mRNA (cDNA clone MGC:33729
           IMAGE:5313878), complete cds
          Length = 2513

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 540 cgttgctcccggagccggccggga 563
           ||||||| ||||||||||||||||
Sbjct: 464 cgttgctgccggagccggccggga 441



to top

>emb|AJ251548.1|HSA251548 Homo sapiens mRNA for polypeptide chain release factor 3b (GSPT2
           gene)
          Length = 1887

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 540 cgttgctcccggagccggccggga 563
           ||||||| ||||||||||||||||
Sbjct: 268 cgttgctgccggagccggccggga 245



to top

>emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chromosome 6, complete
             sequence
          Length = 119898

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 305   tggcaagggcagaggaactt 324
             ||||||||||||||||||||
Sbjct: 58192 tggcaagggcagaggaactt 58173



to top

>emb|CR861342.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1511 (from clone DKFZp459J1511)
          Length = 2532

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 540 cgttgctcccggagccggccggga 563
           ||||||| ||||||||||||||||
Sbjct: 482 cgttgctgccggagccggccggga 459



to top

>gb|AC087892.16| Homo sapiens 12q BAC RP11-3L23 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 123004

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 38   atacaagaaacaggtgcatt 57
            ||||||||||||||||||||
Sbjct: 2769 atacaagaaacaggtgcatt 2788



to top

>gb|AE005819.1| Caulobacter crescentus CB15 section 145 of 359 of the complete
           genome
          Length = 10591

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 512 agcttgtccttggcggcgacccct 535
           ||||||||||||||| ||||||||
Sbjct: 434 agcttgtccttggcgccgacccct 457



to top

>gb|AC098615.2| Homo sapiens chromosome 3 clone RP11-268I20, complete sequence
          Length = 167486

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 42     aagaaacaggtgcatttata 61
              ||||||||||||||||||||
Sbjct: 151940 aagaaacaggtgcatttata 151921



to top

>dbj|AK023155.1| Homo sapiens cDNA FLJ13093 fis, clone NT2RP3002151, highly similar
           to G1 TO S PHASE TRANSITION PROTEIN 1 HOMOLOG
          Length = 2492

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 540 cgttgctcccggagccggccggga 563
           ||||||| ||||||||||||||||
Sbjct: 454 cgttgctgccggagccggccggga 431



to top

>dbj|AK001303.1| Homo sapiens cDNA FLJ10441 fis, clone NT2RP1000733, highly similar
           to Human mRNA for GSPT1-TK protein
          Length = 2481

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 540 cgttgctcccggagccggccggga 563
           ||||||| ||||||||||||||||
Sbjct: 448 cgttgctgccggagccggccggga 425



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 489     cctcgacgaggatgtcgttgccga 512
               ||||||||| ||||||||||||||
Sbjct: 2955444 cctcgacgatgatgtcgttgccga 2955467



to top

>gb|AF336983.1|AF336983 Vaucheria litorea cytochrome b6f complex Rieske FeS protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 222

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 293 tactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348
           ||||| || ||||||||||| |||| ||||||||| || ||   ||||||||||||
Sbjct: 128 tactgcgacccatggcaaggacagatgaacttgttttcagccttgttccaaggcac 73



to top

>emb|AL606597.4|OSJN00042 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0045P24,
              complete sequence
          Length = 124420

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 3      tttctcttctttntagactgtat 25
              |||||||||||| ||||||||||
Sbjct: 103410 tttctcttctttttagactgtat 103388



to top

>gb|AC012451.8| Homo sapiens BAC clone RP11-414K19 from 2, complete sequence
          Length = 188121

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 306    ggcaagggcagaggaacttg 325
              ||||||||||||||||||||
Sbjct: 179433 ggcaagggcagaggaacttg 179452



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 210     cgaccttgccgtcgtcgacg 229
               ||||||||||||||||||||
Sbjct: 2036408 cgaccttgccgtcgtcgacg 2036389



to top

>gb|AE005063.1| Halobacterium sp. NRC-1 section 94 of 170 of the complete genome
          Length = 11844

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                        
Query: 447  gggcgagcgtgcggtcgttggggccgtg 474
            |||||||||||||||||| |||| ||||
Sbjct: 3239 gggcgagcgtgcggtcgtcggggtcgtg 3212



to top

>gb|AF203698.1|AF203698 Rattus norvegicus T calcium channel alpha1G subunit (Cacna1g) gene,
            partial cds
          Length = 4171

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 427  aggatcacccttgagcccctgggc 450
            ||||||||||||||||| ||||||
Sbjct: 3868 aggatcacccttgagcctctgggc 3845



to top

>gb|U04283.1|SAPHSA Streptomyces antibioticus IMRU3720 phenoxazinone synthase (phsA)
            gene, complete cds
          Length = 2302

 Score = 40.1 bits (20), Expect = 9.0
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 217  gccgtcgtcgacgtcggcgt 236
            ||||||||||||||||||||
Sbjct: 1257 gccgtcgtcgacgtcggcgt 1238


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,903,136
Number of Sequences: 3902068
Number of extensions: 3903136
Number of successful extensions: 64515
Number of sequences better than 10.0: 112
Number of HSP's better than 10.0 without gapping: 113
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 63562
Number of HSP's gapped (non-prelim): 929
length of query: 657
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 634
effective length of database: 17,143,297,704
effective search space: 10868850744336
effective search space used: 10868850744336
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top