Clone Name | rbah61h07 |
---|---|
Clone Library Name | barley_pub |
>gb|AY123422.1| Triticum aestivum putative Rieske Fe-S precursor protein mRNA, complete cds Length = 866 Score = 1092 bits (551), Expect = 0.0 Identities = 621/644 (96%), Gaps = 2/644 (0%) Strand = Plus / Minus Query: 16 tagactgtatacatataactggatacaagaaacaggtgcatttatagcaggagtactctt 75 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 857 tagactgtatacatataactggatacaagaaacaggtgcatttatagcaggagtagtctt 798 Query: 76 at--agcagcgttcttaggactggcaggaggcttaacatatcacacgagtgagctttgct 133 || ||||||||||||||||||||||||||||||||||||||||| |||||||| ||||| Sbjct: 797 atgtagcagcgttcttaggactggcaggaggcttaacatatcacaggagtgagcattgct 738 Query: 134 gccggagcttgtgtcgcttatttccaccacgggttctcgccggtcctgaagtcggtctcc 193 ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 737 gccggagcttgcgtcgcttatttccaccacgggttgtcgccggtcctgaagtcggtctcc 678 Query: 194 acccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253 ||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 677 acccacggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaaccagggccagcgac 618 Query: 254 agaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaaggg 313 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 617 agaggtgcaggcccacggacaaccttgccctggttgttgtactgggatccatggcagggg 558 Query: 314 cagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacg 373 ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||| Sbjct: 557 cagaggaacttgttctcggcggcgttccacggcacgacgcatccaagatgcgtgcacacg 498 Query: 374 gcgttgatcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatca 433 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 497 gcgttgatcccgtaggtggcaagggtcttgtcggactccaccacaaggtaggtaggatca 438 Query: 434 cccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcg 493 ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||| Sbjct: 437 cccttgagcccctgggccagcgtgcggtcgttggggccgtgcgtcttgagccagtcctcg 378 Query: 494 acgaggatgtcgttgccgagcttgtccttggcggcgacccctccggcgttgctcccggag 553 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 377 acgaggatgtcgttgccgagcttgtccttggcggcgacccctccggcgttgctcccggag 318 Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 317 ccggcggggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 258 Query: 614 gcgcccagcagcangagggtcatcagctncctcttgctcatgtc 657 ||||||||||| | ||| ||||||||| ||||||||||||||| Sbjct: 257 gcgcccagcaggagcaggttcatcagctccctcttgctcatgtc 214
>emb|AJ222783.1|HVJ222783 Hordeum vulgare mRNA for cytochrome b6/f-complex iron-sulfur like-protein, clone RG115 Length = 275 Score = 537 bits (271), Expect = e-149 Identities = 271/271 (100%) Strand = Plus / Minus Query: 170 tcgccggtcctgaagtcggtctccacccatggcacgaagacgaccttgccgtcgtcgacg 229 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 275 tcgccggtcctgaagtcggtctccacccatggcacgaagacgaccttgccgtcgtcgacg 216 Query: 230 tcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaaccttgccctggttg 289 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 215 tcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaaccttgccctggttg 156 Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 155 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 96 Query: 350 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 95 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 36 Query: 410 tccaccacaaggtaggtaggatcacccttga 440 ||||||||||||||||||||||||||||||| Sbjct: 35 tccaccacaaggtaggtaggatcacccttga 5
>dbj|AK071634.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023100K03, full insert sequence Length = 1082 Score = 521 bits (263), Expect = e-145 Identities = 441/501 (88%) Strand = Plus / Minus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216 |||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||| Sbjct: 725 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 666 Query: 217 gccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaac 276 ||||||||||||||||||||| || | ||||||||||| || |||||||||||||| || Sbjct: 665 gccgtcgtcgacgtcggcgtgcaccaatgccagcgacaggggagcaggtccacggacgac 606 Query: 277 cttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggc 336 | ||||||||||||||||||| || || ||||| ||||||| |||||||||||||||||| Sbjct: 605 cctgccctggttgttgtactgcgagccgtggcaggggcagatgaacttgttctcggcggc 546 Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgag 396 |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| ||||| || Sbjct: 545 gttccacggcacgacgcacccaaggtgcgtgcacacggcgttgatcccgtacgtggccag 486 Query: 397 ggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagcgt 456 |||||||||| |||||| || ||||| || || ||||||||||||||||||| ||| || Sbjct: 485 cgtcttgtcggcctccacgacgaggtacgtcgggtcacccttgagcccctgggtgagggt 426 Query: 457 gcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagctt 516 |||||||||||||||||| ||||||||||| |||||| |||| | ||||||||||||||| Sbjct: 425 gcggtcgttggggccgtgtgtcttgagccactcctcggcgagcacgtcgttgccgagctt 366 Query: 517 gtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggagcc 576 |||||||||| | ||| ||| || | ||||||| ||||| |||| || ||||| ||| Sbjct: 365 gtccttggcgacctgcccgccgccggcgttcccggacccggcggggatgaagaaggcgcc 306 Query: 577 gtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcangagggtcat 636 |||||||||||||||||||| ||||||||||||||||||||| ||||| | |||| |||| Sbjct: 305 gtaggggacgagcatgccgacggtggggagcgagatggcgccgagcaggaggaggttcat 246 Query: 637 cagctncctcttgctcatgtc 657 ||||| | ||||| |||||| Sbjct: 245 cagctggcgcttgcccatgtc 225
>gb|AF093631.1|AF093631 Oryza sativa Rieske Fe-S precursor protein (RISP) mRNA, complete cds Length = 919 Score = 521 bits (263), Expect = e-145 Identities = 441/501 (88%) Strand = Plus / Minus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216 |||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||| Sbjct: 713 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 654 Query: 217 gccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggacaac 276 ||||||||||||||||||||| || | ||||||||||| || |||||||||||||| || Sbjct: 653 gccgtcgtcgacgtcggcgtgcaccaatgccagcgacaggggagcaggtccacggacgac 594 Query: 277 cttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggc 336 | ||||||||||||||||||| || || ||||| ||||||| |||||||||||||||||| Sbjct: 593 cctgccctggttgttgtactgcgagccgtggcaggggcagatgaacttgttctcggcggc 534 Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgag 396 |||||| ||||||||||| ||||| |||||||| ||||||||||||||||| ||||| || Sbjct: 533 gttccacggcacgacgcacccaaggtgcgtgcacacggcgttgatcccgtacgtggccag 474 Query: 397 ggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagcgt 456 |||||||||| |||||| || ||||| || || ||||||||||||||||||| ||| || Sbjct: 473 cgtcttgtcggcctccacgacgaggtacgtcgggtcacccttgagcccctgggtgagggt 414 Query: 457 gcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagctt 516 |||||||||||||||||| ||||||||||| |||||| |||| | ||||||||||||||| Sbjct: 413 gcggtcgttggggccgtgtgtcttgagccactcctcggcgagcacgtcgttgccgagctt 354 Query: 517 gtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggagcc 576 |||||||||| | ||| ||| || | ||||||| ||||| |||| || ||||| ||| Sbjct: 353 gtccttggcgacctgcccgccgccggcgttcccggacccggcggggatgaagaaggcgcc 294 Query: 577 gtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcangagggtcat 636 |||||||||||||||||||| ||||||||||||||||||||| ||||| | |||| |||| Sbjct: 293 gtaggggacgagcatgccgacggtggggagcgagatggcgccgagcaggaggaggttcat 234 Query: 637 cagctncctcttgctcatgtc 657 ||||| | ||||| |||||| Sbjct: 233 cagctggcgcttgcccatgtc 213
>gb|BT016255.1| Zea mays clone Contig88 mRNA sequence Length = 998 Score = 507 bits (256), Expect = e-140 Identities = 429/487 (88%) Strand = Plus / Minus Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214 ||||||||||||| |||||||||||||||||||||||||||||| || ||||||| |||| Sbjct: 746 ttccaccacgggtcctcgccggtcctgaagtcggtctccacccacgggacgaagaggacc 687 Query: 215 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274 |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| Sbjct: 686 ttgccgtcgtcgacgtcggcgtgaaccagggccagcgacagaggcgccggtccacggacc 627 Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334 ||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||||||| Sbjct: 626 accttgccctggttgttgtactgggatccgtggcatgggcagatgaacttgttctcggcg 567 Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394 ||||||| |||||||||||||| || || ||||| ||||||||||||||||||||||| Sbjct: 566 ccgttccacggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggcc 507 Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454 || |||||||| ||||||||| ||||| || || ||||||||||||||||| |||||| Sbjct: 506 agcgtcttgtcctgctccaccaccaggtacgtggggtcacccttgagcccctgcgcgagc 447 Query: 455 gtgcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagc 514 ||||| |||||||| |||||||| |||||||| |||| || |||||||||||| ||| Sbjct: 446 gtgcgatcgttgggaccgtgcgtgttgagccacgcctccaccgtgatgtcgttgcccagc 387 Query: 515 ttgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggag 574 |||||||||||| | ||| ||| || | ||||||||||||| ||||||| ||||| | Sbjct: 386 ttgtccttggcgtaggtcccgccgccggcgttcccggagccggcagggacgaagaaggcg 327 Query: 575 ccgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcangagggtc 634 ||||||||||||| |||||||| |||||| | |||||||||||| || || | |||| || Sbjct: 326 ccgtaggggacgaccatgccgacggtgggcaacgagatggcgccgaggaggaggaggttc 267 Query: 635 atcagct 641 ||||||| Sbjct: 266 atcagct 260
>gb|AY104934.1| Zea mays PCO071754 mRNA sequence Length = 1058 Score = 507 bits (256), Expect = e-140 Identities = 429/487 (88%) Strand = Plus / Minus Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214 |||||||| |||| |||||||||||||||||||||||||||||| || ||||||| |||| Sbjct: 805 ttccaccatgggtcctcgccggtcctgaagtcggtctccacccacgggacgaagaggacc 746 Query: 215 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274 |||||||||||||||||||||||||| ||||||||||||||||| || ||||||||||| Sbjct: 745 ttgccgtcgtcgacgtcggcgtgaaccagggccagcgacagaggcgccggtccacggacc 686 Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334 ||||||||||||||||||||||||||||| ||||| ||||||| |||||||||||| ||| Sbjct: 685 accttgccctggttgttgtactgggatccgtggcaggggcagatgaacttgttctcagcg 626 Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394 ||||||| |||||||||||||| || || ||||| ||||||||||||||||||||||| Sbjct: 625 ccgttccacggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggcc 566 Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454 || |||||||| ||||||||| ||||| || || ||||||||||||||||| |||||| Sbjct: 565 agcgtcttgtcctgctccaccaccaggtacgtggggtcacccttgagcccctgcgcgagc 506 Query: 455 gtgcggtcgttggggccgtgcgtcttgagccaatcctcgacgaggatgtcgttgccgagc 514 |||||||||||||| |||||||| |||||||| ||||| || |||||||||||| ||| Sbjct: 505 gtgcggtcgttgggaccgtgcgtgttgagccactcctccaccgtgatgtcgttgcccagc 446 Query: 515 ttgtccttggcggcgacccctccggcgttgctcccggagccggccgggacgaggaaggag 574 |||||||||||| | ||| ||| || | ||||||||||||| ||||||| ||||| | Sbjct: 445 ttgtccttggcgtaggtcccgccgccggcgttcccggagccggcagggacgaagaaggcg 386 Query: 575 ccgtaggggacgagcatgccgaaggtggggagcgagatggcgcccagcagcangagggtc 634 ||||||||||||| |||||||| |||||| | |||||||||||| || || | |||| || Sbjct: 385 ccgtaggggacgaccatgccgacggtgggcaacgagatggcgccgaggaggaggaggttc 326 Query: 635 atcagct 641 ||||||| Sbjct: 325 atcagct 319
>gb|AY581830.1| Cynodon dactylon putative Rieske Fe-S precursor protein mRNA, partial cds Length = 511 Score = 315 bits (159), Expect = 1e-82 Identities = 285/327 (87%) Strand = Plus / Minus Query: 155 ttccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacc 214 |||||||| |||| |||||||||||||||||||||||||||||| || ||||| | | || Sbjct: 327 ttccaccaggggtcctcgccggtcctgaagtcggtctccacccacgggacgaaaagggcc 268 Query: 215 ttgccgtcgtcgacgtcggcgtgaacgagggccagcgacagaggtgcaggtccacggaca 274 |||||||||||||||||||||||||| | |||||||||||| || || ||||||||||| Sbjct: 267 ttgccgtcgtcgacgtcggcgtgaaccaaggccagcgacagtggcgccggtccacggacg 208 Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334 ||||||||||||||||||||||||||||| ||||| ||| | | |||||||||||||| | Sbjct: 207 accttgccctggttgttgtactgggatccgtggcatgggtacatgaacttgttctcgggg 148 Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcg 394 | ||||| ||||||||||| || || || |||||||| |||||||| ||||||||||| Sbjct: 147 ggattccacggcacgacgcatcccaggtgggtgcagaccgcgttgatgccgtaggtggcc 88 Query: 395 agggtcttgtcggactccaccacaaggtaggtaggatcacccttgagcccctgggcgagc 454 || |||||||| ||||| || ||||| || || ||||||||||||||||| | |||| Sbjct: 87 agcgtcttgtccttgtccacgaccaggtacgtggggtcacccttgagcccctgcgtgagc 28 Query: 455 gtgcggtcgttggggccgtgcgtcttg 481 |||||||| |||||||||||||||||| Sbjct: 27 gtgcggtctttggggccgtgcgtcttg 1
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 194 bits (98), Expect = 3e-46 Identities = 158/178 (88%) Strand = Plus / Minus Query: 260 gcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagagg 319 |||||||||||||| ||| ||||||||||||||||||| || || ||||| ||||||| | Sbjct: 22132649 gcaggtccacggacgaccctgccctggttgttgtactgcgagccgtggcaggggcagatg 22132590 Query: 320 aacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttg 379 ||||||||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||| Sbjct: 22132589 aacttgttctcggcggcgttccacggcacgacgcacccaaggtgcgtgcacacggcgttg 22132530 Query: 380 atcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatcaccct 437 |||||||| ||||| || |||||||||| |||||| || ||||| || || ||||||| Sbjct: 22132529 atcccgtacgtggccagcgtcttgtcggcctccacgacgaggtacgtcgggtcaccct 22132472 Score = 129 bits (65), Expect = 1e-26 Identities = 77/81 (95%) Strand = Plus / Minus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216 |||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||| Sbjct: 22132954 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 22132895 Query: 217 gccgtcgtcgacgtcggcgtg 237 ||||||||||||||||||||| Sbjct: 22132894 gccgtcgtcgacgtcggcgtg 22132874 Score = 127 bits (64), Expect = 5e-26 Identities = 85/92 (92%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |||||| Sbjct: 22132386 ccttgagcccctgggtgagggtgcggtcgttggggccgtgtgtcttgagccactcctcgg 22132327 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 |||| | ||||||||||||||||||||||||| Sbjct: 22132326 cgagcacgtcgttgccgagcttgtccttggcg 22132295 Score = 107 bits (54), Expect = 5e-20 Identities = 91/104 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| |||| || ||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct: 22132170 ccggcggggatgaagaaggcgccgtaggggacgagcatgccgacggtggggagcgagatg 22132111 Query: 614 gcgcccagcagcangagggtcatcagctncctcttgctcatgtc 657 ||||| ||||| | |||| ||||||||| | ||||| |||||| Sbjct: 22132110 gcgccgagcaggaggaggttcatcagctggcgcttgcccatgtc 22132067
>dbj|AP005125.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0058I18 Length = 151453 Score = 194 bits (98), Expect = 3e-46 Identities = 158/178 (88%) Strand = Plus / Minus Query: 260 gcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagagg 319 |||||||||||||| ||| ||||||||||||||||||| || || ||||| ||||||| | Sbjct: 86305 gcaggtccacggacgaccctgccctggttgttgtactgcgagccgtggcaggggcagatg 86246 Query: 320 aacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttg 379 ||||||||||||||||||||||| ||||||||||| ||||| |||||||| ||||||||| Sbjct: 86245 aacttgttctcggcggcgttccacggcacgacgcacccaaggtgcgtgcacacggcgttg 86186 Query: 380 atcccgtaggtggcgagggtcttgtcggactccaccacaaggtaggtaggatcaccct 437 |||||||| ||||| || |||||||||| |||||| || ||||| || || ||||||| Sbjct: 86185 atcccgtacgtggccagcgtcttgtcggcctccacgacgaggtacgtcgggtcaccct 86128 Score = 129 bits (65), Expect = 1e-26 Identities = 77/81 (95%) Strand = Plus / Minus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccacccatggcacgaagacgacctt 216 |||||||||||| ||||||||||||||||||||||||||||| |||||||||| ||||| Sbjct: 86610 ccaccacgggttgtcgccggtcctgaagtcggtctccacccacggcacgaagagaacctt 86551 Query: 217 gccgtcgtcgacgtcggcgtg 237 ||||||||||||||||||||| Sbjct: 86550 gccgtcgtcgacgtcggcgtg 86530 Score = 127 bits (64), Expect = 5e-26 Identities = 85/92 (92%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||||| ||| |||||||||||||||||||| ||||||||||| |||||| Sbjct: 86042 ccttgagcccctgggtgagggtgcggtcgttggggccgtgtgtcttgagccactcctcgg 85983 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 |||| | ||||||||||||||||||||||||| Sbjct: 85982 cgagcacgtcgttgccgagcttgtccttggcg 85951 Score = 107 bits (54), Expect = 5e-20 Identities = 91/104 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| |||| || ||||| ||||||||||||||||||||||| |||||||||||||||| Sbjct: 85826 ccggcggggatgaagaaggcgccgtaggggacgagcatgccgacggtggggagcgagatg 85767 Query: 614 gcgcccagcagcangagggtcatcagctncctcttgctcatgtc 657 ||||| ||||| | |||| ||||||||| | ||||| |||||| Sbjct: 85766 gcgccgagcaggaggaggttcatcagctggcgcttgcccatgtc 85723
>gb|DQ427777.1| Sorghum propinquum locus HHU30 genomic sequence Length = 742 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 524 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 465 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 464 ccgtgatgtcgttgcccagcttgtccttggcg 433 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 320 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 261 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 260 gcgccgaggaggaggaggttcatcagct 233 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 739 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 680 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 679 tcctgctccaccaccaggtacgtcgggtcaccct 646
>gb|DQ427776.1| Sorghum bicolor voucher PI585454 locus HHU30 genomic sequence Length = 728 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632
>gb|DQ427775.1| Sorghum bicolor voucher PI267539 locus HHU30 genomic sequence Length = 731 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635
>gb|DQ427774.1| Sorghum bicolor voucher PI267408 locus HHU30 genomic sequence Length = 731 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635
>gb|DQ427773.1| Sorghum bicolor voucher PI221607 locus HHU30 genomic sequence Length = 725 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 722 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 663 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 662 tcctgctccaccaccaggtacgtcgggtcaccct 629
>gb|DQ427772.1| Sorghum bicolor voucher PI152702 locus HHU30 genomic sequence Length = 731 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635
>gb|DQ427771.1| Sorghum bicolor voucher NSL92371 locus HHU30 genomic sequence Length = 731 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635
>gb|DQ427770.1| Sorghum bicolor voucher NSL87902 locus HHU30 genomic sequence Length = 728 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632
>gb|DQ427769.1| Sorghum bicolor voucher NSL87666 locus HHU30 genomic sequence Length = 733 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 521 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 462 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 461 ccgtgatgtcgttgcccagcttgtccttggcg 430 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 730 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 671 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 670 tcctgctccaccaccaggtacgtcgggtcaccct 637
>gb|DQ427768.1| Sorghum bicolor voucher NSL77217 locus HHU30 genomic sequence Length = 731 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635
>gb|DQ427767.1| Sorghum bicolor voucher NSL77034 locus HHU30 genomic sequence Length = 723 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627
>gb|DQ427766.1| Sorghum bicolor voucher NSL56174 locus HHU30 genomic sequence Length = 723 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627
>gb|DQ427765.1| Sorghum bicolor voucher NSL56003 locus HHU30 genomic sequence Length = 723 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627
>gb|DQ427764.1| Sorghum bicolor voucher NSL55243 locus HHU30 genomic sequence Length = 723 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627
>gb|DQ427763.1| Sorghum bicolor voucher NSL51365 locus HHU30 genomic sequence Length = 723 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 517 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 458 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 457 ccgtgatgtcgttgcccagcttgtccttggcg 426 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 310 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 251 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 250 gcgccgaggaggaggaggttcatcagct 223 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 720 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 661 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 660 tcctgctccaccaccaggtacgtcgggtcaccct 627
>gb|DQ427762.1| Sorghum bicolor voucher NSL51030 locus HHU30 genomic sequence Length = 728 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 516 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 457 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 456 ccgtgatgtcgttgcccagcttgtccttggcg 425 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 725 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 666 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 665 tcctgctccaccaccaggtacgtcgggtcaccct 632
>gb|DQ427761.1| Sorghum bicolor voucher NSL50875 locus HHU30 genomic sequence Length = 725 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 722 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 663 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 662 tcctgctccaccaccaggtacgtcgggtcaccct 629
>gb|DQ427760.1| Sorghum bicolor voucher BTx623 locus HHU30 genomic sequence Length = 731 Score = 103 bits (52), Expect = 7e-19 Identities = 82/92 (89%) Strand = Plus / Minus Query: 435 ccttgagcccctgggcgagcgtgcggtcgttggggccgtgcgtcttgagccaatcctcga 494 ||||||||||||| || ||||||||||||||||| ||||||||||||||||| || || | Sbjct: 519 ccttgagcccctgcgccagcgtgcggtcgttgggaccgtgcgtcttgagccactcatcca 460 Query: 495 cgaggatgtcgttgccgagcttgtccttggcg 526 | |||||||||||| ||||||||||||||| Sbjct: 459 ccgtgatgtcgttgcccagcttgtccttggcg 428 Score = 89.7 bits (45), Expect = 1e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 554 ccggccgggacgaggaaggagccgtaggggacgagcatgccgaaggtggggagcgagatg 613 ||||| ||||||| ||||| |||||||||||||| |||||||| |||||| ||||||||| Sbjct: 312 ccggcggggacgaagaaggcgccgtaggggacgaccatgccgacggtgggcagcgagatg 253 Query: 614 gcgcccagcagcangagggtcatcagct 641 ||||| || || | |||| ||||||||| Sbjct: 252 gcgccgaggaggaggaggttcatcagct 225 Score = 83.8 bits (42), Expect = 7e-13 Identities = 81/94 (86%) Strand = Plus / Minus Query: 344 ggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttg 403 |||||||||||||| || || ||||| ||||||||||||||||||||||| || |||||| Sbjct: 728 ggcacgacgcagccgaggtgagtgcacacggcgttgatcccgtaggtggccagcgtcttg 669 Query: 404 tcggactccaccacaaggtaggtaggatcaccct 437 || ||||||||| ||||| || || ||||||| Sbjct: 668 tcctgctccaccaccaggtacgtcgggtcaccct 635
>gb|DQ122916.1| Chlamydomonas incerta chloroplast cytochrome B6/F complex rieske iron-sulfur protein (PetC) mRNA, partial cds; nuclear gene for chloroplast product Length = 1178 Score = 89.7 bits (45), Expect = 1e-14 Identities = 114/137 (83%) Strand = Plus / Minus Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301 |||||||||||||| || || || |||||||| |||||||||| ||||||||| || Sbjct: 443 agggccagcgacaggggagcggggccacggaccaccttgccctcagcgttgtactgagag 384 Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361 || ||||||||||| ||||||||||||||| || |||||||||||||||||| || Sbjct: 383 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggcacgacgcagcccagg 324 Query: 362 tgcgtgcagacggcgtt 378 || ||||| |||||||| Sbjct: 323 tgagtgcacacggcgtt 307
>dbj|D32003.1| Chlamydomonas reinhardtii mRNA for chloroplast Rieske Fe-S precursor protein, complete cds Length = 1436 Score = 89.7 bits (45), Expect = 1e-14 Identities = 114/137 (83%) Strand = Plus / Minus Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301 |||||||||||||| || || || |||||||| |||||||||| ||||||||| || Sbjct: 576 agggccagcgacaggggagcggggccacggaccaccttgccctcagcgttgtactgagag 517 Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361 || ||||||||||| ||||||||||||||| || |||||||||||||||||| || Sbjct: 516 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggcacgacgcagcccagg 457 Query: 362 tgcgtgcagacggcgtt 378 || ||||| |||||||| Sbjct: 456 tgagtgcacacggcgtt 440
>emb|AL731601.3|OSJN00245 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0044M19, complete sequence Length = 188317 Score = 87.7 bits (44), Expect = 4e-14 Identities = 88/103 (85%), Gaps = 6/103 (5%) Strand = Plus / Plus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210 |||||||||||| ||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 53046 ccaccacgggttgtcgccagtcctgaagtcggtctccactcacacccacggcacgaagag 53105 Query: 211 gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253 |||||| |||||||||||||||||||||| | ||||||||| Sbjct: 53106 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 53148
>gb|DQ384526.1| Panax ginseng clone PG6L-3 photosynthetic electron transfer-like protein mRNA, complete cds Length = 770 Score = 87.7 bits (44), Expect = 4e-14 Identities = 116/140 (82%) Strand = Plus / Minus Query: 251 gacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaa 310 |||||||| ||||| || | ||||||||||| |||||||||||||| ||||||||||| Sbjct: 528 gacagaggagcagggcctctaacaaccttgccttggttgttgtactgagatccatggcat 469 Query: 311 gggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcag 370 ||||| | |||||||||||| || ||||| ||||| || || |||||||||||||| Sbjct: 468 gggcacatgaacttgttctctgctttattccatggcacaacacaaccaagatgcgtgcac 409 Query: 371 acggcgttgatcccgtaggt 390 || || ||||| || ||||| Sbjct: 408 actgcattgataccataggt 389
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 87.7 bits (44), Expect = 4e-14 Identities = 88/103 (85%), Gaps = 6/103 (5%) Strand = Plus / Plus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210 |||||||||||| ||||| |||||||||||||||||||| ||| |||||||||| Sbjct: 18961122 ccaccacgggttgtcgccagtcctgaagtcggtctccactcacacccacggcacgaagag 18961181 Query: 211 gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253 |||||| |||||||||||||||||||||| | ||||||||| Sbjct: 18961182 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 18961224 Score = 40.1 bits (20), Expect = 9.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 3 tttctcttctttntagactgtat 25 |||||||||||| |||||||||| Sbjct: 8169878 tttctcttctttttagactgtat 8169856
>ref|NM_193963.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 705 Score = 81.8 bits (41), Expect = 3e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 189 tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 248 |||||||||| |||||||||| ||||||||||||||||||||||||||||| | |||| Sbjct: 160 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 101 Query: 249 gcgac 253 ||||| Sbjct: 100 gcgac 96
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 81.8 bits (41), Expect = 3e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 189 tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 248 |||||||||| |||||||||| ||||||||||||||||||||||||||||| | |||| Sbjct: 14242662 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 14242603 Query: 249 gcgac 253 ||||| Sbjct: 14242602 gcgac 14242598
>gb|AY826845.1| Pavlova lutheri clone PLCB61 chloroplast cytochrome b6 mRNA, partial cds; nuclear gene for chloroplast product Length = 640 Score = 81.8 bits (41), Expect = 3e-12 Identities = 77/89 (86%) Strand = Plus / Minus Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351 |||||| || || ||||| ||||||| |||||| | || ||||||||||| |||||||| Sbjct: 310 gtactgcgagccgtggcaggggcagatgaacttctgctgcgcggcgttccacggcacgac 251 Query: 352 gcagccaagatgcgtgcagacggcgttga 380 ||||||||| ||||||||||| ||||||| Sbjct: 250 gcagccaaggtgcgtgcagaccgcgttga 222
>dbj|AP002870.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0458A05 Length = 120593 Score = 81.8 bits (41), Expect = 3e-12 Identities = 59/65 (90%) Strand = Plus / Minus Query: 189 tctccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggcca 248 |||||||||| |||||||||| ||||||||||||||||||||||||||||| | |||| Sbjct: 38352 tctccacccacggcacgaagagaaccttgccgtcgtcgacgtcggcgtgaaccaatgcca 38293 Query: 249 gcgac 253 ||||| Sbjct: 38292 gcgac 38288
>gb|AY300039.1| Solanum tuberosum putative Rieske Fe-S protein precursor (FeS) mRNA, complete cds; nuclear gene for chloroplast product Length = 693 Score = 79.8 bits (40), Expect = 1e-11 Identities = 124/152 (81%) Strand = Plus / Minus Query: 287 ttgttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggc 346 |||||||| || ||||||||||||||||| | |||||||||||| || | ||||| ||| Sbjct: 557 ttgttgtattgagatccatggcaagggcaaatgaacttgttctcagcagtattccacggc 498 Query: 347 acgacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 ||||| || ||||| || ||||| || |||||||| || ||||| ||||| || ||| Sbjct: 497 acgacacaaccaaggtgagtgcacacagcgttgataccataggtcgcgagtgttccatcg 438 Query: 407 gactccaccacaaggtaggtaggatcaccctt 438 |||||| |||||||| |||||||| ||||| Sbjct: 437 ttctccacaacaaggtaagtaggatctccctt 406
>gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21H13, complete sequence Length = 101563 Score = 79.8 bits (40), Expect = 1e-11 Identities = 121/148 (81%) Strand = Plus / Minus Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349 ||||| ||||||||||||||||| || |||||||||||||| || |||||| ||||| Sbjct: 101211 ttgtattgggatccatggcaaggacataggaacttgttctcagctttgttccatggcaca 101152 Query: 350 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409 || || |||||||| ||||| || ||||| || ||||| || || || ||||||||| | Sbjct: 101151 acacatccaagatgtgtgcatactgcgtttataccgtatgtcgctagtgtcttgtcgttc 101092 Query: 410 tccaccacaaggtaggtaggatcaccct 437 ||||| || ||||| || ||||| |||| Sbjct: 101091 tccacaactaggtaagttggatctccct 101064
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 79.8 bits (40), Expect = 1e-11 Identities = 87/103 (84%), Gaps = 6/103 (5%) Strand = Plus / Minus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210 |||||||||||| ||||| ||||||||||| |||||||| ||| |||||||||| Sbjct: 8732264 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 8732205 Query: 211 gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253 |||||| |||||||||||||||||||||| | ||||||||| Sbjct: 8732204 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 8732162
>dbj|AP004875.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0463G12 Length = 145403 Score = 79.8 bits (40), Expect = 1e-11 Identities = 87/103 (84%), Gaps = 6/103 (5%) Strand = Plus / Minus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210 |||||||||||| ||||| ||||||||||| |||||||| ||| |||||||||| Sbjct: 139311 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 139252 Query: 211 gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253 |||||| |||||||||||||||||||||| | ||||||||| Sbjct: 139251 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 139209
>dbj|AP006844.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OSJNBa0052K15 Length = 156250 Score = 79.8 bits (40), Expect = 1e-11 Identities = 87/103 (84%), Gaps = 6/103 (5%) Strand = Plus / Minus Query: 157 ccaccacgggttctcgccggtcctgaagtcggtctccac------ccatggcacgaagac 210 |||||||||||| ||||| ||||||||||| |||||||| ||| |||||||||| Sbjct: 31343 ccaccacgggttgtcgccagtcctgaagtcagtctccactcacacccacggcacgaagag 31284 Query: 211 gaccttgccgtcgtcgacgtcggcgtgaacgagggccagcgac 253 |||||| |||||||||||||||||||||| | ||||||||| Sbjct: 31283 aaccttgtcgtcgtcgacgtcggcgtgaaccaatgccagcgac 31241
>gb|AF037456.1|AF037456 Fritillaria agrestis cytochrome B6-F complex iron-sulfur subunit precursor (petC) mRNA, complete cds Length = 881 Score = 77.8 bits (39), Expect = 4e-11 Identities = 72/83 (86%) Strand = Plus / Minus Query: 245 gccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatcca 304 |||||||||| ||||||||||| | ||||||||| || || |||||||| || ||||| Sbjct: 605 gccagcgacaacggtgcaggtcccctgacaaccttcccttgattgttgtattgcgatccg 546 Query: 305 tggcaagggcagaggaacttgtt 327 ||||| ||||||||||||||||| Sbjct: 545 tggcaggggcagaggaacttgtt 523
>ref|NM_116566.3| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C) AT4G03280 (PETC) transcript variant AT4G03280.1 mRNA, complete cds Length = 963 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 678 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 619 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 618 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 561
>ref|NM_178964.1| Arabidopsis thaliana PETC (PHOTOSYNTHETIC ELECTRON TRANSFER C) AT4G03280 (PETC) transcript variant AT4G03280.2 mRNA, complete cds Length = 1062 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 777 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 718 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 717 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 660
>gb|AC005275.1| Arabidopsis thaliana BAC F4C21 from chromosome IV, top arm, near 17 cM, complete sequence Length = 136335 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 74269 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 74210 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 74209 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 74152
>emb|AL161496.2|ATCHRIV8 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 8 Length = 195429 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 92641 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 92582 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 92581 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 92524
>emb|AJ292972.1|ATH292972 Arabidopsis thaliana petC gene for Rieske FeS protein, exons 1-5 Length = 2145 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 1917 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 1858 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 1857 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 1800
>emb|AJ243702.1|ATH243702 Arabidopsis thaliana mRNA for rieske iron-sulfur protein precursor (petC gene) Length = 957 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 654 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 595 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 594 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 537
>gb|AY093726.1| Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, complete cds Length = 633 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 492 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 433 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 432 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 375
>gb|AF410296.1|AF410296 Arabidopsis thaliana AT4g03280/F4C21_21 mRNA, complete cds Length = 1061 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 780 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 721 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 720 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 663
>gb|AF370566.1|AF370566 Arabidopsis thaliana putative component of cytochrome B6-F complex (F4C21.21) mRNA, complete cds Length = 732 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 549 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 490 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 489 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 432
>emb|BX827560.1|CNS0A2RQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS74ZE01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1358 Score = 75.8 bits (38), Expect = 2e-10 Identities = 98/118 (83%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || || ||||||||||| || |||||| ||||| Sbjct: 1133 gttgtattgggatccatggcaaggacatagaaacttgttctcagctttgttccatggcac 1074 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 1073 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 1016
>emb|AJ784852.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur protein (petC-1 gene) Length = 864 Score = 73.8 bits (37), Expect = 6e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351 ||||||||| || ||||| ||||| | |||||||||||| | |||||||| || ||||| Sbjct: 615 gtactgggagccgtggcacgggcacatgaacttgttctccgacgcgttccacgggacgac 556 Query: 352 gcagccaagatgcgtgcagacggcgttga 380 ||| ||||| || |||||||||||||||| Sbjct: 555 gcacccaaggtgagtgcagacggcgttga 527
>dbj|AB025003.1| Cicer arietinum mRNA for plastoquinol-plastocyanin reductase, partial cds Length = 479 Score = 73.8 bits (37), Expect = 6e-10 Identities = 121/149 (81%) Strand = Plus / Minus Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacg 349 |||||||| ||||||||||| ||||||| |||||||||||||||| ||| | |||||| Sbjct: 361 ttgtactgagatccatggcaggggcagataaacttgttctcggcggtgttaaacggcacg 302 Query: 350 acgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcggac 409 || || || || || ||||| || || || ||||| || || || || || |||| | Sbjct: 301 acacacccgaggtgagtgcatactgcattaatcccatatgttgcaagtgttctgtctttc 242 Query: 410 tccaccacaaggtaggtaggatcaccctt 438 ||||||||||||||||||||||| ||||| Sbjct: 241 tccaccacaaggtaggtaggatccccctt 213
>gb|AC134927.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1036C05, complete sequence Length = 143400 Score = 69.9 bits (35), Expect = 1e-08 Identities = 56/63 (88%) Strand = Plus / Plus Query: 191 tccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagc 250 |||| ||| |||||||||| ||||||||||||||||||||||||||||| | |||||| Sbjct: 64199 tccatccacggcacgaagataaccttgccgtcgtcgacgtcggcgtgaaccaatgccagc 64258 Query: 251 gac 253 ||| Sbjct: 64259 gac 64261
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 69.9 bits (35), Expect = 1e-08 Identities = 56/63 (88%) Strand = Plus / Plus Query: 191 tccacccatggcacgaagacgaccttgccgtcgtcgacgtcggcgtgaacgagggccagc 250 |||| ||| |||||||||| ||||||||||||||||||||||||||||| | |||||| Sbjct: 16113029 tccatccacggcacgaagataaccttgccgtcgtcgacgtcggcgtgaaccaatgccagc 16113088 Query: 251 gac 253 ||| Sbjct: 16113089 gac 16113091
>dbj|AU066527.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl inducible, complete cds, clone:NaEX96-104 Length = 578 Score = 63.9 bits (32), Expect = 6e-07 Identities = 50/56 (89%) Strand = Plus / Minus Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330 ||||||||||||||||||||||| ||||| ||||| ||||| |||||||||||| Sbjct: 474 accttgccctggttgttgtactgcgatccgtggcaggggcacttgaacttgttctc 419
>emb|BX826362.1|CNS0A4FZ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB19ZF07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 714 Score = 60.0 bits (30), Expect = 1e-05 Identities = 96/118 (81%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || | ||||||| ||| || |||||| ||||| Sbjct: 678 gttgtattgggatccatggcaaggacatggaaacttgtactcagctttgttccatggcac 619 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||||| ||||| || |||||||| ||||| || || || ||||||||| Sbjct: 618 aacacatccaagatgagtgcacactgcgttgataccgtatgtcgctagagtcttgtcg 561
>emb|X63605.1|PSPETC P.sativum petC mRNA for chloroplast Rieske FeS protein Length = 880 Score = 58.0 bits (29), Expect = 4e-05 Identities = 38/41 (92%) Strand = Plus / Minus Query: 290 ttgtactgggatccatggcaagggcagaggaacttgttctc 330 |||||||| ||||||||||| ||||||| |||||||||||| Sbjct: 591 ttgtactgagatccatggcaggggcagatgaacttgttctc 551 Score = 52.0 bits (26), Expect = 0.002 Identities = 26/26 (100%) Strand = Plus / Minus Query: 413 accacaaggtaggtaggatcaccctt 438 |||||||||||||||||||||||||| Sbjct: 468 accacaaggtaggtaggatcaccctt 443
>gb|AY826843.1| Heterocapsa triquetra clone HTCB61 chloroplast cytochrome b6 mRNA, partial cds; nuclear gene for chloroplast product Length = 531 Score = 54.0 bits (27), Expect = 6e-04 Identities = 87/107 (81%) Strand = Plus / Minus Query: 275 accttgccctggttgttgtactgggatccatggcaagggcagaggaacttgttctcggcg 334 |||||||||| || ||||||||| ||||| ||||| ||||||| ||| |||| || Sbjct: 276 accttgccctcgtcgttgtactgcgatccgtggcacgggcagatgaagcggttcgcgttc 217 Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgat 381 |||||| |||||||||||||| || || |||||||| |||||||| Sbjct: 216 ctgttccagggcacgacgcagcccaggtgggtgcagaccgcgttgat 170
>emb|AJ784853.1| Cyanophora paradoxa mRNA for Rieske iron-sulphur protein (petC-2 gene) Length = 874 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgtt 378 |||||| || |||||||||||||| || |||||||||||||| Sbjct: 554 gttccagggaacgacgcagccaaggtgagtgcagacggcgtt 513 Score = 50.1 bits (25), Expect = 0.009 Identities = 40/45 (88%) Strand = Plus / Minus Query: 419 aggtaggtaggatcacccttgagcccctgggcgagcgtgcggtcg 463 |||||||| | ||| |||||||| ||||||||||||| ||||||| Sbjct: 472 aggtaggtggcatcgcccttgaggccctgggcgagcgagcggtcg 428
>emb|BX826457.1|CNS0A4G1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB28ZC01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 532 Score = 52.0 bits (26), Expect = 0.002 Identities = 38/42 (90%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctc 330 |||||| ||||||||||||||||| || || ||||||||||| Sbjct: 252 gttgtattgggatccatggcaaggacatagaaacttgttctc 211
>emb|BX826302.1|CNS0A381 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB13ZB05 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 790 Score = 52.0 bits (26), Expect = 0.002 Identities = 95/118 (80%) Strand = Plus / Minus Query: 289 gttgtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 |||||| ||||||||||||||||| || | ||||||||||| || |||||| ||||| Sbjct: 553 gttgtattgggatccatggcaaggacataaaaacttgttctcagctttgttccatggcac 494 Query: 349 gacgcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtcg 406 || || |||||| | || || || |||||||| ||||| || || || ||||||||| Sbjct: 493 aacacatccaagaagagttcacactgcgttgataccgtatgtcgctagagtcttgtcg 436
>emb|X06244.1|SORFES Spinach mRNA for Rieske FeS-precursor protein Length = 1024 Score = 52.0 bits (26), Expect = 0.002 Identities = 98/122 (80%) Strand = Plus / Minus Query: 251 gacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggatccatggcaa 310 |||| ||||||||| || || ||||| |||| ||||| ||||| |||||||||||||| Sbjct: 683 gacaaaggtgcagggcctcgaacaactctgccttggttattgtattgggatccatggcat 624 Query: 311 gggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgcgtgcag 370 || || | ||| |||||||| || || || | ||||| || || |||||||| |||||| Sbjct: 623 ggacaaatgaatttgttctcagcagcattaaatggcaccacacatccaagatgtgtgcag 564 Query: 371 ac 372 || Sbjct: 563 ac 562
>gb|AF110783.1|AF110783 Volvox carteri f. nagariensis clone G9 rieske iron-sulfur protein precursor (petC) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1159 Score = 50.1 bits (25), Expect = 0.009 Identities = 109/137 (79%) Strand = Plus / Minus Query: 242 agggccagcgacagaggtgcaggtccacggacaaccttgccctggttgttgtactgggat 301 ||||||| ||||| || ||||| |||||||| |||||||||| |||||||| || Sbjct: 553 agggccaaagacagcggagcagggccacggaccaccttgccctcagcattgtactgagag 494 Query: 302 ccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaaga 361 || ||||||||||| ||||||||||||||| || |||||| ||||| ||||| | Sbjct: 493 ccgtggcaagggcacttgaacttgttctcggccgccacccaaggaacgacacagcccaag 434 Query: 362 tgcgtgcagacggcgtt 378 || ||||| |||||||| Sbjct: 433 tgggtgcacacggcgtt 417
>gb|AY267656.1| Bigelowiella natans Fe-S subunit of cytochrome c6f complex mRNA, complete cds; nuclear gene for plastid product Length = 1025 Score = 48.1 bits (24), Expect = 0.037 Identities = 24/24 (100%) Strand = Plus / Minus Query: 292 gtactgggatccatggcaagggca 315 |||||||||||||||||||||||| Sbjct: 653 gtactgggatccatggcaagggca 630
>emb|X76299.1|CRPETC C.reinhardtii petC gene Length = 1608 Score = 48.1 bits (24), Expect = 0.037 Identities = 57/68 (83%) Strand = Plus / Minus Query: 266 ccacggacaaccttgccctggttgttgtactgggatccatggcaagggcagaggaacttg 325 |||||||| |||||||||| ||||||||| || || ||||||||||| ||||||| Sbjct: 1171 ccacggaccaccttgccctcagcgttgtactgagagccgtggcaagggcacttgaacttg 1112 Query: 326 ttctcggc 333 |||||||| Sbjct: 1111 ttctcggc 1104 Score = 46.1 bits (23), Expect = 0.15 Identities = 35/39 (89%) Strand = Plus / Minus Query: 340 ccaaggcacgacgcagccaagatgcgtgcagacggcgtt 378 |||||||||||||||||| || || ||||| |||||||| Sbjct: 959 ccaaggcacgacgcagcccaggtgagtgcacacggcgtt 921
>emb|X66009.1|NTRFES1 N.tabacum mRNA for chloroplast Rieske FeS precursor protein 1 Length = 814 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 284 tggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330 ||||||||||| || ||||||||||| ||||| | ||||||||||| Sbjct: 592 tggttgttgtattgagatccatggcaggggcaaataaacttgttctc 546
>emb|X64353.1|NTRFSCBFC N.tabacum mRNA for Rieske Fe/S protein of cytochrome b6/f complex Length = 833 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 284 tggttgttgtactgggatccatggcaagggcagaggaacttgttctc 330 ||||||||||| || ||||||||||| ||||| | ||||||||||| Sbjct: 556 tggttgttgtattgagatccatggcaggggcaaataaacttgttctc 510
>emb|BX572099.1| Prochlorococcus marinus MIT9313 complete genome; segment 5/7 Length = 349746 Score = 46.1 bits (23), Expect = 0.15 Identities = 44/51 (86%) Strand = Plus / Minus Query: 337 gttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgta 387 |||||||||||| |||||||| || || ||||||| |||||||| ||||| Sbjct: 12422 gttccaaggcaccacgcagccgaggtgggtgcagatcgcgttgattccgta 12372
>emb|BX569694.1| Synechococcus sp. WH8102 complete genome; segment 6/7 Length = 349122 Score = 46.1 bits (23), Expect = 0.15 Identities = 68/83 (81%) Strand = Plus / Minus Query: 305 tggcaagggcagaggaacttgttctcggcggcgttccaaggcacgacgcagccaagatgc 364 ||||||||||| | ||||||||| || || |||||| ||||| |||||||| || || Sbjct: 17548 tggcaagggcacatgaacttgttggcgccgctgttccagggcaccacgcagcccaggtgg 17489 Query: 365 gtgcagacggcgttgatcccgta 387 ||||||| |||||| || ||||| Sbjct: 17488 gtgcagatggcgttaatgccgta 17466
>gb|CP000151.1| Burkholderia sp. 383 chromosome 1, complete sequence Length = 3694126 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 208 gacgaccttgccgtcgtcgacg 229 |||||||||||||||||||||| Sbjct: 1061182 gacgaccttgccgtcgtcgacg 1061203
>dbj|AP008231.1| Synechococcus elongatus PCC 6301 DNA, complete genome Length = 2696255 Score = 44.1 bits (22), Expect = 0.57 Identities = 46/54 (85%) Strand = Plus / Minus Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtag 388 |||||||||||||| |||||||| | || ||||| || |||||||| |||||| Sbjct: 367671 gcgttccaaggcaccacgcagcccaagtgggtgcaaactgcgttgatgccgtag 367618
>gb|AY826844.1| Isochrysis galbana clone ISCB61 chloroplast cytochrome b6 mRNA, partial cds; nuclear gene for chloroplast product Length = 1010 Score = 44.1 bits (22), Expect = 0.57 Identities = 91/114 (79%) Strand = Plus / Minus Query: 292 gtactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcacgac 351 |||||| || || ||||| ||||||| | ||||| || |||| |||||| || ||||| Sbjct: 521 gtactgcgagccgtggcacgggcagatgtacttgagctgggcgcggttccatgggacgac 462 Query: 352 gcagccaagatgcgtgcagacggcgttgatcccgtaggtggcgagggtcttgtc 405 |||||| || || ||||| || |||||||| ||||| | ||||||||||||| Sbjct: 461 gcagccgaggtgggtgcaaacagcgttgatggcgtagttctcgagggtcttgtc 408
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Plus Query: 202 cacgaagacgaccttgccgtcg 223 |||||||||||||||||||||| Sbjct: 3591632 cacgaagacgaccttgccgtcg 3591653
>gb|AY487229.1| Mycobacterium fortuitum PgaE gene, partial cds; putative transcription regulator, hypothetical protein, Erm(39), 3355, and FolD genes, complete cds; and 3359 gene, partial cds Length = 4803 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 217 gccgtcgtcgacgtcggcgtga 238 |||||||||||||||||||||| Sbjct: 3357 gccgtcgtcgacgtcggcgtga 3336
>gb|CP000100.1| Synechococcus elongatus PCC 7942, complete genome Length = 2695903 Score = 44.1 bits (22), Expect = 0.57 Identities = 46/54 (85%) Strand = Plus / Plus Query: 335 gcgttccaaggcacgacgcagccaagatgcgtgcagacggcgttgatcccgtag 388 |||||||||||||| |||||||| | || ||||| || |||||||| |||||| Sbjct: 1253134 gcgttccaaggcaccacgcagcccaagtgggtgcaaactgcgttgatgccgtag 1253187
>dbj|AB070940.1| Streptomyces avermitilis oligomycin biosynthetic gene cluster Length = 104326 Score = 44.1 bits (22), Expect = 0.57 Identities = 22/22 (100%) Strand = Plus / Minus Query: 202 cacgaagacgaccttgccgtcg 223 |||||||||||||||||||||| Sbjct: 46173 cacgaagacgaccttgccgtcg 46152
>gb|AC093100.2| Drosophila melanogaster clone BACR05J04, complete sequence Length = 214621 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 506 ttgccgagcttgtccttggcggcga 530 ||||||||| ||||||||||||||| Sbjct: 148179 ttgccgagcgtgtccttggcggcga 148155
>ref|NM_135169.2| Drosophila melanogaster Pez CG9493-RA (Pez), mRNA Length = 4527 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 506 ttgccgagcttgtccttggcggcga 530 ||||||||| ||||||||||||||| Sbjct: 1064 ttgccgagcgtgtccttggcggcga 1040
>gb|AF217284.1|AF217284 Drosophila melanogaster protein tyrosine phosphatase Pez (Pez) mRNA, complete cds Length = 4433 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 506 ttgccgagcttgtccttggcggcga 530 ||||||||| ||||||||||||||| Sbjct: 955 ttgccgagcgtgtccttggcggcga 931
>gb|AE003613.4| Drosophila melanogaster chromosome 2L, section 22 of 83 of the complete sequence Length = 280095 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 506 ttgccgagcttgtccttggcggcga 530 ||||||||| ||||||||||||||| Sbjct: 119693 ttgccgagcgtgtccttggcggcga 119717
>gb|AC005285.1|AC005285 Drosophila melanogaster DNA sequence (P1s DS00121 (D128), DS05470 (D270), and DS00108 (D120)), complete sequence Length = 209071 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Plus Query: 506 ttgccgagcttgtccttggcggcga 530 ||||||||| ||||||||||||||| Sbjct: 133047 ttgccgagcgtgtccttggcggcga 133071
>ref|NM_018094.2| Homo sapiens G1 to S phase transition 2 (GSPT2), mRNA Length = 2503 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 540 cgttgctcccggagccggccggga 563 ||||||| |||||||||||||||| Sbjct: 464 cgttgctgccggagccggccggga 441
>gb|AC120788.7| Mus musculus chromosome 14, clone RP23-279B13, complete sequence Length = 215810 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ttaggactggcaggaggctt 107 |||||||||||||||||||| Sbjct: 14455 ttaggactggcaggaggctt 14436
>gb|CP000359.1| Deinococcus geothermalis DSM 11300, complete genome Length = 2467205 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 510 cgagcttgtccttggcggcg 529 |||||||||||||||||||| Sbjct: 1291092 cgagcttgtccttggcggcg 1291073
>ref|XM_659574.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN7062.2), mRNA Length = 1668 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 204 cgaagacgaccttgccgtcg 223 |||||||||||||||||||| Sbjct: 976 cgaagacgaccttgccgtcg 957
>ref|XM_754954.1| Ustilago maydis 521 hypothetical protein (UM03900.1) partial mRNA Length = 3015 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 306 ggcaagggcagaggaacttg 325 |||||||||||||||||||| Sbjct: 1647 ggcaagggcagaggaacttg 1628
>gb|AC125332.3| Mus musculus BAC clone RP23-113I20 from 3, complete sequence Length = 220068 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 303 catggcaagggcagaggaac 322 |||||||||||||||||||| Sbjct: 148711 catggcaagggcagaggaac 148730
>gb|AC121928.2| Mus musculus BAC clone RP24-204F1 from 3, complete sequence Length = 178387 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 303 catggcaagggcagaggaac 322 |||||||||||||||||||| Sbjct: 151789 catggcaagggcagaggaac 151770
>emb|AL929101.4| Human DNA sequence from clone RP11-22B10 on chromosome X Contains the GSPT2 gene for G1 to S phase transition 2, a pseudogene similar to part of p30 (nuclear protein p30), a zinc finger protein pseudogene, the 5' end of a variant of the MAGED1 gene for melanoma antigen, family D, 1 and two CpG islands, complete sequence Length = 157110 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 540 cgttgctcccggagccggccggga 563 ||||||| |||||||||||||||| Sbjct: 40236 cgttgctgccggagccggccggga 40213
>emb|AL662824.9| Human DNA sequence from clone XXbac-22I16 on chromosome 6 contains the HLA-DPA1 gene for major histocompatibility complex, class II, DP alpha 1, the HLA-DPB1 gene for major histocompatibility complex, class II, DP beta 1, a ribosomal protein L32 (RPL32) pseudogene, the HLA-DPA2 pseudogene for major histocompatibility complex, class II, DP alpha 2, a pseudogene similar to part of collagens, a novel protein similar to major histocompatibility complex, class II, DP beta 2 (pseudogene), a major histocompatibility complex, class II, DP beta 1 pseudogene, two putative novel transcripts, the COL11A2 gene for collagen, type XI, alpha 2, the RXRB gene for retinoid X receptor, beta, the HKE4 gene for HLA-class II region expressed gene KE4, the 5' end of the HSD17B8 gene for hydroxysteroid (17-beta) dehydrogenase 8 and four CpG islands, complete sequence Length = 187964 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 tggcaagggcagaggaactt 324 |||||||||||||||||||| Sbjct: 38046 tggcaagggcagaggaactt 38027
>emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on chromosome 6 Contains the HLA-DOA, HLA-DPA1 and HLA-DPB1 genes for major histocompatibility complex class II proteins DO alpha, DP alpha 1 and DP beta 1, the HLA-DPA2 major histocompatibility complex class II DP alpha 2 pseudogene, ribosomal protein L32 pseudogene RPL32P1, a pseudogene similar to part of collagens, the 5' end of an HLA class II histocompatibility antigen D or S beta pseudogene, the 5' end of a novel protein similar to major histocompatibility complex class II DP beta 1 precursor and a CpG island, complete sequence Length = 124899 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 tggcaagggcagaggaactt 324 |||||||||||||||||||| Sbjct: 63756 tggcaagggcagaggaactt 63737
>ref|XM_783177.1| PREDICTED: Strongylocentrotus purpuratus similar to tripartite motif protein TRIM2 (LOC583257), mRNA Length = 1002 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 485 caatcctcgacgaggatgtc 504 |||||||||||||||||||| Sbjct: 776 caatcctcgacgaggatgtc 757
>gb|AC090496.28| Mus musculus strain C57BL/6J clone rp23-469n6 map 14, complete sequence Length = 180338 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 88 ttaggactggcaggaggctt 107 |||||||||||||||||||| Sbjct: 173120 ttaggactggcaggaggctt 173101
>gb|BC036077.1| Homo sapiens G1 to S phase transition 2, mRNA (cDNA clone MGC:33729 IMAGE:5313878), complete cds Length = 2513 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 540 cgttgctcccggagccggccggga 563 ||||||| |||||||||||||||| Sbjct: 464 cgttgctgccggagccggccggga 441
>emb|AJ251548.1|HSA251548 Homo sapiens mRNA for polypeptide chain release factor 3b (GSPT2 gene) Length = 1887 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 540 cgttgctcccggagccggccggga 563 ||||||| |||||||||||||||| Sbjct: 268 cgttgctgccggagccggccggga 245
>emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chromosome 6, complete sequence Length = 119898 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 305 tggcaagggcagaggaactt 324 |||||||||||||||||||| Sbjct: 58192 tggcaagggcagaggaactt 58173
>emb|CR861342.1| Pongo pygmaeus mRNA; cDNA DKFZp459J1511 (from clone DKFZp459J1511) Length = 2532 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 540 cgttgctcccggagccggccggga 563 ||||||| |||||||||||||||| Sbjct: 482 cgttgctgccggagccggccggga 459
>gb|AC087892.16| Homo sapiens 12q BAC RP11-3L23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 123004 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 38 atacaagaaacaggtgcatt 57 |||||||||||||||||||| Sbjct: 2769 atacaagaaacaggtgcatt 2788
>gb|AE005819.1| Caulobacter crescentus CB15 section 145 of 359 of the complete genome Length = 10591 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 512 agcttgtccttggcggcgacccct 535 ||||||||||||||| |||||||| Sbjct: 434 agcttgtccttggcgccgacccct 457
>gb|AC098615.2| Homo sapiens chromosome 3 clone RP11-268I20, complete sequence Length = 167486 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 42 aagaaacaggtgcatttata 61 |||||||||||||||||||| Sbjct: 151940 aagaaacaggtgcatttata 151921
>dbj|AK023155.1| Homo sapiens cDNA FLJ13093 fis, clone NT2RP3002151, highly similar to G1 TO S PHASE TRANSITION PROTEIN 1 HOMOLOG Length = 2492 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 540 cgttgctcccggagccggccggga 563 ||||||| |||||||||||||||| Sbjct: 454 cgttgctgccggagccggccggga 431
>dbj|AK001303.1| Homo sapiens cDNA FLJ10441 fis, clone NT2RP1000733, highly similar to Human mRNA for GSPT1-TK protein Length = 2481 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 540 cgttgctcccggagccggccggga 563 ||||||| |||||||||||||||| Sbjct: 448 cgttgctgccggagccggccggga 425
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome Length = 4381608 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 489 cctcgacgaggatgtcgttgccga 512 ||||||||| |||||||||||||| Sbjct: 2955444 cctcgacgatgatgtcgttgccga 2955467
>gb|AF336983.1|AF336983 Vaucheria litorea cytochrome b6f complex Rieske FeS protein mRNA, partial cds; nuclear gene for chloroplast product Length = 222 Score = 40.1 bits (20), Expect = 9.0 Identities = 47/56 (83%) Strand = Plus / Minus Query: 293 tactgggatccatggcaagggcagaggaacttgttctcggcggcgttccaaggcac 348 ||||| || ||||||||||| |||| ||||||||| || || |||||||||||| Sbjct: 128 tactgcgacccatggcaaggacagatgaacttgttttcagccttgttccaaggcac 73
>emb|AL606597.4|OSJN00042 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0045P24, complete sequence Length = 124420 Score = 40.1 bits (20), Expect = 9.0 Identities = 22/23 (95%) Strand = Plus / Minus Query: 3 tttctcttctttntagactgtat 25 |||||||||||| |||||||||| Sbjct: 103410 tttctcttctttttagactgtat 103388
>gb|AC012451.8| Homo sapiens BAC clone RP11-414K19 from 2, complete sequence Length = 188121 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 306 ggcaagggcagaggaacttg 325 |||||||||||||||||||| Sbjct: 179433 ggcaagggcagaggaacttg 179452
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 210 cgaccttgccgtcgtcgacg 229 |||||||||||||||||||| Sbjct: 2036408 cgaccttgccgtcgtcgacg 2036389
>gb|AE005063.1| Halobacterium sp. NRC-1 section 94 of 170 of the complete genome Length = 11844 Score = 40.1 bits (20), Expect = 9.0 Identities = 26/28 (92%) Strand = Plus / Minus Query: 447 gggcgagcgtgcggtcgttggggccgtg 474 |||||||||||||||||| |||| |||| Sbjct: 3239 gggcgagcgtgcggtcgtcggggtcgtg 3212
>gb|AF203698.1|AF203698 Rattus norvegicus T calcium channel alpha1G subunit (Cacna1g) gene, partial cds Length = 4171 Score = 40.1 bits (20), Expect = 9.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 427 aggatcacccttgagcccctgggc 450 ||||||||||||||||| |||||| Sbjct: 3868 aggatcacccttgagcctctgggc 3845
>gb|U04283.1|SAPHSA Streptomyces antibioticus IMRU3720 phenoxazinone synthase (phsA) gene, complete cds Length = 2302 Score = 40.1 bits (20), Expect = 9.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 217 gccgtcgtcgacgtcggcgt 236 |||||||||||||||||||| Sbjct: 1257 gccgtcgtcgacgtcggcgt 1238 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,903,136 Number of Sequences: 3902068 Number of extensions: 3903136 Number of successful extensions: 64515 Number of sequences better than 10.0: 112 Number of HSP's better than 10.0 without gapping: 113 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 63562 Number of HSP's gapped (non-prelim): 929 length of query: 657 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 634 effective length of database: 17,143,297,704 effective search space: 10868850744336 effective search space used: 10868850744336 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)