ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah61f01
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 66 3e-08
2gb|AC113977.16| Mus musculus chromosome 1, clone RP23-161E13, co... 38 6.4
3gb|AC102375.8| Mus musculus chromosome 3, clone RP23-281M6, comp... 38 6.4
4gb|AC104507.5| Drosophila melanogaster 3L BAC RP98-26J11 (Roswel... 38 6.4
5gb|AC010003.8| Drosophila melanogaster 3L BAC RP98-6L11 (Roswell... 38 6.4
6dbj|BS000178.1| Pan troglodytes chromosome 22 clone:RP43-042C06,... 38 6.4
7gb|AE003521.3| Drosophila melanogaster chromosome 3L, section 64... 38 6.4
8gb|AC102405.8| Mus musculus chromosome 3, clone RP24-318I21, com... 38 6.4

>dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase small subunit, complete cds,
            clone:6, subclone:16
          Length = 5980

 Score = 65.9 bits (33), Expect = 3e-08
 Identities = 109/135 (80%), Gaps = 5/135 (3%)
 Strand = Plus / Minus

                                                                        
Query: 1    atatgtgtaggccgtgctagaattgtacatatgcatatntgctccanaacctatgctcgt 60
            |||||||||| | ||||||||||| |||||||||||    |||||| |||||||| ||||
Sbjct: 1432 atatgtgtagccggtgctagaatt-tacatatgcat----gctccacaacctatgttcgt 1378

                                                                        
Query: 61   acataaacagatcatngcagaagaaaattatgcnctagncggnaagccgagncgnggaca 120
            ||| | |||||||||  |  | ||||| ||||| || | ||| |||| ||| |  |||||
Sbjct: 1377 acaaacacagatcataccgaaggaaaaatatgctctggtcgggaagcagagtcctggaca 1318

                           
Query: 121  aaagtgaagctcaca 135
            ||||||||| |||||
Sbjct: 1317 aaagtgaagttcaca 1303



to top

>gb|AC113977.16| Mus musculus chromosome 1, clone RP23-161E13, complete sequence
          Length = 235738

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 24/26 (92%)
 Strand = Plus / Minus

                                       
Query: 65    aaacagatcatngcagaagaaaatta 90
             ||||||||||| |||||||| |||||
Sbjct: 75351 aaacagatcatggcagaagagaatta 75326



to top

>gb|AC102375.8| Mus musculus chromosome 3, clone RP23-281M6, complete sequence
          Length = 149467

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                  
Query: 25   gtacatatgcatatntgctcca 46
            |||||||||||||| |||||||
Sbjct: 9350 gtacatatgcatatttgctcca 9329



to top

>gb|AC104507.5| Drosophila melanogaster 3L BAC RP98-26J11 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 183911

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 17     ctagaattgtacatatgca 35
              |||||||||||||||||||
Sbjct: 124220 ctagaattgtacatatgca 124238



to top

>gb|AC010003.8| Drosophila melanogaster 3L BAC RP98-6L11 (Roswell Park Cancer
            Institute Drosophila BAC Library) complete sequence
          Length = 183291

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 17   ctagaattgtacatatgca 35
            |||||||||||||||||||
Sbjct: 4627 ctagaattgtacatatgca 4645



to top

>dbj|BS000178.1| Pan troglodytes chromosome 22 clone:RP43-042C06, map 22, complete
            sequences
          Length = 176580

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 19   agaattgtacatatgcata 37
            |||||||||||||||||||
Sbjct: 3639 agaattgtacatatgcata 3657



to top

>gb|AE003521.3| Drosophila melanogaster chromosome 3L, section 64 of 83 of the complete
             sequence
          Length = 271237

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 17    ctagaattgtacatatgca 35
             |||||||||||||||||||
Sbjct: 38657 ctagaattgtacatatgca 38675



to top

>gb|AC102405.8| Mus musculus chromosome 3, clone RP24-318I21, complete sequence
          Length = 181425

 Score = 38.2 bits (19), Expect = 6.4
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 25     gtacatatgcatatntgctcca 46
              |||||||||||||| |||||||
Sbjct: 156789 gtacatatgcatatttgctcca 156768


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 760,079
Number of Sequences: 3902068
Number of extensions: 760079
Number of successful extensions: 47535
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 47521
Number of HSP's gapped (non-prelim): 14
length of query: 136
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 115
effective length of database: 17,151,101,840
effective search space: 1972376711600
effective search space used: 1972376711600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top