>dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
carboxylase/oxygenase small subunit, complete cds,
clone:6, subclone:16
Length = 5980
Score = 65.9 bits (33), Expect = 3e-08
Identities = 109/135 (80%), Gaps = 5/135 (3%)
Strand = Plus / Minus
Query: 1 atatgtgtaggccgtgctagaattgtacatatgcatatntgctccanaacctatgctcgt 60
|||||||||| | ||||||||||| ||||||||||| |||||| |||||||| ||||
Sbjct: 1432 atatgtgtagccggtgctagaatt-tacatatgcat----gctccacaacctatgttcgt 1378
Query: 61 acataaacagatcatngcagaagaaaattatgcnctagncggnaagccgagncgnggaca 120
||| | ||||||||| | | ||||| ||||| || | ||| |||| ||| | |||||
Sbjct: 1377 acaaacacagatcataccgaaggaaaaatatgctctggtcgggaagcagagtcctggaca 1318
Query: 121 aaagtgaagctcaca 135
||||||||| |||||
Sbjct: 1317 aaagtgaagttcaca 1303
>gb|AC102405.8| Mus musculus chromosome 3, clone RP24-318I21, complete sequence
Length = 181425
Score = 38.2 bits (19), Expect = 6.4
Identities = 21/22 (95%)
Strand = Plus / Minus
Query: 25 gtacatatgcatatntgctcca 46
|||||||||||||| |||||||
Sbjct: 156789 gtacatatgcatatttgctcca 156768
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 760,079
Number of Sequences: 3902068
Number of extensions: 760079
Number of successful extensions: 47535
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 7
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 47521
Number of HSP's gapped (non-prelim): 14
length of query: 136
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 115
effective length of database: 17,151,101,840
effective search space: 1972376711600
effective search space used: 1972376711600
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)