Clone Name | rbah61e01 |
---|---|
Clone Library Name | barley_pub |
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 46.1 bits (23), Expect = 0.054 Identities = 55/67 (82%) Strand = Plus / Plus Query: 191 tccccaagtaagctttccatctcttnagggttccgttgcacnnatggatgatgcanaacc 250 |||||||||||||| |||||||||| ||| || |||| | ||||||| |||| ||| Sbjct: 17895376 tccccaagtaagctctccatctcttcaggattttgttgtgcccatggatgttgcattacc 17895435 Query: 251 ttcctca 257 ||||||| Sbjct: 17895436 ttcctca 17895442 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 129 ctttcttctcgatgctgaaat 149 ||||||||||||||||||||| Sbjct: 17922101 ctttcttctcgatgctgaaat 17922121 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 129 ctttcttctcgatgctgaaat 149 ||||||||||||||||||||| Sbjct: 17914011 ctttcttctcgatgctgaaat 17914031
>dbj|AP005555.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OJ1118_B06 Length = 106678 Score = 46.1 bits (23), Expect = 0.054 Identities = 55/67 (82%) Strand = Plus / Plus Query: 191 tccccaagtaagctttccatctcttnagggttccgttgcacnnatggatgatgcanaacc 250 |||||||||||||| |||||||||| ||| || |||| | ||||||| |||| ||| Sbjct: 46195 tccccaagtaagctctccatctcttcaggattttgttgtgcccatggatgttgcattacc 46254 Query: 251 ttcctca 257 ||||||| Sbjct: 46255 ttcctca 46261 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 129 ctttcttctcgatgctgaaat 149 ||||||||||||||||||||| Sbjct: 72920 ctttcttctcgatgctgaaat 72940 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 129 ctttcttctcgatgctgaaat 149 ||||||||||||||||||||| Sbjct: 64830 ctttcttctcgatgctgaaat 64850
>gb|AC109162.12| Mus musculus chromosome 7, clone RP24-177G14, complete sequence Length = 176990 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Minus Query: 58 attgattgattgttttgagaca 79 |||||||||||||||||||||| Sbjct: 71967 attgattgattgttttgagaca 71946
>gb|AC107231.9| Mus musculus chromosome 14, clone RP23-475A2, complete sequence Length = 216217 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Plus Query: 58 attgattgattgttttgagaca 79 |||||||||||||||||||||| Sbjct: 171668 attgattgattgttttgagaca 171689
>gb|AF512555.1| Homo sapiens excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence) (ERCC1) gene, complete cds Length = 17285 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Plus Query: 58 attgattgattgttttgagaca 79 |||||||||||||||||||||| Sbjct: 7443 attgattgattgttttgagaca 7464
>gb|AC010377.7| Homo sapiens chromosome 5 clone CTD-2060J20, complete sequence Length = 139476 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Plus Query: 58 attgattgattgttttgagaca 79 |||||||||||||||||||||| Sbjct: 68552 attgattgattgttttgagaca 68573
>gb|AC008966.9| Homo sapiens chromosome 5 clone CTD-2366F13, complete sequence Length = 174831 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Plus Query: 58 attgattgattgttttgagaca 79 |||||||||||||||||||||| Sbjct: 19563 attgattgattgttttgagaca 19584
>gb|AC139353.3| Homo sapiens chromosome 19 clone LLNLR-257F11, complete sequence Length = 38480 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Plus Query: 58 attgattgattgttttgagaca 79 |||||||||||||||||||||| Sbjct: 22437 attgattgattgttttgagaca 22458
>gb|AC154195.1| Mus musculus BAC clone RP24-419F8 from 14, complete sequence Length = 159281 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Minus Query: 58 attgattgattgttttgagaca 79 |||||||||||||||||||||| Sbjct: 132184 attgattgattgttttgagaca 132163
>gb|M63796.1|HUMMMDA Human DNA from cosmid MMDA from chromosome 19q13.3 (obtained by automated sequence analysis) Length = 37314 Score = 44.1 bits (22), Expect = 0.21 Identities = 22/22 (100%) Strand = Plus / Minus Query: 58 attgattgattgttttgagaca 79 |||||||||||||||||||||| Sbjct: 16976 attgattgattgttttgagaca 16955
>gb|AC012046.11| Homo sapiens chromosome 10 clone RP11-312P12, complete sequence Length = 198781 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Minus Query: 59 ttgattgattgttttgagaca 79 ||||||||||||||||||||| Sbjct: 81124 ttgattgattgttttgagaca 81104
>gb|AC087560.26| Mus musculus strain C57BL/6J clone rp23-448g13 map X, complete sequence Length = 203953 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Minus Query: 59 ttgattgattgttttgagaca 79 ||||||||||||||||||||| Sbjct: 117806 ttgattgattgttttgagaca 117786
>gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, complete sequence Length = 193569 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 187 gggttccccaagtaagctttc 207 ||||||||||||||||||||| Sbjct: 153243 gggttccccaagtaagctttc 153263
>gb|AC018841.4| Homo sapiens chromosome 3 clone RP11-7F24 map 3p, complete sequence Length = 198264 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 58 attgattgattgttttgagac 78 ||||||||||||||||||||| Sbjct: 69071 attgattgattgttttgagac 69091
>gb|AC090958.3| Homo sapiens chromosome 3 clone RP11-758G22 map 3p, complete sequence Length = 193333 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Minus Query: 58 attgattgattgttttgagac 78 ||||||||||||||||||||| Sbjct: 23078 attgattgattgttttgagac 23058
>gb|AC023263.4|AC023263 Homo sapiens, clone RP11-590E14, complete sequence Length = 174176 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Plus Query: 187 gggttccccaagtaagctttc 207 ||||||||||||||||||||| Sbjct: 743 gggttccccaagtaagctttc 763
>gb|AC022234.4| Homo sapiens chromosome 3 clone RP11-25O17 map 3p, complete sequence Length = 147172 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Minus Query: 58 attgattgattgttttgagac 78 ||||||||||||||||||||| Sbjct: 78131 attgattgattgttttgagac 78111
>dbj|AK111541.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013038H19, full insert sequence Length = 2604 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Minus Query: 129 ctttcttctcgatgctgaaat 149 ||||||||||||||||||||| Sbjct: 2344 ctttcttctcgatgctgaaat 2324
>emb|AL671920.9| Mouse DNA sequence from clone RP23-445A22 on chromosome X, complete sequence Length = 166399 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Minus Query: 59 ttgattgattgttttgagaca 79 ||||||||||||||||||||| Sbjct: 68963 ttgattgattgttttgagaca 68943
>gb|AC119615.7| Rattus norvegicus 10 NOVECTOR CH230-502G21 (Children's Hospital Oakland Research Institute) complete sequence Length = 156223 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 attgttttgagacaaaataa 85 |||||||||||||||||||| Sbjct: 38027 attgttttgagacaaaataa 38008
>gb|AC150412.2| Branchiostoma floridae clone CH302-60C21, complete sequence Length = 169780 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 29 aatgagaaatagataacaaa 48 |||||||||||||||||||| Sbjct: 51985 aatgagaaatagataacaaa 52004
>gb|AF100673.1| Caenorhabditis elegans cosmid Y66H1B, complete sequence Length = 34122 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 56 aaattgattgattgttttga 75 |||||||||||||||||||| Sbjct: 21994 aaattgattgattgttttga 22013
>emb|BX927195.18| Zebrafish DNA sequence from clone CH211-124E6 in linkage group 19, complete sequence Length = 148711 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 62 attgattgttttgagacaaa 81 |||||||||||||||||||| Sbjct: 76203 attgattgttttgagacaaa 76184
>gb|AC103592.2| Homo sapiens chromosome 1 clone RP11-335E14, complete sequence Length = 197372 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 29 aatgagaaatagataacaaa 48 |||||||||||||||||||| Sbjct: 39380 aatgagaaatagataacaaa 39361
>gb|AC087600.21| Homo sapiens 12q BAC RP11-495C23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 185454 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 attgttttgagacaaaataa 85 |||||||||||||||||||| Sbjct: 85909 attgttttgagacaaaataa 85928
>emb|BX572622.13| Zebrafish DNA sequence from clone CH211-150O20 in linkage group 19, complete sequence Length = 188940 Score = 40.1 bits (20), Expect = 3.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 58 attgattgattgttttgagacaaa 81 |||||||||||| ||||||||||| Sbjct: 171155 attgattgattgatttgagacaaa 171178
>gb|AC079283.4|AC079283 Arabidopsis thaliana chromosome 1 BAC F7O12 genomic sequence, complete sequence Length = 39456 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 gataacaaacatatacaaat 59 |||||||||||||||||||| Sbjct: 34090 gataacaaacatatacaaat 34071
>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome Length = 3179300 Score = 40.1 bits (20), Expect = 3.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 128 gctttcttctcgatgctgaaatat 151 ||||||||||||| |||||||||| Sbjct: 1680143 gctttcttctcgaggctgaaatat 1680166
>gb|AC098932.3| Homo sapiens chromosome 1 clone RP11-480D2, complete sequence Length = 186291 Score = 40.1 bits (20), Expect = 3.3 Identities = 23/24 (95%) Strand = Plus / Minus Query: 35 aaatagataacaaacatatacaaa 58 |||||||||||||||| ||||||| Sbjct: 106601 aaatagataacaaacagatacaaa 106578
>emb|BX248393.5| Zebrafish DNA sequence from clone CH211-233O13, complete sequence Length = 166286 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 3 aaaagtcaattacagttgaa 22 |||||||||||||||||||| Sbjct: 104011 aaaagtcaattacagttgaa 103992
>gb|AC159636.3| Mus musculus BAC clone RP24-93H15 from chromosome 12, complete sequence Length = 184821 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 tgattgattgttttgagaca 79 |||||||||||||||||||| Sbjct: 48462 tgattgattgttttgagaca 48443
>emb|AL772205.12| Mouse DNA sequence from clone RP23-162C3 on chromosome 2, complete sequence Length = 142565 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 acatatacaaattgattgat 67 |||||||||||||||||||| Sbjct: 72601 acatatacaaattgattgat 72620
>dbj|AB024414.1| Gallid herpesvirus 1 (serotype 2) DNA, UL region complete sequence Length = 110637 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 tacaaattgattgattgttt 72 |||||||||||||||||||| Sbjct: 59514 tacaaattgattgattgttt 59495
>dbj|AB049735.1| Gallid herpesvirus 3 DNA, complete genome, strain:HPRS24 Length = 164270 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 tacaaattgattgattgttt 72 |||||||||||||||||||| Sbjct: 71338 tacaaattgattgattgttt 71319
>dbj|AB024309.1| Gallid herpesvirus 1 (serotype 2) UL30 to UL40 genes, complete cds Length = 27535 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 53 tacaaattgattgattgttt 72 |||||||||||||||||||| Sbjct: 5127 tacaaattgattgattgttt 5108
>dbj|AB240156.1| Octopus ocellatus mitochondrial DNA, complete genome Length = 15979 Score = 40.1 bits (20), Expect = 3.3 Identities = 22/23 (95%) Strand = Plus / Plus Query: 9 caattacagttgaaatngttaat 31 |||||||||||||||| |||||| Sbjct: 4700 caattacagttgaaattgttaat 4722 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 2,427,643 Number of Sequences: 3902068 Number of extensions: 2427643 Number of successful extensions: 51691 Number of sequences better than 10.0: 36 Number of HSP's better than 10.0 without gapping: 36 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 51598 Number of HSP's gapped (non-prelim): 93 length of query: 258 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 236 effective length of database: 17,147,199,772 effective search space: 4046739146192 effective search space used: 4046739146192 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)