>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.054
 Identities = 55/67 (82%)
 Strand = Plus / Plus

                                                                            
Query: 191      tccccaagtaagctttccatctcttnagggttccgttgcacnnatggatgatgcanaacc 250
                |||||||||||||| |||||||||| ||| ||  ||||  |  ||||||| ||||  |||
Sbjct: 17895376 tccccaagtaagctctccatctcttcaggattttgttgtgcccatggatgttgcattacc 17895435

                       
Query: 251      ttcctca 257
                |||||||
Sbjct: 17895436 ttcctca 17895442



 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 129      ctttcttctcgatgctgaaat 149
                |||||||||||||||||||||
Sbjct: 17922101 ctttcttctcgatgctgaaat 17922121



 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 129      ctttcttctcgatgctgaaat 149
                |||||||||||||||||||||
Sbjct: 17914011 ctttcttctcgatgctgaaat 17914031

>dbj|AP005555.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1118_B06
          Length = 106678

 Score = 46.1 bits (23), Expect = 0.054
 Identities = 55/67 (82%)
 Strand = Plus / Plus

                                                                         
Query: 191   tccccaagtaagctttccatctcttnagggttccgttgcacnnatggatgatgcanaacc 250
             |||||||||||||| |||||||||| ||| ||  ||||  |  ||||||| ||||  |||
Sbjct: 46195 tccccaagtaagctctccatctcttcaggattttgttgtgcccatggatgttgcattacc 46254

                    
Query: 251   ttcctca 257
             |||||||
Sbjct: 46255 ttcctca 46261



 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 129   ctttcttctcgatgctgaaat 149
             |||||||||||||||||||||
Sbjct: 72920 ctttcttctcgatgctgaaat 72940



 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 129   ctttcttctcgatgctgaaat 149
             |||||||||||||||||||||
Sbjct: 64830 ctttcttctcgatgctgaaat 64850

>gb|AC109162.12| Mus musculus chromosome 7, clone RP24-177G14, complete sequence
          Length = 176990

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 58    attgattgattgttttgagaca 79
             ||||||||||||||||||||||
Sbjct: 71967 attgattgattgttttgagaca 71946

>gb|AC107231.9| Mus musculus chromosome 14, clone RP23-475A2, complete sequence
          Length = 216217

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 58     attgattgattgttttgagaca 79
              ||||||||||||||||||||||
Sbjct: 171668 attgattgattgttttgagaca 171689

>gb|AF512555.1| Homo sapiens excision repair cross-complementing rodent repair
            deficiency, complementation group 1 (includes overlapping
            antisense sequence) (ERCC1) gene, complete cds
          Length = 17285

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 58   attgattgattgttttgagaca 79
            ||||||||||||||||||||||
Sbjct: 7443 attgattgattgttttgagaca 7464

>gb|AC010377.7| Homo sapiens chromosome 5 clone CTD-2060J20, complete sequence
          Length = 139476

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 58    attgattgattgttttgagaca 79
             ||||||||||||||||||||||
Sbjct: 68552 attgattgattgttttgagaca 68573

>gb|AC008966.9| Homo sapiens chromosome 5 clone CTD-2366F13, complete sequence
          Length = 174831

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 58    attgattgattgttttgagaca 79
             ||||||||||||||||||||||
Sbjct: 19563 attgattgattgttttgagaca 19584

>gb|AC139353.3| Homo sapiens chromosome 19 clone LLNLR-257F11, complete sequence
          Length = 38480

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 58    attgattgattgttttgagaca 79
             ||||||||||||||||||||||
Sbjct: 22437 attgattgattgttttgagaca 22458

>gb|AC154195.1| Mus musculus BAC clone RP24-419F8 from 14, complete sequence
          Length = 159281

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 58     attgattgattgttttgagaca 79
              ||||||||||||||||||||||
Sbjct: 132184 attgattgattgttttgagaca 132163

>gb|M63796.1|HUMMMDA Human DNA from cosmid MMDA from chromosome 19q13.3 (obtained by
             automated sequence analysis)
          Length = 37314

 Score = 44.1 bits (22), Expect = 0.21
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 58    attgattgattgttttgagaca 79
             ||||||||||||||||||||||
Sbjct: 16976 attgattgattgttttgagaca 16955

>gb|AC012046.11| Homo sapiens chromosome 10 clone RP11-312P12, complete sequence
          Length = 198781

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 59    ttgattgattgttttgagaca 79
             |||||||||||||||||||||
Sbjct: 81124 ttgattgattgttttgagaca 81104

>gb|AC087560.26| Mus musculus strain C57BL/6J clone rp23-448g13 map X, complete sequence
          Length = 203953

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 59     ttgattgattgttttgagaca 79
              |||||||||||||||||||||
Sbjct: 117806 ttgattgattgttttgagaca 117786

>gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, complete sequence
          Length = 193569

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 187    gggttccccaagtaagctttc 207
              |||||||||||||||||||||
Sbjct: 153243 gggttccccaagtaagctttc 153263

>gb|AC018841.4| Homo sapiens chromosome 3 clone RP11-7F24 map 3p, complete sequence
          Length = 198264

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 58    attgattgattgttttgagac 78
             |||||||||||||||||||||
Sbjct: 69071 attgattgattgttttgagac 69091

>gb|AC090958.3| Homo sapiens chromosome 3 clone RP11-758G22 map 3p, complete sequence
          Length = 193333

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    attgattgattgttttgagac 78
             |||||||||||||||||||||
Sbjct: 23078 attgattgattgttttgagac 23058

>gb|AC023263.4|AC023263 Homo sapiens, clone RP11-590E14, complete sequence
          Length = 174176

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 187 gggttccccaagtaagctttc 207
           |||||||||||||||||||||
Sbjct: 743 gggttccccaagtaagctttc 763

>gb|AC022234.4| Homo sapiens chromosome 3 clone RP11-25O17 map 3p, complete sequence
          Length = 147172

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 58    attgattgattgttttgagac 78
             |||||||||||||||||||||
Sbjct: 78131 attgattgattgttttgagac 78111

>dbj|AK111541.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013038H19, full
            insert sequence
          Length = 2604

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 129  ctttcttctcgatgctgaaat 149
            |||||||||||||||||||||
Sbjct: 2344 ctttcttctcgatgctgaaat 2324

>emb|AL671920.9| Mouse DNA sequence from clone RP23-445A22 on chromosome X, complete
             sequence
          Length = 166399

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 59    ttgattgattgttttgagaca 79
             |||||||||||||||||||||
Sbjct: 68963 ttgattgattgttttgagaca 68943

>gb|AC119615.7| Rattus norvegicus 10 NOVECTOR CH230-502G21 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 156223

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 66    attgttttgagacaaaataa 85
             ||||||||||||||||||||
Sbjct: 38027 attgttttgagacaaaataa 38008

>gb|AC150412.2| Branchiostoma floridae clone CH302-60C21, complete sequence
          Length = 169780

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 29    aatgagaaatagataacaaa 48
             ||||||||||||||||||||
Sbjct: 51985 aatgagaaatagataacaaa 52004

>gb|AF100673.1| Caenorhabditis elegans cosmid Y66H1B, complete sequence
          Length = 34122

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 56    aaattgattgattgttttga 75
             ||||||||||||||||||||
Sbjct: 21994 aaattgattgattgttttga 22013

>emb|BX927195.18| Zebrafish DNA sequence from clone CH211-124E6 in linkage group 19,
             complete sequence
          Length = 148711

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 62    attgattgttttgagacaaa 81
             ||||||||||||||||||||
Sbjct: 76203 attgattgttttgagacaaa 76184

>gb|AC103592.2| Homo sapiens chromosome 1 clone RP11-335E14, complete sequence
          Length = 197372

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    aatgagaaatagataacaaa 48
             ||||||||||||||||||||
Sbjct: 39380 aatgagaaatagataacaaa 39361

>gb|AC087600.21| Homo sapiens 12q BAC RP11-495C23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 185454

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 66    attgttttgagacaaaataa 85
             ||||||||||||||||||||
Sbjct: 85909 attgttttgagacaaaataa 85928

>emb|BX572622.13| Zebrafish DNA sequence from clone CH211-150O20 in linkage group 19,
              complete sequence
          Length = 188940

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 58     attgattgattgttttgagacaaa 81
              |||||||||||| |||||||||||
Sbjct: 171155 attgattgattgatttgagacaaa 171178

>gb|AC079283.4|AC079283 Arabidopsis thaliana chromosome 1 BAC F7O12 genomic sequence, complete
             sequence
          Length = 39456

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 40    gataacaaacatatacaaat 59
             ||||||||||||||||||||
Sbjct: 34090 gataacaaacatatacaaat 34071

>gb|CP000252.1| Syntrophus aciditrophicus SB, complete genome
          Length = 3179300

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 128     gctttcttctcgatgctgaaatat 151
               ||||||||||||| ||||||||||
Sbjct: 1680143 gctttcttctcgaggctgaaatat 1680166

>gb|AC098932.3| Homo sapiens chromosome 1 clone RP11-480D2, complete sequence
          Length = 186291

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 35     aaatagataacaaacatatacaaa 58
              |||||||||||||||| |||||||
Sbjct: 106601 aaatagataacaaacagatacaaa 106578

>emb|BX248393.5| Zebrafish DNA sequence from clone CH211-233O13, complete sequence
          Length = 166286

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 3      aaaagtcaattacagttgaa 22
              ||||||||||||||||||||
Sbjct: 104011 aaaagtcaattacagttgaa 103992

>gb|AC159636.3| Mus musculus BAC clone RP24-93H15 from chromosome 12, complete sequence
          Length = 184821

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 60    tgattgattgttttgagaca 79
             ||||||||||||||||||||
Sbjct: 48462 tgattgattgttttgagaca 48443

>emb|AL772205.12| Mouse DNA sequence from clone RP23-162C3 on chromosome 2, complete
             sequence
          Length = 142565

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 48    acatatacaaattgattgat 67
             ||||||||||||||||||||
Sbjct: 72601 acatatacaaattgattgat 72620

>dbj|AB024414.1| Gallid herpesvirus 1 (serotype 2) DNA, UL region complete sequence
          Length = 110637

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    tacaaattgattgattgttt 72
             ||||||||||||||||||||
Sbjct: 59514 tacaaattgattgattgttt 59495

>dbj|AB049735.1| Gallid herpesvirus 3 DNA, complete genome, strain:HPRS24
          Length = 164270

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 53    tacaaattgattgattgttt 72
             ||||||||||||||||||||
Sbjct: 71338 tacaaattgattgattgttt 71319

>dbj|AB024309.1| Gallid herpesvirus 1 (serotype 2) UL30 to UL40 genes, complete cds
          Length = 27535

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 53   tacaaattgattgattgttt 72
            ||||||||||||||||||||
Sbjct: 5127 tacaaattgattgattgttt 5108

>dbj|AB240156.1| Octopus ocellatus mitochondrial DNA, complete genome
          Length = 15979

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 9    caattacagttgaaatngttaat 31
            |||||||||||||||| ||||||
Sbjct: 4700 caattacagttgaaattgttaat 4722


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,427,643
Number of Sequences: 3902068
Number of extensions: 2427643
Number of successful extensions: 51691
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 51598
Number of HSP's gapped (non-prelim): 93
length of query: 258
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 236
effective length of database: 17,147,199,772
effective search space: 4046739146192
effective search space used: 4046739146192
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)