ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbah61c18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF543426.1| Leymus cinereus putative serine/threonine phospha... 165 2e-37
2gb|AF543425.1| Leymus triticoides putative serine/threonine phos... 165 2e-37
3gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 103 5e-19
4gb|AC137634.3| Oryza sativa (japonica cultivar-group) chromosome... 103 5e-19
5dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 103 5e-19
6emb|AJ242803.1|SST242803 Sporobolus stapfianus partial mRNA for ... 50 0.007
7dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.10
8gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 46 0.10
9emb|AL713933.6|CNS07YPE Oryza sativa chromosome 12, . BAC OJ1041... 46 0.10
10emb|AL513523.33| Human DNA sequence from clone RP11-216N14 on ch... 44 0.41
11emb|CR391999.9| Zebrafish DNA sequence from clone CH211-261L7 in... 44 0.41
12emb|AL929549.16| Zebrafish DNA sequence from clone CH211-149L22 ... 44 0.41
13gb|AC153497.8| Mus musculus 10 BAC RP23-226H21 (Roswell Park Can... 44 0.41
14gb|AC153825.7| Mus musculus 10 BAC RP23-70B19 (Roswell Park Canc... 44 0.41
15emb|CR381573.14| Zebrafish DNA sequence from clone DKEY-23M15 in... 42 1.6
16gb|AC107638.17| Mus musculus, clone RP23-44D14, complete sequence 42 1.6
17emb|AL355603.17| Human DNA sequence from clone RP11-394M3 on chr... 42 1.6
18emb|BX663528.10| Zebrafish DNA sequence from clone DKEYP-47F9 in... 42 1.6
19gb|AC165445.1| Mus musculus BAC clone RP23-10J16 from chromosome... 42 1.6
20gb|AC154646.2| Mus musculus BAC clone RP23-283B12 from chromosom... 42 1.6
21gb|AC150313.7| Mus musculus BAC clone RP23-436A18 from chromosom... 42 1.6
22gb|AC026888.6|AC026888 Homo sapiens chromosome 14 clone CTD-2243... 42 1.6
23emb|BX005057.8| Zebrafish DNA sequence from clone DKEY-12L12 in ... 42 1.6
24emb|AL450399.16| Mouse DNA sequence from clone RP23-286I5 on chr... 42 1.6
25gb|AC116409.9| Mus musculus chromosome 3, clone RP24-337P23, com... 40 6.4
26emb|CT025590.5| Mouse DNA sequence from clone RP24-132A1 on chro... 40 6.4
27emb|BX914197.15| Zebrafish DNA sequence from clone DKEYP-81F11 i... 40 6.4
28gb|AC154580.2| Mus musculus BAC clone RP23-380H1 from chromosome... 40 6.4
29emb|AL450363.12| Human DNA sequence from clone RP11-469M2 on chr... 40 6.4
30emb|AL357376.16| Human DNA sequence from clone RP11-43G16 on chr... 40 6.4
31emb|AL354951.7| Human DNA sequence from clone RP11-451M19 on chr... 40 6.4
32emb|AL137019.6| Human DNA sequence from clone RP11-143P10 on chr... 40 6.4
33emb|AL133416.8| Human DNA sequence from clone RP11-271I13 on chr... 40 6.4
34emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome 40 6.4
35emb|BX005005.19| Zebrafish DNA sequence from clone DKEY-70O15 in... 40 6.4
36emb|BX088648.9| Mouse DNA sequence from clone RP23-156M16 on chr... 40 6.4
37emb|AL603917.5| Mouse DNA sequence from clone RP23-107J13 on chr... 40 6.4
38emb|BX571700.8| Zebrafish DNA sequence from clone CH211-168K14 i... 40 6.4
39emb|BX248332.14| Zebrafish DNA sequence from clone CH211-212O2 i... 40 6.4
40gb|AC069023.5| Homo sapiens chromosome 10 clone RP11-457D2, comp... 40 6.4
41emb|BX546473.10| Zebrafish DNA sequence from clone DKEYP-51F2 in... 40 6.4
42gb|AC118584.18| Papio anubis clone rp41-78d16, complete sequence 40 6.4
43gb|AC117273.41| Papio anubis clone rp41-167h10, complete sequence 40 6.4
44gb|AC025428.10| Homo sapiens chromosome 10 clone RP11-475D12, co... 40 6.4
45gb|AC079319.19| Homo sapiens 12q BAC RP11-118A3 (Roswell Park Ca... 40 6.4
46gb|AC092445.4| Homo sapiens BAC clone RP11-676H8 from 4, complet... 40 6.4
47emb|CR388226.3| Mouse DNA sequence from clone RP24-131D9 on chro... 40 6.4
48gb|AC009014.5| Homo sapiens chromosome 5 clone P1_748D6, complet... 40 6.4
49emb|BX827002.1|CNS0A4AI Arabidopsis thaliana Full-length cDNA Co... 40 6.4
50gb|AC171128.2| Helobdella robusta clone CH306-1A10, complete seq... 40 6.4
51gb|AC099518.3| Homo sapiens chromosome 16 clone RP11-626G11, com... 40 6.4
52emb|AL391731.1|ATT6L19 Arabidopsis thaliana DNA chromosome 3, BA... 40 6.4
53emb|AL928997.8| Zebrafish DNA sequence from clone CH211-125O15 i... 40 6.4
54emb|CR955007.2| Medicago truncatula chromosome 5 clone mte1-58b2... 40 6.4

>gb|AF543426.1| Leymus cinereus putative serine/threonine phosphatase (PRC140) gene,
            partial cds
          Length = 1146

 Score =  165 bits (83), Expect = 2e-37
 Identities = 89/91 (97%)
 Strand = Plus / Minus

                                                                        
Query: 384  aagccttgtcattgccgatgcaaagaggcctggctatgtctatggcttcctggttatcca 443
            |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 1139 aagccttgtcattgccgatgcagagaggcctggcgatgtctatggcttcctggttatcca 1080

                                           
Query: 444  ccttatcccacaagccatcagaggcaagtac 474
            |||||||||||||||||||||||||||||||
Sbjct: 1079 ccttatcccacaagccatcagaggcaagtac 1049



to top

>gb|AF543425.1| Leymus triticoides putative serine/threonine phosphatase (PRC140)
            gene, partial cds
          Length = 1104

 Score =  165 bits (83), Expect = 2e-37
 Identities = 89/91 (97%)
 Strand = Plus / Minus

                                                                        
Query: 384  aagccttgtcattgccgatgcaaagaggcctggctatgtctatggcttcctggttatcca 443
            |||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||
Sbjct: 1097 aagccttgtcattgccgatgcagagaggcctggcgatgtctatggcttcctggttatcca 1038

                                           
Query: 444  ccttatcccacaagccatcagaggcaagtac 474
            |||||||||||||||||||||||||||||||
Sbjct: 1037 ccttatcccacaagccatcagaggcaagtac 1007



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  103 bits (52), Expect = 5e-19
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                            
Query: 302      tgtatgatcaaaacgctgatgtcatcggtagaccccctggaacccgcggtttcgacaagc 361
                |||||||||| || |||||| || || || || ||||| | | |||| |||||||| |||
Sbjct: 10136988 tgtatgatcacaatgctgatatcgtcagtcgagcccctagtaaccgcagtttcgacgagc 10136929

                                                                            
Query: 362      cttntgcaagcagccatgctanaagccttgtcattgccgatgcaaagaggcctggctatg 421
                ||  ||||||||| ||||| | |||| ||||| |||| |||| |||| |||||||| |||
Sbjct: 10136928 ctcctgcaagcagtcatgcgagaagctttgtcgttgctgatgtaaagcggcctggcaatg 10136869

                                                                  
Query: 422      tctatggcttcctggttatccaccttatcccacaagccatcagaggcaag 471
                || |  || |||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 10136868 tcaactgcctcctggttctccaccttgtcccacaaaccatcagaggcaag 10136819



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 49/53 (92%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                     
Query: 25       agtatgaggtgagcactaaccctgccttattacattagaatcaaagaatgaat 77
                ||||||||||||| | |||| | ||||||||||||||||||||||||||||||
Sbjct: 10137361 agtatgaggtgagtagtaactc-gccttattacattagaatcaaagaatgaat 10137310



to top

>gb|AC137634.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBb0078C05, complete sequence
          Length = 122116

 Score =  103 bits (52), Expect = 5e-19
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                         
Query: 302   tgtatgatcaaaacgctgatgtcatcggtagaccccctggaacccgcggtttcgacaagc 361
             |||||||||| || |||||| || || || || ||||| | | |||| |||||||| |||
Sbjct: 82609 tgtatgatcacaatgctgatatcgtcagtcgagcccctagtaaccgcagtttcgacgagc 82550

                                                                         
Query: 362   cttntgcaagcagccatgctanaagccttgtcattgccgatgcaaagaggcctggctatg 421
             ||  ||||||||| ||||| | |||| ||||| |||| |||| |||| |||||||| |||
Sbjct: 82549 ctcctgcaagcagtcatgcgagaagctttgtcgttgctgatgtaaagcggcctggcaatg 82490

                                                               
Query: 422   tctatggcttcctggttatccaccttatcccacaagccatcagaggcaag 471
             || |  || |||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 82489 tcaactgcctcctggttctccaccttgtcccacaaaccatcagaggcaag 82440



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 49/53 (92%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                  
Query: 25    agtatgaggtgagcactaaccctgccttattacattagaatcaaagaatgaat 77
             ||||||||||||| | |||| | ||||||||||||||||||||||||||||||
Sbjct: 82982 agtatgaggtgagtagtaactc-gccttattacattagaatcaaagaatgaat 82931



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  103 bits (52), Expect = 5e-19
 Identities = 140/170 (82%)
 Strand = Plus / Minus

                                                                            
Query: 302      tgtatgatcaaaacgctgatgtcatcggtagaccccctggaacccgcggtttcgacaagc 361
                |||||||||| || |||||| || || || || ||||| | | |||| |||||||| |||
Sbjct: 10135109 tgtatgatcacaatgctgatatcgtcagtcgagcccctagtaaccgcagtttcgacgagc 10135050

                                                                            
Query: 362      cttntgcaagcagccatgctanaagccttgtcattgccgatgcaaagaggcctggctatg 421
                ||  ||||||||| ||||| | |||| ||||| |||| |||| |||| |||||||| |||
Sbjct: 10135049 ctcctgcaagcagtcatgcgagaagctttgtcgttgctgatgtaaagcggcctggcaatg 10134990

                                                                  
Query: 422      tctatggcttcctggttatccaccttatcccacaagccatcagaggcaag 471
                || |  || |||||||| |||||||| |||||||| ||||||||||||||
Sbjct: 10134989 tcaactgcctcctggttctccaccttgtcccacaaaccatcagaggcaag 10134940



 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 49/53 (92%), Gaps = 1/53 (1%)
 Strand = Plus / Minus

                                                                     
Query: 25       agtatgaggtgagcactaaccctgccttattacattagaatcaaagaatgaat 77
                ||||||||||||| | |||| | ||||||||||||||||||||||||||||||
Sbjct: 10135482 agtatgaggtgagtagtaactc-gccttattacattagaatcaaagaatgaat 10135431



to top

>emb|AJ242803.1|SST242803 Sporobolus stapfianus partial mRNA for putative serine/threonine
           phosphatase type 2c
          Length = 1075

 Score = 50.1 bits (25), Expect = 0.007
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 366 tgcaagcagccatgctanaagccttgtcattgccgatgcaaagaggcc 413
           |||| |||||||||| | ||||||||||||||| | |||| |||||||
Sbjct: 727 tgcaggcagccatgcgagaagccttgtcattgctggtgcagagaggcc 680



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
               sequence
          Length = 27566993

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 58      attagaatcaaagaatgaatgaatgga 84
               |||| ||||||||||||||||||||||
Sbjct: 3713421 attaaaatcaaagaatgaatgaatgga 3713447



to top

>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence
          Length = 27492551

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                          
Query: 58      attagaatcaaagaatgaatgaatgga 84
               |||| ||||||||||||||||||||||
Sbjct: 3713395 attaaaatcaaagaatgaatgaatgga 3713421



to top

>emb|AL713933.6|CNS07YPE Oryza sativa chromosome 12, . BAC OJ1041_D02 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 104421

 Score = 46.1 bits (23), Expect = 0.10
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 58    attagaatcaaagaatgaatgaatgga 84
             |||| ||||||||||||||||||||||
Sbjct: 36252 attaaaatcaaagaatgaatgaatgga 36226



to top

>emb|AL513523.33| Human DNA sequence from clone RP11-216N14 on chromosome 1 Contains a
              survival of motor neuron protein interacting protein 1
              pseudogene (SIP1), a novel gene (FLJ21919), two novel
              genes, a novel gene, the SLC27A3 gene for solute carrier
              family 27 (fatty acid transporter), member 3, a pseudogene
              similar to part of putative neuronal cell adhesion molecule
              (PUNC), the 3' end of the gene for transcription repressor
              p66 beta component of the MeCP1 complex (P66beta), a
              adipose differentiation-related protein (ADFP) pseudogene
              and a CpG island, complete sequence
          Length = 150166

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 32/34 (94%), Gaps = 1/34 (2%)
 Strand = Plus / Plus

                                                
Query: 61     agaatcaaagaatgaatgaatggaattaaattaa 94
              |||||||| |||||||||||| ||||||||||||
Sbjct: 114166 agaatcaacgaatgaatgaat-gaattaaattaa 114198



to top

>emb|CR391999.9| Zebrafish DNA sequence from clone CH211-261L7 in linkage group 5,
             complete sequence
          Length = 176753

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 67    aaagaatgaatgaatggaatta 88
             ||||||||||||||||||||||
Sbjct: 90735 aaagaatgaatgaatggaatta 90714



to top

>emb|AL929549.16| Zebrafish DNA sequence from clone CH211-149L22 in linkage group 5,
             complete sequence
          Length = 146059

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 67    aaagaatgaatgaatggaatta 88
             ||||||||||||||||||||||
Sbjct: 36936 aaagaatgaatgaatggaatta 36915



to top

>gb|AC153497.8| Mus musculus 10 BAC RP23-226H21 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 179741

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 25    agtatgaggtgagcactaaccctgcc 50
             ||||||||||||||||||||| ||||
Sbjct: 50200 agtatgaggtgagcactaaccatgcc 50225



to top

>gb|AC153825.7| Mus musculus 10 BAC RP23-70B19 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 279677

 Score = 44.1 bits (22), Expect = 0.41
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 25     agtatgaggtgagcactaaccctgcc 50
              ||||||||||||||||||||| ||||
Sbjct: 228129 agtatgaggtgagcactaaccatgcc 228154



to top

>emb|CR381573.14| Zebrafish DNA sequence from clone DKEY-23M15 in linkage group 24,
             complete sequence
          Length = 120376

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 71    aatgaatgaatggaattaaat 91
             |||||||||||||||||||||
Sbjct: 39021 aatgaatgaatggaattaaat 39041



to top

>gb|AC107638.17| Mus musculus, clone RP23-44D14, complete sequence
          Length = 231286

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 60     tagaatcaaagaatgaatgaa 80
              |||||||||||||||||||||
Sbjct: 199795 tagaatcaaagaatgaatgaa 199815



to top

>emb|AL355603.17| Human DNA sequence from clone RP11-394M3 on chromosome 13 Contains the
             5' end of a novel gene (KIAA1165) (likely ortholog of
             mouse Nedd4 WW domain-binding protein 5A), a novel gene
             and a CpG island, complete sequence
          Length = 101771

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 69    agaatgaatgaatggaattaa 89
             |||||||||||||||||||||
Sbjct: 19279 agaatgaatgaatggaattaa 19299



to top

>emb|BX663528.10| Zebrafish DNA sequence from clone DKEYP-47F9 in linkage group 17,
              complete sequence
          Length = 193986

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 70     gaatgaatgaatggaattaaattaa 94
              ||||||||||||| |||||||||||
Sbjct: 100350 gaatgaatgaatgaaattaaattaa 100374



to top

>gb|AC165445.1| Mus musculus BAC clone RP23-10J16 from chromosome 17, complete
            sequence
          Length = 209118

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 71   aatgaatgaatggaattaaat 91
            |||||||||||||||||||||
Sbjct: 3849 aatgaatgaatggaattaaat 3829



to top

>gb|AC154646.2| Mus musculus BAC clone RP23-283B12 from chromosome 14, complete
             sequence
          Length = 189102

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 60    tagaatcaaagaatgaatgaatgga 84
             ||||||||| |||||||||||||||
Sbjct: 47601 tagaatcaaggaatgaatgaatgga 47625



to top

>gb|AC150313.7| Mus musculus BAC clone RP23-436A18 from chromosome 7, complete sequence
          Length = 204095

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 60    tagaatcaaagaatgaatgaa 80
             |||||||||||||||||||||
Sbjct: 51293 tagaatcaaagaatgaatgaa 51313



to top

>gb|AC026888.6|AC026888 Homo sapiens chromosome 14 clone CTD-2243E23 and CTD-2009K21 map
              14q24.3-31, complete sequence
          Length = 208894

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 63     aatcaaagaatgaatgaatggaattaaat 91
              |||||| ||||||||||||| ||||||||
Sbjct: 123131 aatcaatgaatgaatgaatgtaattaaat 123103



to top

>emb|BX005057.8| Zebrafish DNA sequence from clone DKEY-12L12 in linkage group 24,
             complete sequence
          Length = 238625

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 71    aatgaatgaatggaattaaat 91
             |||||||||||||||||||||
Sbjct: 77824 aatgaatgaatggaattaaat 77804



to top

>emb|AL450399.16| Mouse DNA sequence from clone RP23-286I5 on chromosome X, complete
              sequence
          Length = 207922

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 62     gaatcaaagaatgaatgaatg 82
              |||||||||||||||||||||
Sbjct: 159811 gaatcaaagaatgaatgaatg 159791



to top

>gb|AC116409.9| Mus musculus chromosome 3, clone RP24-337P23, complete sequence
          Length = 162232

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 419    atgtctatggcttcctggtt 438
              ||||||||||||||||||||
Sbjct: 115344 atgtctatggcttcctggtt 115363



to top

>emb|CT025590.5| Mouse DNA sequence from clone RP24-132A1 on chromosome 14, complete
              sequence
          Length = 193572

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 71     aatgaatgaatggaattaaattaa 94
              ||||||||||||||| ||||||||
Sbjct: 145549 aatgaatgaatggaaataaattaa 145526



to top

>emb|BX914197.15| Zebrafish DNA sequence from clone DKEYP-81F11 in linkage group 11,
              complete sequence
          Length = 198600

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 55     tacattagaatcaaagaatgaatgaatg 82
              ||||| ||||| ||||||||||||||||
Sbjct: 107166 tacatgagaatgaaagaatgaatgaatg 107193



to top

>gb|AC154580.2| Mus musculus BAC clone RP23-380H1 from chromosome 14, complete
            sequence
          Length = 187377

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 71   aatgaatgaatggaattaaattaa 94
            ||||||||||||||| ||||||||
Sbjct: 4560 aatgaatgaatggaaataaattaa 4583



to top

>emb|AL450363.12| Human DNA sequence from clone RP11-469M2 on chromosome 10, complete
            sequence
          Length = 114333

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 84   aattaaattaagtacataaa 103
            ||||||||||||||||||||
Sbjct: 9665 aattaaattaagtacataaa 9684



to top

>emb|AL357376.16| Human DNA sequence from clone RP11-43G16 on chromosome 6, complete
            sequence
          Length = 45386

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 63   aatcaaagaatgaatgaatg 82
            ||||||||||||||||||||
Sbjct: 7573 aatcaaagaatgaatgaatg 7554



to top

>emb|AL354951.7| Human DNA sequence from clone RP11-451M19 on chromosome 10 Contains a
            ribosomal protein L21 (RPL21) pseudogene, the XPNPEP1
            gene for X-prolyl aminopeptidase (aminopeptidase P) 1,
            soluble (SAMP, XPNPEP, XPNPEPL), a novel gene and one CpG
            island, complete sequence
          Length = 205329

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 63   aatcaaagaatgaatgaatg 82
            ||||||||||||||||||||
Sbjct: 1928 aatcaaagaatgaatgaatg 1947



to top

>emb|AL137019.6| Human DNA sequence from clone RP11-143P10 on chromosome 9q31.3-33.1,
             complete sequence
          Length = 181542

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 132   ttgcaaaatggtgcaaccac 151
             ||||||||||||||||||||
Sbjct: 44155 ttgcaaaatggtgcaaccac 44174



to top

>emb|AL133416.8| Human DNA sequence from clone RP11-271I13 on chromosome 10, complete
             sequence
          Length = 41435

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 63    aatcaaagaatgaatgaatg 82
             ||||||||||||||||||||
Sbjct: 41363 aatcaaagaatgaatgaatg 41382



to top

>emb|CR522870.1| Desulfotalea psychrophila LSv54 chromosome
          Length = 3523383

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 3       acatacaacaacagcctctt 22
               ||||||||||||||||||||
Sbjct: 1051774 acatacaacaacagcctctt 1051755



to top

>emb|BX005005.19| Zebrafish DNA sequence from clone DKEY-70O15 in linkage group 13,
             complete sequence
          Length = 153184

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 62    gaatcaaagaatgaatgaatggaa 85
             |||| |||||||||||||||||||
Sbjct: 91485 gaatgaaagaatgaatgaatggaa 91508



to top

>emb|BX088648.9| Mouse DNA sequence from clone RP23-156M16 on chromosome 11, complete
              sequence
          Length = 199838

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 65     tcaaagaatgaatgaatggaattaaatt 92
              ||||||||||| |||| |||||||||||
Sbjct: 160509 tcaaagaatgagtgaaaggaattaaatt 160536



to top

>emb|AL603917.5| Mouse DNA sequence from clone RP23-107J13 on chromosome 11 Contains a
              novel gene, a glyoxalase 1 (Glo1) pseudogene and a
              pseudogene similar to part of nuclear pore membrane protein
              121 Pom121, complete sequence
          Length = 212255

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 63     aatcaaagaatgaatgaatg 82
              ||||||||||||||||||||
Sbjct: 201770 aatcaaagaatgaatgaatg 201751



to top

>emb|BX571700.8| Zebrafish DNA sequence from clone CH211-168K14 in linkage group 9,
              complete sequence
          Length = 137898

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 63     aatcaaagaatgaatgaatg 82
              ||||||||||||||||||||
Sbjct: 116461 aatcaaagaatgaatgaatg 116480



to top

>emb|BX248332.14| Zebrafish DNA sequence from clone CH211-212O2 in linkage group 9,
             complete sequence
          Length = 237498

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 71    aatgaatgaatggaattaaattaa 94
             |||||||||||| |||||||||||
Sbjct: 40421 aatgaatgaatgaaattaaattaa 40444



to top

>gb|AC069023.5| Homo sapiens chromosome 10 clone RP11-457D2, complete sequence
          Length = 131345

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 64    atcaaagaatgaatgaatggaatt 87
             ||||| ||||||||||||||||||
Sbjct: 23294 atcaatgaatgaatgaatggaatt 23317



to top

>emb|BX546473.10| Zebrafish DNA sequence from clone DKEYP-51F2 in linkage group 3,
             complete sequence
          Length = 211253

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 70    gaatgaatgaatggaattaa 89
             ||||||||||||||||||||
Sbjct: 29853 gaatgaatgaatggaattaa 29834



to top

>gb|AC118584.18| Papio anubis clone rp41-78d16, complete sequence
          Length = 189610

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 64    atcaaagaatgaatgaatgg 83
             ||||||||||||||||||||
Sbjct: 36222 atcaaagaatgaatgaatgg 36241



to top

>gb|AC117273.41| Papio anubis clone rp41-167h10, complete sequence
          Length = 184931

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 64     atcaaagaatgaatgaatgg 83
              ||||||||||||||||||||
Sbjct: 114077 atcaaagaatgaatgaatgg 114058



to top

>gb|AC025428.10| Homo sapiens chromosome 10 clone RP11-475D12, complete sequence
          Length = 174906

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 61     agaatcaaagaatgaatgaatgga 84
              |||||||| |||||||||||||||
Sbjct: 139046 agaatcaatgaatgaatgaatgga 139023



to top

>gb|AC079319.19| Homo sapiens 12q BAC RP11-118A3 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 152449

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 62    gaatcaaagaatgaatgaatggaa 85
             |||||||||||||||| |||||||
Sbjct: 38710 gaatcaaagaatgaataaatggaa 38687



to top

>gb|AC092445.4| Homo sapiens BAC clone RP11-676H8 from 4, complete sequence
          Length = 173840

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    ttaaattaagtacataaaga 105
             ||||||||||||||||||||
Sbjct: 15250 ttaaattaagtacataaaga 15231



to top

>emb|CR388226.3| Mouse DNA sequence from clone RP24-131D9 on chromosome 2, complete
            sequence
          Length = 15347

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 84   aattaaattaagtacataaa 103
            ||||||||||||||||||||
Sbjct: 3048 aattaaattaagtacataaa 3067



to top

>gb|AC009014.5| Homo sapiens chromosome 5 clone P1_748D6, complete sequence
          Length = 88365

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 72    atgaatgaatggaattaaat 91
             ||||||||||||||||||||
Sbjct: 60251 atgaatgaatggaattaaat 60270



to top

>emb|BX827002.1|CNS0A4AI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB85ZC10 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1702

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 308  atcaaaacgctgatgtcatc 327
            ||||||||||||||||||||
Sbjct: 1379 atcaaaacgctgatgtcatc 1398



to top

>gb|AC171128.2| Helobdella robusta clone CH306-1A10, complete sequence
          Length = 76716

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 67   aaagaatgaatgaatggaat 86
            ||||||||||||||||||||
Sbjct: 9959 aaagaatgaatgaatggaat 9940



to top

>gb|AC099518.3| Homo sapiens chromosome 16 clone RP11-626G11, complete sequence
          Length = 216264

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 64    atcaaagaatgaatgaatgg 83
             ||||||||||||||||||||
Sbjct: 36914 atcaaagaatgaatgaatgg 36895



to top

>emb|AL391731.1|ATT6L19 Arabidopsis thaliana DNA chromosome 3, BAC clone T6L19
          Length = 47069

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 50    cttattacattagaatcaaa 69
             ||||||||||||||||||||
Sbjct: 14068 cttattacattagaatcaaa 14087



to top

>emb|AL928997.8| Zebrafish DNA sequence from clone CH211-125O15 in linkage group 18,
             complete sequence
          Length = 169038

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 67    aaagaatgaatgaatggaattaaa 90
             |||||||||||||||| |||||||
Sbjct: 90883 aaagaatgaatgaatgaaattaaa 90906



to top

>emb|CR955007.2| Medicago truncatula chromosome 5 clone mte1-58b20, COMPLETE SEQUENCE
          Length = 108616

 Score = 40.1 bits (20), Expect = 6.4
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 67   aaagaatgaatgaatggaattaaattaa 94
            ||||||||||||||| ||||||||||||
Sbjct: 9575 aaagaatgaatgaat-gaattaaattaa 9549


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,882,653
Number of Sequences: 3902068
Number of extensions: 3882653
Number of successful extensions: 85861
Number of sequences better than 10.0: 55
Number of HSP's better than 10.0 without gapping: 53
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 85655
Number of HSP's gapped (non-prelim): 208
length of query: 477
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 455
effective length of database: 17,147,199,772
effective search space: 7801975896260
effective search space used: 7801975896260
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top