ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf96k17
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_001051287.1| Oryza sativa (japonica cultivar-group) Os01g... 515 e-143
2dbj|AK064685.1| Oryza sativa (japonica cultivar-group) cDNA clon... 515 e-143
3emb|CT831722.1| Oryza sativa (indica cultivar-group) cDNA clone:... 500 e-138
4gb|DQ245857.1| Zea mays clone 20924 mRNA sequence 385 e-103
5ref|NM_001062293.1| Oryza sativa (japonica cultivar-group) Os05g... 377 e-101
6dbj|AK103320.1| Oryza sativa (japonica cultivar-group) cDNA clon... 377 e-101
7dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 125 3e-25
8dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic D... 125 3e-25
9dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic D... 125 3e-25
10gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome... 92 4e-15
11dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 92 4e-15
12gb|AY022792.1| Oryza sativa microsatellite MRG5117 containing (C... 80 1e-11
13dbj|AK228114.1| Arabidopsis thaliana mRNA for ribsomal protein -... 62 3e-06
14ref|NM_121014.2| Arabidopsis thaliana structural constituent of ... 62 3e-06
15gb|AY086225.1| Arabidopsis thaliana clone 22697 mRNA, complete s... 62 3e-06
16gb|BT003108.1| Arabidopsis thaliana At5g09770 mRNA, complete cds 62 3e-06
17emb|BX832882.1|CNS0A21B Arabidopsis thaliana Full-length cDNA Co... 62 3e-06
18emb|BX832861.1|CNS0A22N Arabidopsis thaliana Full-length cDNA Co... 60 1e-05
19gb|CP000238.1| Baumannia cicadellinicola str. Hc (Homalodisca co... 52 0.003
20gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete ... 52 0.003
21dbj|AB020752.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 52 0.003
22gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome 52 0.003
23emb|AL353994.1|ATF17I14 Arabidopsis thaliana DNA chromosome 5, B... 52 0.003
24emb|CT009568.8| M.truncatula DNA sequence from clone MTH2-95K22 ... 46 0.19
25emb|BX061381.1|CNS09JIX Single read from an extremity of a full-... 46 0.19
26emb|BX060210.1|CNS09IME Single read from an extremity of a full-... 46 0.19
27emb|BX060209.1|CNS09IMD Single read from an extremity of a full-... 46 0.19
28gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequ... 46 0.19
29emb|BX019804.1|CNS08NG0 Single read from an extremity of a full-... 46 0.19
30emb|BX019803.1|CNS08NFZ Single read from an extremity of a full-... 46 0.19
31ref|XM_321202.2| Anopheles gambiae str. PEST ENSANGP00000020872 ... 46 0.19
32emb|AL772303.11| Mouse DNA sequence from clone RP23-185P20 on ch... 46 0.19
33gb|CP000481.1| Acidothermus cellulolyticus 11B, complete genome 44 0.77
34gb|BT025732.1| Arabidopsis thaliana At5g64650 mRNA, complete cds 44 0.77
35ref|NM_125861.2| Arabidopsis thaliana structural constituent of ... 44 0.77
36gb|AE006177.1| Pasteurella multocida subsp. multocida str. Pm70 ... 44 0.77
37gb|AE005770.1| Caulobacter crescentus CB15 section 96 of 359 of ... 44 0.77
38emb|AL365220.24| Human DNA sequence from clone RP4-735N21 on chr... 44 0.77
39gb|AY086818.1| Arabidopsis thaliana clone 2806 mRNA, complete se... 44 0.77
40dbj|AK118268.1| Arabidopsis thaliana At5g64650 mRNA for putative... 44 0.77
41emb|AM260479.1| Ralstonia eutropha H16 chromosome 1 42 3.0
42emb|CR848708.12| Wallaby DNA sequence from clone MEKBa-201B9, co... 42 3.0
43gb|AC019235.6| Homo sapiens BAC clone RP11-665C14 from 4, comple... 42 3.0
44gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 42 3.0
45gb|AC093326.3| Homo sapiens BAC clone RP11-625N16 from 2, comple... 42 3.0
46dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 42 3.0 
>ref|NM_001051287.1| Oryza sativa (japonica cultivar-group) Os01g0839300 (Os01g0839300)
           mRNA, complete cds
          Length = 789
 Score =  515 bits (260), Expect = e-143
 Identities = 404/452 (89%)
 Strand = Plus / Plus

                                                                       
Query: 29  gccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcgtgtccatgctcagg 88
           |||||||| ||||||||||||||||| ||||||||||| ||||| || ||||||||||||
Sbjct: 78  gccatggggaagttccgcaagctcggccgccacgccgcccaccgagtatccatgctcagg 137

                                                                       
Query: 89  acgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgccaaggcgaag 148
           ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 138 acgatggtgtcgcagctcgtgaagcacgagcgaatcgagaccaccgtcgccaaggcgaag 197

                                                                       
Query: 149 gaggtgcggcgcaaggcggatcagatggtgcagctcggcaaagatggtacactggatgca 208
           |||||||||||||||||||||||||||||||||||||| ||||| || ||| ||||||||
Sbjct: 198 gaggtgcggcgcaaggcggatcagatggtgcagctcgggaaagagggcacattggatgca 257

                                                                       
Query: 209 gcaagacgtgcttctgcttttgttcgtggagatgatgttgtccataagctattcacagag 268
           |||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 258 gcaagacgtgcttctgcttttgttcggggagatgatgttgttcataagctatttacagag 317

                                                                       
Query: 269 ctggcctaccgctataaagatcgagcaggcggatatacaagacttttgcgaactaggata 328
           || |||||||| || ||  | ||||| || || || || ||||| |||||||||||||||
Sbjct: 318 ctagcctaccgttacaagaaccgagctggtgggtacaccagactattgcgaactaggata 377

                                                                       
Query: 329 cgaataggtgatgctgcaccaatggcatacattgagtttgttgacagagagaacgaactc 388
           ||| | |||||||||||||| ||||||||||||||||| ||||| || || || ||||| 
Sbjct: 378 cgagttggtgatgctgcaccgatggcatacattgagttcgttgatagggaaaatgaactt 437

                                                                       
Query: 389 cgagaggccaaacctgcaacgccaccaccgcctcagcgggttccacttgatccatgggcc 448
           ||||| |||||||||||||| ||||  || ||||| |||  ||| |||||||| ||||||
Sbjct: 438 cgagaagccaaacctgcaacaccacagccacctcaacggtctcctcttgatccctgggcc 497

                                           
Query: 449 aaatctcgtgctagccagcaatgggcgggacc 480
           || |||||||||||||| || |||||||||||
Sbjct: 498 aagtctcgtgctagccaacagtgggcgggacc 529
to top
>dbj|AK064685.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-116-D07, full
           insert sequence
          Length = 789

 Score =  515 bits (260), Expect = e-143
 Identities = 404/452 (89%)
 Strand = Plus / Plus

                                                                       
Query: 29  gccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcgtgtccatgctcagg 88
           |||||||| ||||||||||||||||| ||||||||||| ||||| || ||||||||||||
Sbjct: 78  gccatggggaagttccgcaagctcggccgccacgccgcccaccgagtatccatgctcagg 137

                                                                       
Query: 89  acgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgccaaggcgaag 148
           ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 138 acgatggtgtcgcagctcgtgaagcacgagcgaatcgagaccaccgtcgccaaggcgaag 197

                                                                       
Query: 149 gaggtgcggcgcaaggcggatcagatggtgcagctcggcaaagatggtacactggatgca 208
           |||||||||||||||||||||||||||||||||||||| ||||| || ||| ||||||||
Sbjct: 198 gaggtgcggcgcaaggcggatcagatggtgcagctcgggaaagagggcacattggatgca 257

                                                                       
Query: 209 gcaagacgtgcttctgcttttgttcgtggagatgatgttgtccataagctattcacagag 268
           |||||||||||||||||||||||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 258 gcaagacgtgcttctgcttttgttcggggagatgatgttgttcataagctatttacagag 317

                                                                       
Query: 269 ctggcctaccgctataaagatcgagcaggcggatatacaagacttttgcgaactaggata 328
           || |||||||| || ||  | ||||| || || || || ||||| |||||||||||||||
Sbjct: 318 ctagcctaccgttacaagaaccgagctggtgggtacaccagactattgcgaactaggata 377

                                                                       
Query: 329 cgaataggtgatgctgcaccaatggcatacattgagtttgttgacagagagaacgaactc 388
           ||| | |||||||||||||| ||||||||||||||||| ||||| || || || ||||| 
Sbjct: 378 cgagttggtgatgctgcaccgatggcatacattgagttcgttgatagggaaaatgaactt 437

                                                                       
Query: 389 cgagaggccaaacctgcaacgccaccaccgcctcagcgggttccacttgatccatgggcc 448
           ||||| |||||||||||||| ||||  || ||||| |||  ||| |||||||| ||||||
Sbjct: 438 cgagaagccaaacctgcaacaccacagccacctcaacggtctcctcttgatccctgggcc 497

                                           
Query: 449 aaatctcgtgctagccagcaatgggcgggacc 480
           || |||||||||||||| || |||||||||||
Sbjct: 498 aagtctcgtgctagccaacagtgggcgggacc 529
to top
>emb|CT831722.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCPI015H11, full
           insert sequence
          Length = 800

 Score =  500 bits (252), Expect = e-138
 Identities = 402/452 (88%)
 Strand = Plus / Plus

                                                                       
Query: 29  gccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcgtgtccatgctcagg 88
           |||||||| ||||||||||||||||| ||||||||||| ||||| || ||||||||||||
Sbjct: 73  gccatggggaagttccgcaagctcggccgccacgccgcccaccgagtatccatgctcagg 132

                                                                       
Query: 89  acgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgccaaggcgaag 148
           ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||
Sbjct: 133 acgatggtgtcgcagctcgtgaagcacgagcgaatcgagaccaccgtcgccaaggcgaag 192

                                                                       
Query: 149 gaggtgcggcgcaaggcggatcagatggtgcagctcggcaaagatggtacactggatgca 208
           |||||||||||||||||||||||||||||||||||||| ||||| || ||| ||||||||
Sbjct: 193 gaggtgcggcgcaaggcggatcagatggtgcagctcgggaaagagggcacattggatgca 252

                                                                       
Query: 209 gcaagacgtgcttctgcttttgttcgtggagatgatgttgtccataagctattcacagag 268
           ||||||||||| |||||||||||||| |||||||||||||| ||||||||||| ||||||
Sbjct: 253 gcaagacgtgcctctgcttttgttcggggagatgatgttgttcataagctatttacagag 312

                                                                       
Query: 269 ctggcctaccgctataaagatcgagcaggcggatatacaagacttttgcgaactaggata 328
           || || ||||| || ||  | ||||| || || || || ||||| |||||||||||||||
Sbjct: 313 ctagcgtaccgttacaagaaccgagctggtgggtacaccagactattgcgaactaggata 372

                                                                       
Query: 329 cgaataggtgatgctgcaccaatggcatacattgagtttgttgacagagagaacgaactc 388
           ||| | |||||||||||||| ||||||||||||||||| ||||| || || || ||||| 
Sbjct: 373 cgagttggtgatgctgcaccgatggcatacattgagttcgttgatagggaaaatgaactt 432

                                                                       
Query: 389 cgagaggccaaacctgcaacgccaccaccgcctcagcgggttccacttgatccatgggcc 448
           ||||| |||||||||||||| ||||  || ||||| |||  ||| |||||||| ||||||
Sbjct: 433 cgagaagccaaacctgcaacaccacagccacctcaacggtctcctcttgatccctgggcc 492

                                           
Query: 449 aaatctcgtgctagccagcaatgggcgggacc 480
           || |||||||||||||| || |||||||||||
Sbjct: 493 aagtctcgtgctagccaacagtgggcgggacc 524
to top
>gb|DQ245857.1| Zea mays clone 20924 mRNA sequence
          Length = 910

 Score =  385 bits (194), Expect = e-103
 Identities = 350/402 (87%)
 Strand = Plus / Plus

                                                                       
Query: 79  catgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgc 138
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 150 catgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgc 209

                                                                       
Query: 139 caaggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcggcaaagatggtac 198
           ||||||||||||||| ||||| ||||||||||||||||||||||| || || || |||||
Sbjct: 210 caaggcgaaggaggttcggcggaaggcggatcagatggtgcagctagggaaggagggtac 269

                                                                       
Query: 199 actggatgcagcaagacgtgcttctgcttttgttcgtggagatgatgttgtccataagct 258
            | | ||||||||||||||||| |||| |||||||| || |||||||| || ||||||||
Sbjct: 270 tcagcatgcagcaagacgtgctgctgcctttgttcggggtgatgatgtcgttcataagct 329

                                                                       
Query: 259 attcacagagctggcctaccgctataaagatcgagcaggcggatatacaagacttttgcg 318
           ||| || |||||||||| |||||| | ||||||||| || || || |||||| | ||  |
Sbjct: 330 atttactgagctggccttccgctacagagatcgagctgggggctacacaagaatgttaag 389

                                                                       
Query: 319 aactaggatacgaataggtgatgctgcaccaatggcatacattgagtttgttgacagaga 378
           ||| ||||||||  | ||||||||||| |||||||||||||| ||||| || ||||| ||
Sbjct: 390 aaccaggatacgtgttggtgatgctgctccaatggcatacatcgagttcgtggacaggga 449

                                                                       
Query: 379 gaacgaactccgagaggccaaacctgcaacgccaccaccgcctcagcgggttccacttga 438
           ||| || || ||||||||||||||||||||||| || |||||||| || |  || |||||
Sbjct: 450 gaatgagcttcgagaggccaaacctgcaacgccgccgccgcctcaacgagcccctcttga 509

                                                     
Query: 439 tccatgggccaaatctcgtgctagccagcaatgggcgggacc 480
           |||||||||||| || ||||||||||| || ||||| |||||
Sbjct: 510 tccatgggccaagtcacgtgctagccaacagtgggcaggacc 551
to top
>ref|NM_001062293.1| Oryza sativa (japonica cultivar-group) Os05g0460700 (Os05g0460700)
           mRNA, complete cds
          Length = 734

 Score =  377 bits (190), Expect = e-101
 Identities = 310/350 (88%)
 Strand = Plus / Plus

                                                                       
Query: 15  cccccgccgccgacgccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcg 74
           ||||| |||||| ||||||||| |||||||||||||| || ||||||||||| |||||||
Sbjct: 64  ccccctccgccgccgccatggggaagttccgcaagctgggccgccacgccgcccaccgcg 123

                                                                       
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccg 134
           | |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 124 tctccatgctcaggactatggtgtcgcagctggtgaagcatgagcggatcgagaccaccg 183

                                                                       
Query: 135 tcgccaaggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcggcaaagatg 194
           |||| ||||||||||||||||||   || ||||||||||||||||||||||||||||| |
Sbjct: 184 tcgcgaaggcgaaggaggtgcggacgaaagcggatcagatggtgcagctcggcaaagagg 243

                                                                       
Query: 195 gtacactggatgcagcaagacgtgcttctgcttttgttcgtggagatgatgttgtccata 254
           |||| || ||||||||||||||||| || || |||||||| || ||  ||||||| || |
Sbjct: 244 gtacgcttgatgcagcaagacgtgcctcagcctttgttcggggtgacaatgttgttcaca 303

                                                                       
Query: 255 agctattcacagagctggcctaccgctataaagatcgagcaggcggatatacaagacttt 314
           || |||||||||| || ||||||||||| ||||||||||| || ||||||||||||||  
Sbjct: 304 agttattcacagaactcgcctaccgctacaaagatcgagctggtggatatacaagactac 363

                                                             
Query: 315 tgcgaactaggatacgaataggtgatgctgcaccaatggcatacattgag 364
           |||| |||||||||||  | || |||||||||||||||||||||||||||
Sbjct: 364 tgcggactaggatacgggttggcgatgctgcaccaatggcatacattgag 413



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 364 gtttgttgacagagagaacgaactccgagaggccaaacctgcaacgccaccaccgcctca 423
           |||||| ||| | ||||| ||||| |||||||| ||||||||||| ||||  || |||||
Sbjct: 466 gtttgtcgaccgggagaatgaacttcgagaggcaaaacctgcaacaccacagccacctca 525

                                      
Query: 424 gcgggttccacttgatccatgggccaa 450
           |||||| || |||||||||||| ||||
Sbjct: 526 gcgggtccctcttgatccatggaccaa 552
to top
>dbj|AK103320.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033125I20, full
           insert sequence
          Length = 735

 Score =  377 bits (190), Expect = e-101
 Identities = 310/350 (88%)
 Strand = Plus / Plus

                                                                       
Query: 15  cccccgccgccgacgccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcg 74
           ||||| |||||| ||||||||| |||||||||||||| || ||||||||||| |||||||
Sbjct: 65  ccccctccgccgccgccatggggaagttccgcaagctgggccgccacgccgcccaccgcg 124

                                                                       
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccg 134
           | |||||||||||||| ||||||||||||||||||||||| ||||| |||||||||||||
Sbjct: 125 tctccatgctcaggactatggtgtcgcagctggtgaagcatgagcggatcgagaccaccg 184

                                                                       
Query: 135 tcgccaaggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcggcaaagatg 194
           |||| ||||||||||||||||||   || ||||||||||||||||||||||||||||| |
Sbjct: 185 tcgcgaaggcgaaggaggtgcggacgaaagcggatcagatggtgcagctcggcaaagagg 244

                                                                       
Query: 195 gtacactggatgcagcaagacgtgcttctgcttttgttcgtggagatgatgttgtccata 254
           |||| || ||||||||||||||||| || || |||||||| || ||  ||||||| || |
Sbjct: 245 gtacgcttgatgcagcaagacgtgcctcagcctttgttcggggtgacaatgttgttcaca 304

                                                                       
Query: 255 agctattcacagagctggcctaccgctataaagatcgagcaggcggatatacaagacttt 314
           || |||||||||| || ||||||||||| ||||||||||| || ||||||||||||||  
Sbjct: 305 agttattcacagaactcgcctaccgctacaaagatcgagctggtggatatacaagactac 364

                                                             
Query: 315 tgcgaactaggatacgaataggtgatgctgcaccaatggcatacattgag 364
           |||| |||||||||||  | || |||||||||||||||||||||||||||
Sbjct: 365 tgcggactaggatacgggttggcgatgctgcaccaatggcatacattgag 414



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 74/87 (85%)
 Strand = Plus / Plus

                                                                       
Query: 364 gtttgttgacagagagaacgaactccgagaggccaaacctgcaacgccaccaccgcctca 423
           |||||| ||| | ||||| ||||| |||||||| ||||||||||| ||||  || |||||
Sbjct: 467 gtttgtcgaccgggagaatgaacttcgagaggcaaaacctgcaacaccacagccacctca 526

                                      
Query: 424 gcgggttccacttgatccatgggccaa 450
           |||||| || |||||||||||| ||||
Sbjct: 527 gcgggtccctcttgatccatggaccaa 553
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score =  125 bits (63), Expect = 3e-25
 Identities = 75/79 (94%)
 Strand = Plus / Plus

                                                                            
Query: 201      tggatgcagcaagacgtgcttctgcttttgttcgtggagatgatgttgtccataagctat 260
                |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 36001969 tggatgcagcaagacgtgcttctgcttttgttcggggagatgatgttgttcataagctat 36002028

                                   
Query: 261      tcacagagctggcctaccg 279
                | |||||||| ||||||||
Sbjct: 36002029 ttacagagctagcctaccg 36002047



 Score =  101 bits (51), Expect = 4e-18
 Identities = 57/59 (96%)
 Strand = Plus / Plus

                                                                           
Query: 85       caggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgccaagg 143
                ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 36000882 caggacgatggtgtcgcagctcgtgaagcacgagcgaatcgagaccaccgtcgccaagg 36000940



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 51/52 (98%)
 Strand = Plus / Plus

                                                                    
Query: 141      aggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcggcaaaga 192
                |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 36001034 aggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcgggaaaga 36001085



 Score = 83.8 bits (42), Expect = 9e-13
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                          
Query: 308      agacttttgcgaactaggatacgaataggtgatgctgcaccaatggcatacattgagt 365
                ||||| |||||||||||||||||| | |||||||||||||| ||||||||||||||||
Sbjct: 36002323 agactattgcgaactaggatacgagttggtgatgctgcaccgatggcatacattgagt 36002380



 Score = 83.8 bits (42), Expect = 9e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                            
Query: 383      gaactccgagaggccaaacctgcaacgccaccaccgcctcagcgggttccacttgatcca 442
                ||||| ||||| |||||||||||||| ||||  || ||||| |||  ||| |||||||| 
Sbjct: 36002797 gaacttcgagaagccaaacctgcaacaccacagccacctcaacggtctcctcttgatccc 36002856

                                                      
Query: 443      tgggccaaatctcgtgctagccagcaatgggcgggacc 480
                |||||||| |||||||||||||| || |||||||||||
Sbjct: 36002857 tgggccaagtctcgtgctagccaacagtgggcgggacc 36002894



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                            
Query: 29       gccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcgtgtccatgctcagg 88
                |||||||| ||||||||||||||||| ||||||||||| ||||| || ||||||||||||
Sbjct: 36000738 gccatggggaagttccgcaagctcggccgccacgccgcccaccgagtatccatgctcagg 36000797
to top
>dbj|AP003241.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0408C03
          Length = 141273

 Score =  125 bits (63), Expect = 3e-25
 Identities = 75/79 (94%)
 Strand = Plus / Plus

                                                                         
Query: 201   tggatgcagcaagacgtgcttctgcttttgttcgtggagatgatgttgtccataagctat 260
             |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 14694 tggatgcagcaagacgtgcttctgcttttgttcggggagatgatgttgttcataagctat 14753

                                
Query: 261   tcacagagctggcctaccg 279
             | |||||||| ||||||||
Sbjct: 14754 ttacagagctagcctaccg 14772



 Score =  101 bits (51), Expect = 4e-18
 Identities = 57/59 (96%)
 Strand = Plus / Plus

                                                                        
Query: 85    caggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgccaagg 143
             ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 13607 caggacgatggtgtcgcagctcgtgaagcacgagcgaatcgagaccaccgtcgccaagg 13665



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 51/52 (98%)
 Strand = Plus / Plus

                                                                 
Query: 141   aggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcggcaaaga 192
             |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 13759 aggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcgggaaaga 13810



 Score = 83.8 bits (42), Expect = 9e-13
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                       
Query: 308   agacttttgcgaactaggatacgaataggtgatgctgcaccaatggcatacattgagt 365
             ||||| |||||||||||||||||| | |||||||||||||| ||||||||||||||||
Sbjct: 15048 agactattgcgaactaggatacgagttggtgatgctgcaccgatggcatacattgagt 15105



 Score = 83.8 bits (42), Expect = 9e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                         
Query: 383   gaactccgagaggccaaacctgcaacgccaccaccgcctcagcgggttccacttgatcca 442
             ||||| ||||| |||||||||||||| ||||  || ||||| |||  ||| |||||||| 
Sbjct: 15522 gaacttcgagaagccaaacctgcaacaccacagccacctcaacggtctcctcttgatccc 15581

                                                   
Query: 443   tgggccaaatctcgtgctagccagcaatgggcgggacc 480
             |||||||| |||||||||||||| || |||||||||||
Sbjct: 15582 tgggccaagtctcgtgctagccaacagtgggcgggacc 15619



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                         
Query: 29    gccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcgtgtccatgctcagg 88
             |||||||| ||||||||||||||||| ||||||||||| ||||| || ||||||||||||
Sbjct: 13463 gccatggggaagttccgcaagctcggccgccacgccgcccaccgagtatccatgctcagg 13522
to top
>dbj|AP003231.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0031D11
          Length = 138108

 Score =  125 bits (63), Expect = 3e-25
 Identities = 75/79 (94%)
 Strand = Plus / Plus

                                                                          
Query: 201    tggatgcagcaagacgtgcttctgcttttgttcgtggagatgatgttgtccataagctat 260
              |||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||
Sbjct: 100647 tggatgcagcaagacgtgcttctgcttttgttcggggagatgatgttgttcataagctat 100706

                                 
Query: 261    tcacagagctggcctaccg 279
              | |||||||| ||||||||
Sbjct: 100707 ttacagagctagcctaccg 100725



 Score =  101 bits (51), Expect = 4e-18
 Identities = 57/59 (96%)
 Strand = Plus / Plus

                                                                        
Query: 85    caggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgccaagg 143
             ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||
Sbjct: 99560 caggacgatggtgtcgcagctcgtgaagcacgagcgaatcgagaccaccgtcgccaagg 99618



 Score = 95.6 bits (48), Expect = 2e-16
 Identities = 51/52 (98%)
 Strand = Plus / Plus

                                                                 
Query: 141   aggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcggcaaaga 192
             |||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 99712 aggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcgggaaaga 99763



 Score = 83.8 bits (42), Expect = 9e-13
 Identities = 54/58 (93%)
 Strand = Plus / Plus

                                                                        
Query: 308    agacttttgcgaactaggatacgaataggtgatgctgcaccaatggcatacattgagt 365
              ||||| |||||||||||||||||| | |||||||||||||| ||||||||||||||||
Sbjct: 101001 agactattgcgaactaggatacgagttggtgatgctgcaccgatggcatacattgagt 101058



 Score = 83.8 bits (42), Expect = 9e-13
 Identities = 84/98 (85%)
 Strand = Plus / Plus

                                                                          
Query: 383    gaactccgagaggccaaacctgcaacgccaccaccgcctcagcgggttccacttgatcca 442
              ||||| ||||| |||||||||||||| ||||  || ||||| |||  ||| |||||||| 
Sbjct: 101475 gaacttcgagaagccaaacctgcaacaccacagccacctcaacggtctcctcttgatccc 101534

                                                    
Query: 443    tgggccaaatctcgtgctagccagcaatgggcgggacc 480
              |||||||| |||||||||||||| || |||||||||||
Sbjct: 101535 tgggccaagtctcgtgctagccaacagtgggcgggacc 101572



 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                         
Query: 29    gccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcgtgtccatgctcagg 88
             |||||||| ||||||||||||||||| ||||||||||| ||||| || ||||||||||||
Sbjct: 99416 gccatggggaagttccgcaagctcggccgccacgccgcccaccgagtatccatgctcagg 99475
to top
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05,
             complete sequence
          Length = 163130

 Score = 91.7 bits (46), Expect = 4e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                         
Query: 15    cccccgccgccgacgccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcg 74
             ||||| |||||| ||||||||| |||||||||||||| || ||||||||||| |||||||
Sbjct: 76686 ccccctccgccgccgccatggggaagttccgcaagctgggccgccacgccgcccaccgcg 76627

                           
Query: 75    tgtccatgctcagg 88
             | ||||||||||||
Sbjct: 76626 tctccatgctcagg 76613



 Score = 87.7 bits (44), Expect = 6e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                         
Query: 286   agatcgagcaggcggatatacaagacttttgcgaactaggatacgaataggtgatgctgc 345
             ||||||||| || ||||||||||||||  |||| |||||||||||  | || ||||||||
Sbjct: 75416 agatcgagctggtggatatacaagactactgcggactaggatacgggttggcgatgctgc 75357

                                 
Query: 346   accaatggcatacattgagt 365
             ||||||||||||||||||||
Sbjct: 75356 accaatggcatacattgagt 75337



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                        
Query: 85    caggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgccaagg 143
             |||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 76477 caggactatggtgtcgcagctggtgaagcatgagcggatcgagaccaccgtcgcgaagg 76419



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                 
Query: 141   aggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcggcaaaga 192
             |||||||||||||||||   || |||||||||||||||||||||||||||||
Sbjct: 76291 aggcgaaggaggtgcggacgaaagcggatcagatggtgcagctcggcaaaga 76240



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                         
Query: 364   gtttgttgacagagagaacgaactccgagaggccaaacctgcaacgccaccaccgcctca 423
             |||||| ||| | ||||| ||||| |||||||| ||||||||||| ||||  || |||||
Sbjct: 74855 gtttgtcgaccgggagaatgaacttcgagaggcaaaacctgcaacaccacagccacctca 74796

                                        
Query: 424   gcgggttccacttgatccatgggccaa 450
             |||||| || |||||||||||| ||||
Sbjct: 74795 gcgggtccctcttgatccatggaccaa 74769



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                         
Query: 194   ggtacactggatgcagcaagacgtgcttctgcttttgttcgtggagatgatgttgtccat 253
             ||||| || ||||||||||||||||| || || |||||||| || ||  ||||||| || 
Sbjct: 75636 ggtacgcttgatgcagcaagacgtgcctcagcctttgttcggggtgacaatgttgttcac 75577

                                          
Query: 254   aagctattcacagagctggcctaccgcta 282
             ||| |||||||||| || |||||||||||
Sbjct: 75576 aagttattcacagaactcgcctaccgcta 75548
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5
          Length = 29737217

 Score = 91.7 bits (46), Expect = 4e-15
 Identities = 67/74 (90%)
 Strand = Plus / Minus

                                                                            
Query: 15       cccccgccgccgacgccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcg 74
                ||||| |||||| ||||||||| |||||||||||||| || ||||||||||| |||||||
Sbjct: 22487279 ccccctccgccgccgccatggggaagttccgcaagctgggccgccacgccgcccaccgcg 22487220

                              
Query: 75       tgtccatgctcagg 88
                | ||||||||||||
Sbjct: 22487219 tctccatgctcagg 22487206



 Score = 87.7 bits (44), Expect = 6e-14
 Identities = 71/80 (88%)
 Strand = Plus / Minus

                                                                            
Query: 286      agatcgagcaggcggatatacaagacttttgcgaactaggatacgaataggtgatgctgc 345
                ||||||||| || ||||||||||||||  |||| |||||||||||  | || ||||||||
Sbjct: 22486009 agatcgagctggtggatatacaagactactgcggactaggatacgggttggcgatgctgc 22485950

                                    
Query: 346      accaatggcatacattgagt 365
                ||||||||||||||||||||
Sbjct: 22485949 accaatggcatacattgagt 22485930



 Score = 85.7 bits (43), Expect = 2e-13
 Identities = 55/59 (93%)
 Strand = Plus / Minus

                                                                           
Query: 85       caggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccgtcgccaagg 143
                |||||| ||||||||||||||||||||||| ||||| ||||||||||||||||| ||||
Sbjct: 22487070 caggactatggtgtcgcagctggtgaagcatgagcggatcgagaccaccgtcgcgaagg 22487012



 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 48/52 (92%)
 Strand = Plus / Minus

                                                                    
Query: 141      aggcgaaggaggtgcggcgcaaggcggatcagatggtgcagctcggcaaaga 192
                |||||||||||||||||   || |||||||||||||||||||||||||||||
Sbjct: 22486884 aggcgaaggaggtgcggacgaaagcggatcagatggtgcagctcggcaaaga 22486833



 Score = 69.9 bits (35), Expect = 1e-08
 Identities = 74/87 (85%)
 Strand = Plus / Minus

                                                                            
Query: 364      gtttgttgacagagagaacgaactccgagaggccaaacctgcaacgccaccaccgcctca 423
                |||||| ||| | ||||| ||||| |||||||| ||||||||||| ||||  || |||||
Sbjct: 22485448 gtttgtcgaccgggagaatgaacttcgagaggcaaaacctgcaacaccacagccacctca 22485389

                                           
Query: 424      gcgggttccacttgatccatgggccaa 450
                |||||| || |||||||||||| ||||
Sbjct: 22485388 gcgggtccctcttgatccatggaccaa 22485362



 Score = 65.9 bits (33), Expect = 2e-07
 Identities = 75/89 (84%)
 Strand = Plus / Minus

                                                                            
Query: 194      ggtacactggatgcagcaagacgtgcttctgcttttgttcgtggagatgatgttgtccat 253
                ||||| || ||||||||||||||||| || || |||||||| || ||  ||||||| || 
Sbjct: 22486229 ggtacgcttgatgcagcaagacgtgcctcagcctttgttcggggtgacaatgttgttcac 22486170

                                             
Query: 254      aagctattcacagagctggcctaccgcta 282
                ||| |||||||||| || |||||||||||
Sbjct: 22486169 aagttattcacagaactcgcctaccgcta 22486141
to top
>gb|AY022792.1| Oryza sativa microsatellite MRG5117 containing (CGC)X8, genomic
           sequence
          Length = 224

 Score = 79.8 bits (40), Expect = 1e-11
 Identities = 55/60 (91%)
 Strand = Plus / Plus

                                                                       
Query: 29  gccatgggcaagttccgcaagctcgggcgccacgccgcgcaccgcgtgtccatgctcagg 88
           |||||||| ||||||||||||||||| ||||||||||| ||||| || ||||||||||||
Sbjct: 146 gccatggggaagttccgcaagctcggccgccacgccgcccaccgagtatccatgctcagg 205
to top
>dbj|AK228114.1| Arabidopsis thaliana mRNA for ribsomal protein - like, complete
           cds, clone: RAFL14-59-G19
          Length = 738

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccg 134
           |||||||||| ||||| ||||| || ||| |||||||||||||||| || |||||||| |
Sbjct: 68  tgtccatgcttaggactatggtttctcagttggtgaagcacgagcgtattgagaccactg 127

                              
Query: 135 tcgccaaggcgaaggaggt 153
           || | ||||| || |||||
Sbjct: 128 tcactaaggctaaagaggt 146



 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aaagatcgagcaggcggatatacaagacttttgcgaactaggatacgaataggtgatgct 343
           |||||| |||| || ||||| ||||||||  | || ||| | |||||| | |||||||||
Sbjct: 277 aaagatagagctggtggatacacaagactgctacgtactcgcatacgagttggtgatgct 336

                                                    
Query: 344 gcaccaatggcatacattgagtttgttgacagagagaacga 384
           || || ||||| || || |||||| ||||||||||||||||
Sbjct: 337 gctcctatggcctatatcgagtttattgacagagagaacga 377
to top
>ref|NM_121014.2| Arabidopsis thaliana structural constituent of ribosome (AT5G09770)
           mRNA, complete cds
          Length = 728

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccg 134
           |||||||||| ||||| ||||| || ||| |||||||||||||||| || |||||||| |
Sbjct: 68  tgtccatgcttaggactatggtttctcagttggtgaagcacgagcgtattgagaccactg 127

                              
Query: 135 tcgccaaggcgaaggaggt 153
           || | ||||| || |||||
Sbjct: 128 tcactaaggctaaagaggt 146



 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aaagatcgagcaggcggatatacaagacttttgcgaactaggatacgaataggtgatgct 343
           |||||| |||| || ||||| ||||||||  | || ||| | |||||| | |||||||||
Sbjct: 277 aaagatagagctggtggatacacaagactgctacgtactcgcatacgagttggtgatgct 336

                                                    
Query: 344 gcaccaatggcatacattgagtttgttgacagagagaacga 384
           || || ||||| || || |||||| ||||||||||||||||
Sbjct: 337 gctcctatggcctatatcgagtttattgacagagagaacga 377
to top
>gb|AY086225.1| Arabidopsis thaliana clone 22697 mRNA, complete sequence
          Length = 725

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccg 134
           |||||||||| ||||| ||||| || ||| |||||||||||||||| || |||||||| |
Sbjct: 68  tgtccatgcttaggactatggtttctcagttggtgaagcacgagcgtattgagaccactg 127

                              
Query: 135 tcgccaaggcgaaggaggt 153
           || | ||||| || |||||
Sbjct: 128 tcactaaggctaaagaggt 146



 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aaagatcgagcaggcggatatacaagacttttgcgaactaggatacgaataggtgatgct 343
           |||||| |||| || ||||| ||||||||  | || ||| | |||||| | |||||||||
Sbjct: 277 aaagatagagctggtggatacacaagactgctacgtactcgcatacgagttggtgatgct 336

                                                    
Query: 344 gcaccaatggcatacattgagtttgttgacagagagaacga 384
           || || ||||| || || |||||| ||||||||||||||||
Sbjct: 337 gctcctatggcctatatcgagtttattgacagagagaacga 377
to top
>gb|BT003108.1| Arabidopsis thaliana At5g09770 mRNA, complete cds
          Length = 483

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccg 134
           |||||||||| ||||| ||||| || ||| |||||||||||||||| || |||||||| |
Sbjct: 44  tgtccatgcttaggactatggtttctcagttggtgaagcacgagcgtattgagaccactg 103

                              
Query: 135 tcgccaaggcgaaggaggt 153
           || | ||||| || |||||
Sbjct: 104 tcactaaggctaaagaggt 122



 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aaagatcgagcaggcggatatacaagacttttgcgaactaggatacgaataggtgatgct 343
           |||||| |||| || ||||| ||||||||  | || ||| | |||||| | |||||||||
Sbjct: 253 aaagatagagctggtggatacacaagactgctacgtactcgcatacgagttggtgatgct 312

                                                    
Query: 344 gcaccaatggcatacattgagtttgttgacagagagaacga 384
           || || ||||| || || |||||| ||||||||||||||||
Sbjct: 313 gctcctatggcctatatcgagtttattgacagagagaacga 353
to top
>emb|BX832882.1|CNS0A21B Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL19ZG09 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 636

 Score = 61.9 bits (31), Expect = 3e-06
 Identities = 67/79 (84%)
 Strand = Plus / Plus

                                                                       
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccaccg 134
           |||||||||| ||||| ||||| || ||| |||||||||||||||| || |||||||| |
Sbjct: 16  tgtccatgcttaggactatggtttctcagttggtgaagcacgagcgtattgagaccactg 75

                              
Query: 135 tcgccaaggcgaaggaggt 153
           || | ||||| || |||||
Sbjct: 76  tcactaaggctaaagaggt 94



 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aaagatcgagcaggcggatatacaagacttttgcgaactaggatacgaataggtgatgct 343
           |||||| |||| || ||||| ||||||||  | || ||| | |||||| | |||||||||
Sbjct: 225 aaagatagagctggtggatacacaagactgctacgtactcgcatacgagttggtgatgct 284

                                                    
Query: 344 gcaccaatggcatacattgagtttgttgacagagagaacga 384
           || || ||||| || || |||||| ||||||||||||||||
Sbjct: 285 gctcctatggcctatatcgagtttattgacagagagaacga 325
to top
>emb|BX832861.1|CNS0A22N Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL18ZB06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 707

 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccac 132
           |||||||||| ||||| ||||| || ||| |||||||||||||||| || ||||||||
Sbjct: 40  tgtccatgcttaggactatggtttctcagttggtgaagcacgagcgtattgagaccac 97



 Score = 58.0 bits (29), Expect = 5e-05
 Identities = 83/101 (82%)
 Strand = Plus / Plus

                                                                       
Query: 284 aaagatcgagcaggcggatatacaagacttttgcgaactaggatacgaataggtgatgct 343
           |||||| |||| || ||||| ||||||||  | || ||| | |||||| | |||||||||
Sbjct: 250 aaagatagagctggtggatacacaagactgctacgtactcgcatacgagttggtgatgct 309

                                                    
Query: 344 gcaccaatggcatacattgagtttgttgacagagagaacga 384
           || || ||||| || || |||||| ||||||||||||||||
Sbjct: 310 gctcctatggcctatatcgagtttattgacagagagaacga 350
to top
>gb|CP000238.1| Baumannia cicadellinicola str. Hc (Homalodisca coagulata), complete
              genome
          Length = 686194

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 343    tgcaccaatggcatacattgagtttgttga 372
              ||||||||||||||| ||||||||||||||
Sbjct: 364364 tgcaccaatggcatatattgagtttgttga 364393
to top
>gb|CP000057.1| Haemophilus influenzae strain 86-028NP, complete genome
          Length = 1913428

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 343    tgcaccaatggcatacattgagtttgttga 372
              |||||||||||||||||||||||| |||||
Sbjct: 917775 tgcaccaatggcatacattgagttagttga 917804
to top
>dbj|AB020752.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MTH16
          Length = 68098

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Minus

                                                               
Query: 83    ctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccac 132
             |||||||| ||||| || ||| |||||||||||||||| || ||||||||
Sbjct: 57243 ctcaggactatggtttctcagttggtgaagcacgagcgtattgagaccac 57194
to top
>gb|L42023.1| Haemophilus influenzae Rd KW20, complete genome
          Length = 1830138

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                            
Query: 343    tgcaccaatggcatacattgagtttgttga 372
              |||||||||||||||||||||||| |||||
Sbjct: 853429 tgcaccaatggcatacattgagttagttga 853458
to top
>emb|AL353994.1|ATF17I14 Arabidopsis thaliana DNA chromosome 5, BAC clone F17I14 (ESSA project)
          Length = 92491

 Score = 52.0 bits (26), Expect = 0.003
 Identities = 44/50 (88%)
 Strand = Plus / Plus

                                                               
Query: 83    ctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccac 132
             |||||||| ||||| || ||| |||||||||||||||| || ||||||||
Sbjct: 12341 ctcaggactatggtttctcagttggtgaagcacgagcgtattgagaccac 12390
to top
>emb|CT009568.8| M.truncatula DNA sequence from clone MTH2-95K22 on chromosome 3,
             complete sequence
          Length = 121926

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                            
Query: 335   ggtgatgctgcaccaatggcatacattgagt 365
             |||||||||||||||||||| || |||||||
Sbjct: 18928 ggtgatgctgcaccaatggcctatattgagt 18958
to top
>emb|BX061381.1|CNS09JIX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42AF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 104 ctggtgaagcacgagcgcatcga 126
           |||||||||||||||||||||||
Sbjct: 260 ctggtgaagcacgagcgcatcga 282
to top
>emb|BX060210.1|CNS09IME Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 824

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 104 ctggtgaagcacgagcgcatcga 126
           |||||||||||||||||||||||
Sbjct: 514 ctggtgaagcacgagcgcatcga 492
to top
>emb|BX060209.1|CNS09IMD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40CA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 604

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 104 ctggtgaagcacgagcgcatcga 126
           |||||||||||||||||||||||
Sbjct: 26  ctggtgaagcacgagcgcatcga 48
to top
>gb|AC143340.4| Medicago truncatula clone mth2-7f4, complete sequence
          Length = 114535

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                           
Query: 335  ggtgatgctgcaccaatggcatacattgagt 365
            |||||||||||||||||||| || |||||||
Sbjct: 1109 ggtgatgctgcaccaatggcctatattgagt 1079
to top
>emb|BX019804.1|CNS08NG0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 676

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 104 ctggtgaagcacgagcgcatcga 126
           |||||||||||||||||||||||
Sbjct: 576 ctggtgaagcacgagcgcatcga 554
to top
>emb|BX019803.1|CNS08NFZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 104 ctggtgaagcacgagcgcatcga 126
           |||||||||||||||||||||||
Sbjct: 215 ctggtgaagcacgagcgcatcga 237
to top
>ref|XM_321202.2| Anopheles gambiae str. PEST ENSANGP00000020872
           (ENSANGG00000018383), partial mRNA
          Length = 528

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 104 ctggtgaagcacgagcgcatcga 126
           |||||||||||||||||||||||
Sbjct: 130 ctggtgaagcacgagcgcatcga 152
to top
>emb|AL772303.11| Mouse DNA sequence from clone RP23-185P20 on chromosome 2, complete
              sequence
          Length = 202001

 Score = 46.1 bits (23), Expect = 0.19
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 558    tatccattttgtttgtgtaactc 580
              |||||||||||||||||||||||
Sbjct: 147643 tatccattttgtttgtgtaactc 147665
to top
>gb|CP000481.1| Acidothermus cellulolyticus 11B, complete genome
          Length = 2443540

 Score = 44.1 bits (22), Expect = 0.77
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 158    cgcaaggcggatcagatggtgc 179
              ||||||||||||||||||||||
Sbjct: 315365 cgcaaggcggatcagatggtgc 315386
to top
>gb|BT025732.1| Arabidopsis thaliana At5g64650 mRNA, complete cds
          Length = 483

 Score = 44.1 bits (22), Expect = 0.77
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccac 132
           |||||||||||||||| ||||| || ||  ||||| | |||||||| || ||||||||
Sbjct: 44  tgtccatgctcaggactatggtttctcaattggtgcaacacgagcgaattgagaccac 101



 Score = 44.1 bits (22), Expect = 0.77
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 335 ggtgatgctgcaccaatggcatacattgagtttgttgacagagagaacga 384
           ||||||||||| |||||||| || || |||||| | || |||||||||||
Sbjct: 304 ggtgatgctgccccaatggcctatatcgagtttatcgatagagagaacga 353
to top
>ref|NM_125861.2| Arabidopsis thaliana structural constituent of ribosome (AT5G64650)
           mRNA, complete cds
          Length = 699

 Score = 44.1 bits (22), Expect = 0.77
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccac 132
           |||||||||||||||| ||||| || ||  ||||| | |||||||| || ||||||||
Sbjct: 78  tgtccatgctcaggactatggtttctcaattggtgcaacacgagcgaattgagaccac 135



 Score = 44.1 bits (22), Expect = 0.77
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 335 ggtgatgctgcaccaatggcatacattgagtttgttgacagagagaacga 384
           ||||||||||| |||||||| || || |||||| | || |||||||||||
Sbjct: 338 ggtgatgctgccccaatggcctatatcgagtttatcgatagagagaacga 387
to top
>gb|AE006177.1| Pasteurella multocida subsp. multocida str. Pm70 section 144 of 204
           of the complete genome
          Length = 14087

 Score = 44.1 bits (22), Expect = 0.77
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 347 ccaatggcatacattgagtttgttga 372
           |||||||||||||||||||| |||||
Sbjct: 225 ccaatggcatacattgagttagttga 200
to top
>gb|AE005770.1| Caulobacter crescentus CB15 section 96 of 359 of the complete genome
          Length = 11274

 Score = 44.1 bits (22), Expect = 0.77
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 5     ggccgctcagcccccgccgccg 26
             ||||||||||||||||||||||
Sbjct: 10862 ggccgctcagcccccgccgccg 10883
to top
>emb|AL365220.24| Human DNA sequence from clone RP4-735N21 on chromosome 1p21.2-22.2
             Contains a novel pseudogene, complete sequence
          Length = 113028

 Score = 44.1 bits (22), Expect = 0.77
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 723   gtataatgaaatgtttgaagaa 744
             ||||||||||||||||||||||
Sbjct: 69653 gtataatgaaatgtttgaagaa 69674
to top
>gb|AY086818.1| Arabidopsis thaliana clone 2806 mRNA, complete sequence
          Length = 677

 Score = 44.1 bits (22), Expect = 0.77
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccac 132
           |||||||||||||||| ||||| || ||  ||||| | |||||||| || ||||||||
Sbjct: 78  tgtccatgctcaggactatggtttctcaattggtgcaacacgagcgaattgagaccac 135



 Score = 44.1 bits (22), Expect = 0.77
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 335 ggtgatgctgcaccaatggcatacattgagtttgttgacagagagaacga 384
           ||||||||||| |||||||| || || |||||| | || |||||||||||
Sbjct: 338 ggtgatgctgccccaatggcctatatcgagtttatcgatagagagaacga 387
to top
>dbj|AK118268.1| Arabidopsis thaliana At5g64650 mRNA for putative 50S ribosomal
           protein L17, complete cds, clone: RAFL19-56-H21
          Length = 653

 Score = 44.1 bits (22), Expect = 0.77
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 75  tgtccatgctcaggacgatggtgtcgcagctggtgaagcacgagcgcatcgagaccac 132
           |||||||||||||||| ||||| || ||  ||||| | |||||||| || ||||||||
Sbjct: 32  tgtccatgctcaggactatggtttctcaattggtgcaacacgagcgaattgagaccac 89



 Score = 44.1 bits (22), Expect = 0.77
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                             
Query: 335 ggtgatgctgcaccaatggcatacattgagtttgttgacagagagaacga 384
           ||||||||||| |||||||| || || |||||| | || |||||||||||
Sbjct: 292 ggtgatgctgccccaatggcctatatcgagtttatcgatagagagaacga 341
to top
>emb|AM260479.1| Ralstonia eutropha H16 chromosome 1
          Length = 4052032

 Score = 42.1 bits (21), Expect = 3.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 50     ctcgggcgccacgccgcgcaccgcg 74
              |||||||| ||||||||||||||||
Sbjct: 489076 ctcgggcggcacgccgcgcaccgcg 489052
to top
>emb|CR848708.12| Wallaby DNA sequence from clone MEKBa-201B9, complete sequence
          Length = 194524

 Score = 42.1 bits (21), Expect = 3.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 12     cagcccccgccgccgacgccatggg 36
              ||||||||||||||| |||||||||
Sbjct: 107933 cagcccccgccgccgccgccatggg 107957
to top
>gb|AC019235.6| Homo sapiens BAC clone RP11-665C14 from 4, complete sequence
          Length = 196680

 Score = 42.1 bits (21), Expect = 3.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 725  ataatgaaatgtttgaagaat 745
            |||||||||||||||||||||
Sbjct: 4415 ataatgaaatgtttgaagaat 4435
to top
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 42.1 bits (21), Expect = 3.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 11      tcagcccccgccgccgacgcc 31
               |||||||||||||||||||||
Sbjct: 3431548 tcagcccccgccgccgacgcc 3431528
to top
>gb|AC093326.3| Homo sapiens BAC clone RP11-625N16 from 2, complete sequence
          Length = 188711

 Score = 42.1 bits (21), Expect = 3.0
 Identities = 28/29 (96%), Gaps = 1/29 (3%)
 Strand = Plus / Minus

                                           
Query: 239    gatgatgttgtccata-agctattcacag 266
              |||||||||||||||| ||||||||||||
Sbjct: 106419 gatgatgttgtccatagagctattcacag 106391
to top
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 42.1 bits (21), Expect = 3.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                                
Query: 2       gccggccgctcagcccccgccgccgacgccatg 34
               |||||| |||| || ||||||||||||||||||
Sbjct: 2891621 gccggcggctcggcacccgccgccgacgccatg 2891653


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 125,940,692
Number of extensions: 6504780
Number of successful extensions: 131771
Number of sequences better than 10.0: 46
Number of HSP's gapped: 131768
Number of HSP's successfully gapped: 83
Length of query: 808
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 786
Effective length of database: 18,508,616,841
Effective search space: 14547772837026
Effective search space used: 14547772837026
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top