Clone Name	FLbaf96k01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D...	50	0.013
2	gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete se...	46	0.20
3	gb|CP000264.1| Jannaschia sp. CCS1, complete genome	46	0.20
4	gb|AC153148.4| Mus musculus BAC clone RP23-189N11 from chromosom...	44	0.79
5	gb|AC163398.5| Mus musculus chromosome 18, clone RP24-376O5, com...	44	0.79
6	gb|AC140437.3| Mus musculus BAC clone RP23-88N2 from chromosome ...	44	0.79
7	gb|AC115629.3| Mus musculus BAC clone RP23-74J16 from chromosome...	44	0.79
8	gb|AC122264.3| Mus musculus BAC clone RP23-197G20 from chromosom...	44	0.79
9	gb|AC113969.7| Mus musculus chromosome 8, clone RP23-122L19, com...	44	0.79
10	gb|AC165163.2| Mus musculus BAC clone RP23-146B12 from chromosom...	44	0.79
11	gb|AC154904.4| Mus musculus BAC clone RP23-416C3 from chromosome...	44	0.79
12	gb|AC155812.2| Mus musculus BAC clone RP24-139G23 from 12, compl...	44	0.79
13	emb|CT571268.7| Mouse DNA sequence from clone RP23-275M21 on chr...	44	0.79
14	gb|CP000468.1| Escherichia coli APEC O1, complete genome	42	3.1
15	gb|AC188467.2| Taeniopygia guttata BAC clone TGMCBa-28H12 from c...	42	3.1
16	gb|DQ260227.1| Picea glauca genotype 81115 homeobox transcriptio...	42	3.1
17	gb|DQ260226.1| Picea glauca genotype 81115 homeobox transcriptio...	42	3.1
18	gb|DQ260225.1| Picea glauca genotype 81114 homeobox transcriptio...	42	3.1
19	gb|DQ260224.1| Picea glauca genotype 81114 homeobox transcriptio...	42	3.1
20	gb|DQ260223.1| Picea glauca genotype 81111 homeobox transcriptio...	42	3.1
21	gb|DQ260222.1| Picea glauca genotype 81111 homeobox transcriptio...	42	3.1
22	gb|DQ260221.1| Picea glauca genotype 81110 homeobox transcriptio...	42	3.1
23	gb|DQ260220.1| Picea glauca genotype 81110 homeobox transcriptio...	42	3.1
24	gb|DQ260219.1| Picea glauca genotype 81109 homeobox transcriptio...	42	3.1
25	gb|DQ260218.1| Picea glauca genotype 81109 homeobox transcriptio...	42	3.1
26	gb|DQ260217.1| Picea glauca genotype 81107 homeobox transcriptio...	42	3.1
27	gb|DQ260216.1| Picea glauca genotype 81107 homeobox transcriptio...	42	3.1
28	gb|DQ260215.1| Picea glauca genotype 81103 homeobox transcriptio...	42	3.1
29	gb|DQ260214.1| Picea glauca genotype 81103 homeobox transcriptio...	42	3.1
30	gb|DQ260213.1| Picea glauca genotype 81102 homeobox transcriptio...	42	3.1
31	gb|DQ260212.1| Picea glauca genotype 81102 homeobox transcriptio...	42	3.1
32	gb|DQ260211.1| Picea glauca genotype 81101 homeobox transcriptio...	42	3.1
33	gb|DQ260210.1| Picea glauca genotype 81101 homeobox transcriptio...	42	3.1
34	gb|DQ260209.1| Picea glauca genotype 80139 homeobox transcriptio...	42	3.1
35	gb|DQ260208.1| Picea glauca genotype 80139 homeobox transcriptio...	42	3.1
36	gb|DQ260207.1| Picea glauca genotype 80135 homeobox transcriptio...	42	3.1
37	gb|DQ260206.1| Picea glauca genotype 80135 homeobox transcriptio...	42	3.1
38	gb|DQ260205.1| Picea glauca genotype 80133 homeobox transcriptio...	42	3.1
39	gb|DQ260204.1| Picea glauca genotype 80133 homeobox transcriptio...	42	3.1
40	gb|DQ260203.1| Picea glauca genotype 80131 homeobox transcriptio...	42	3.1
41	gb|DQ260202.1| Picea glauca genotype 80131 homeobox transcriptio...	42	3.1
42	gb|DQ260201.1| Picea glauca genotype 80128 homeobox transcriptio...	42	3.1
43	gb|DQ260200.1| Picea glauca genotype 80128 homeobox transcriptio...	42	3.1
44	gb|DQ260199.1| Picea glauca genotype 80120 homeobox transcriptio...	42	3.1
45	gb|DQ260198.1| Picea glauca genotype 80120 homeobox transcriptio...	42	3.1
46	gb|DQ260197.1| Picea glauca genotype 80118 homeobox transcriptio...	42	3.1
47	gb|DQ260196.1| Picea glauca genotype 80118 homeobox transcriptio...	42	3.1
48	gb|DQ260195.1| Picea glauca genotype 80117 homeobox transcriptio...	42	3.1
49	gb|DQ260194.1| Picea glauca genotype 80117 homeobox transcriptio...	42	3.1
50	gb|DQ260193.1| Picea glauca genotype 80114 homeobox transcriptio...	42	3.1
51	gb|DQ260192.1| Picea glauca genotype 80114 homeobox transcriptio...	42	3.1
52	gb|DQ260191.1| Picea glauca genotype 80110 homeobox transcriptio...	42	3.1
53	gb|DQ260190.1| Picea glauca genotype 80110 homeobox transcriptio...	42	3.1
54	gb|DQ260189.1| Picea glauca genotype 80102 homeobox transcriptio...	42	3.1
55	gb|DQ260188.1| Picea glauca genotype 80102 homeobox transcriptio...	42	3.1
56	gb|DQ260187.1| Picea glauca genotype 80101 homeobox transcriptio...	42	3.1
57	gb|DQ260186.1| Picea glauca genotype 80101 homeobox transcriptio...	42	3.1
58	gb|DQ260185.1| Picea glauca genotype 79108 homeobox transcriptio...	42	3.1
59	gb|DQ260184.1| Picea glauca genotype 79108 homeobox transcriptio...	42	3.1
60	gb|DQ260183.1| Picea glauca genotype 79106 homeobox transcriptio...	42	3.1
61	gb|DQ260182.1| Picea glauca genotype 79106 homeobox transcriptio...	42	3.1
62	gb|DQ260181.1| Picea glauca genotype 79105 homeobox transcriptio...	42	3.1
63	gb|DQ260180.1| Picea glauca genotype 79105 homeobox transcriptio...	42	3.1
64	gb|DQ260179.1| Picea glauca genotype 79101 homeobox transcriptio...	42	3.1
65	gb|DQ260178.1| Picea glauca genotype 79101 homeobox transcriptio...	42	3.1
66	gb|DQ260177.1| Picea glauca genotype 78107 homeobox transcriptio...	42	3.1
67	gb|DQ260176.1| Picea glauca genotype 78107 homeobox transcriptio...	42	3.1
68	gb|DQ260175.1| Picea glauca genotype 78102 homeobox transcriptio...	42	3.1
69	gb|DQ260174.1| Picea glauca genotype 78102 homeobox transcriptio...	42	3.1
70	gb|DQ260173.1| Picea glauca genotype 77133 homeobox transcriptio...	42	3.1
71	gb|DQ260172.1| Picea glauca genotype 77133 homeobox transcriptio...	42	3.1
72	gb|DQ260171.1| Picea glauca genotype 77114 homeobox transcriptio...	42	3.1
73	gb|DQ260170.1| Picea glauca genotype 77114 homeobox transcriptio...	42	3.1
74	gb|DQ260169.1| Picea glauca genotype 77106 homeobox transcriptio...	42	3.1
75	gb|DQ260168.1| Picea glauca genotype 77106 homeobox transcriptio...	42	3.1
76	gb|DQ260167.1| Picea glauca genotype 77102 homeobox transcriptio...	42	3.1
77	gb|DQ260166.1| Picea glauca genotype 77102 homeobox transcriptio...	42	3.1
78	gb|DQ260165.1| Picea glauca genotype 2397 homeobox transcription...	42	3.1
79	gb|DQ260164.1| Picea glauca genotype 2397 homeobox transcription...	42	3.1
80	gb|DQ260163.1| Picea glauca genotype 2385 homeobox transcription...	42	3.1
81	gb|DQ260162.1| Picea glauca genotype 2385 homeobox transcription...	42	3.1
82	gb|DQ260161.1| Picea glauca genotype 2379 homeobox transcription...	42	3.1
83	gb|DQ260160.1| Picea glauca genotype 2379 homeobox transcription...	42	3.1
84	gb|DQ260159.1| Picea glauca genotype 2312 homeobox transcription...	42	3.1
85	gb|DQ260158.1| Picea glauca genotype 2312 homeobox transcription...	42	3.1
86	gb|DQ260157.1| Picea glauca genotype 653 homeobox transcription ...	42	3.1
87	gb|DQ260156.1| Picea glauca genotype 653 homeobox transcription ...	42	3.1
88	gb|DQ260155.1| Picea glauca genotype 93125 homeobox transcriptio...	42	3.1
89	gb|DQ260154.1| Picea glauca genotype 93125 homeobox transcriptio...	42	3.1
90	gb|DQ260153.1| Picea glauca genotype 93124 homeobox transcriptio...	42	3.1
91	gb|DQ260152.1| Picea glauca genotype 93124 homeobox transcriptio...	42	3.1
92	gb|DQ260151.1| Picea glauca genotype 93122 homeobox transcriptio...	42	3.1
93	gb|DQ260150.1| Picea glauca genotype 93122 homeobox transcriptio...	42	3.1
94	gb|DQ260149.1| Picea glauca genotype 93121 homeobox transcriptio...	42	3.1
95	gb|DQ260148.1| Picea glauca genotype 93121 homeobox transcriptio...	42	3.1
96	gb|DQ260147.1| Picea glauca genotype 93118 homeobox transcriptio...	42	3.1
97	gb|DQ260146.1| Picea glauca genotype 93118 homeobox transcriptio...	42	3.1
98	gb|DQ260145.1| Picea glauca genotype 93116 homeobox transcriptio...	42	3.1
99	gb|DQ260144.1| Picea glauca genotype 93116 homeobox transcriptio...	42	3.1
100	gb|DQ260143.1| Picea glauca genotype 821118 homeobox transcripti...	42	3.1
101	gb|DQ260142.1| Picea glauca genotype 821118 homeobox transcripti...	42	3.1
102	gb|DQ260141.1| Picea glauca genotype 821099 homeobox transcripti...	42	3.1
103	gb|DQ260140.1| Picea glauca genotype 821099 homeobox transcripti...	42	3.1
104	gb|DQ260139.1| Picea glauca genotype 821095 homeobox transcripti...	42	3.1
105	gb|DQ260138.1| Picea glauca genotype 821095 homeobox transcripti...	42	3.1
106	gb|DQ260137.1| Picea glauca genotype 821084 homeobox transcripti...	42	3.1
107	gb|DQ260136.1| Picea glauca genotype 821084 homeobox transcripti...	42	3.1
108	gb|DQ260135.1| Picea glauca genotype 821025 homeobox transcripti...	42	3.1
109	gb|DQ260134.1| Picea glauca genotype 821025 homeobox transcripti...	42	3.1
110	gb|DQ260133.1| Picea glauca genotype 821019 homeobox transcripti...	42	3.1
111	gb|DQ260132.1| Picea glauca genotype 821019 homeobox transcripti...	42	3.1
112	gb|DQ260131.1| Picea glauca genotype 81113 homeobox transcriptio...	42	3.1
113	gb|DQ260130.1| Picea glauca genotype 81113 homeobox transcriptio...	42	3.1
114	gb|DQ260129.1| Picea glauca genotype 81106 homeobox transcriptio...	42	3.1
115	gb|DQ260128.1| Picea glauca genotype 81106 homeobox transcriptio...	42	3.1
116	gb|DQ260127.1| Picea glauca genotype 81104 homeobox transcriptio...	42	3.1
117	gb|DQ260126.1| Picea glauca genotype 81104 homeobox transcriptio...	42	3.1
118	gb|DQ260125.1| Picea glauca genotype 80140 homeobox transcriptio...	42	3.1
119	gb|DQ260124.1| Picea glauca genotype 80140 homeobox transcriptio...	42	3.1
120	gb|DQ260123.1| Picea glauca genotype 80138 homeobox transcriptio...	42	3.1
121	gb|DQ260122.1| Picea glauca genotype 80138 homeobox transcriptio...	42	3.1
122	gb|DQ260121.1| Picea glauca genotype 80137 homeobox transcriptio...	42	3.1
123	gb|DQ260120.1| Picea glauca genotype 80137 homeobox transcriptio...	42	3.1
124	gb|DQ260119.1| Picea glauca genotype 80136 homeobox transcriptio...	42	3.1
125	gb|DQ260118.1| Picea glauca genotype 80136 homeobox transcriptio...	42	3.1
126	gb|DQ260117.1| Picea glauca genotype 80134 homeobox transcriptio...	42	3.1
127	gb|DQ260116.1| Picea glauca genotype 80134 homeobox transcriptio...	42	3.1
128	gb|DQ260115.1| Picea glauca genotype 80132 homeobox transcriptio...	42	3.1
129	gb|DQ260114.1| Picea glauca genotype 80132 homeobox transcriptio...	42	3.1
130	gb|DQ260113.1| Picea glauca genotype 80130 homeobox transcriptio...	42	3.1
131	gb|DQ260112.1| Picea glauca genotype 80130 homeobox transcriptio...	42	3.1
132	gb|DQ260111.1| Picea glauca genotype 80129 homeobox transcriptio...	42	3.1
133	gb|DQ260110.1| Picea glauca genotype 80129 homeobox transcriptio...	42	3.1
134	gb|DQ260109.1| Picea glauca genotype 80127 homeobox transcriptio...	42	3.1
135	gb|DQ260108.1| Picea glauca genotype 80127 homeobox transcriptio...	42	3.1
136	gb|DQ260107.1| Picea glauca genotype 80126 homeobox transcriptio...	42	3.1
137	gb|DQ260106.1| Picea glauca genotype 80126 homeobox transcriptio...	42	3.1
138	gb|DQ260105.1| Picea glauca genotype 80125 homeobox transcriptio...	42	3.1
139	gb|DQ260104.1| Picea glauca genotype 80125 homeobox transcriptio...	42	3.1
140	gb|DQ260103.1| Picea glauca genotype 80124 homeobox transcriptio...	42	3.1
141	gb|DQ260102.1| Picea glauca genotype 80124 homeobox transcriptio...	42	3.1
142	gb|DQ260101.1| Picea glauca genotype 80123 homeobox transcriptio...	42	3.1
143	gb|DQ260100.1| Picea glauca genotype 80123 homeobox transcriptio...	42	3.1
144	gb|DQ260099.1| Picea glauca genotype 80122 homeobox transcriptio...	42	3.1
145	gb|DQ260098.1| Picea glauca genotype 80122 homeobox transcriptio...	42	3.1
146	gb|DQ260097.1| Picea glauca genotype 80121 homeobox transcriptio...	42	3.1
147	gb|DQ260096.1| Picea glauca genotype 80121 homeobox transcriptio...	42	3.1
148	gb|DQ260095.1| Picea glauca genotype 80119 homeobox transcriptio...	42	3.1
149	gb|DQ260094.1| Picea glauca genotype 80119 homeobox transcriptio...	42	3.1
150	gb|DQ260093.1| Picea glauca genotype 80116 homeobox transcriptio...	42	3.1
151	gb|DQ260092.1| Picea glauca genotype 80116 homeobox transcriptio...	42	3.1
152	gb|DQ260091.1| Picea glauca genotype 80113 homeobox transcriptio...	42	3.1
153	gb|DQ260090.1| Picea glauca genotype 80113 homeobox transcriptio...	42	3.1
154	gb|DQ260089.1| Picea glauca genotype 80112 homeobox transcriptio...	42	3.1
155	gb|DQ260088.1| Picea glauca genotype 80112 homeobox transcriptio...	42	3.1
156	gb|DQ260087.1| Picea glauca genotype 80109 homeobox transcriptio...	42	3.1
157	gb|DQ260086.1| Picea glauca genotype 80109 homeobox transcriptio...	42	3.1
158	gb|DQ260085.1| Picea glauca genotype 80108 homeobox transcriptio...	42	3.1
159	gb|DQ260084.1| Picea glauca genotype 80108 homeobox transcriptio...	42	3.1
160	gb|DQ260083.1| Picea glauca genotype 80107 homeobox transcriptio...	42	3.1
161	gb|DQ260082.1| Picea glauca genotype 80107 homeobox transcriptio...	42	3.1
162	gb|DQ260081.1| Picea glauca genotype 80106 homeobox transcriptio...	42	3.1
163	gb|DQ260080.1| Picea glauca genotype 80106 homeobox transcriptio...	42	3.1
164	gb|DQ260079.1| Picea glauca genotype 80105 homeobox transcriptio...	42	3.1
165	gb|DQ260078.1| Picea glauca genotype 80105 homeobox transcriptio...	42	3.1
166	gb|DQ260077.1| Picea glauca genotype 80104 homeobox transcriptio...	42	3.1
167	gb|DQ260076.1| Picea glauca genotype 80104 homeobox transcriptio...	42	3.1
168	gb|DQ260075.1| Picea glauca genotype 80103 homeobox transcriptio...	42	3.1
169	gb|DQ260074.1| Picea glauca genotype 80103 homeobox transcriptio...	42	3.1
170	gb|DQ260073.1| Picea glauca genotype 79109 homeobox transcriptio...	42	3.1
171	gb|DQ260072.1| Picea glauca genotype 79109 homeobox transcriptio...	42	3.1
172	gb|DQ260071.1| Picea glauca genotype 79107 homeobox transcriptio...	42	3.1
173	gb|DQ260070.1| Picea glauca genotype 79107 homeobox transcriptio...	42	3.1
174	gb|DQ260069.1| Picea glauca genotype 79104 homeobox transcriptio...	42	3.1
175	gb|DQ260068.1| Picea glauca genotype 79104 homeobox transcriptio...	42	3.1
176	gb|DQ260067.1| Picea glauca genotype 79102 homeobox transcriptio...	42	3.1
177	gb|DQ260066.1| Picea glauca genotype 79102 homeobox transcriptio...	42	3.1
178	gb|DQ260065.1| Picea glauca genotype 77115 homeobox transcriptio...	42	3.1
179	gb|DQ260064.1| Picea glauca genotype 77115 homeobox transcriptio...	42	3.1
180	gb|DQ260063.1| Picea glauca genotype 77113 homeobox transcriptio...	42	3.1
181	gb|DQ260062.1| Picea glauca genotype 77113 homeobox transcriptio...	42	3.1
182	gb|DQ260061.1| Picea glauca genotype 77111 homeobox transcriptio...	42	3.1
183	gb|DQ260060.1| Picea glauca genotype 77111 homeobox transcriptio...	42	3.1
184	gb|DQ260059.1| Picea glauca genotype 77109 homeobox transcriptio...	42	3.1
185	gb|DQ260058.1| Picea glauca genotype 77109 homeobox transcriptio...	42	3.1
186	gb|DQ260057.1| Picea glauca genotype 77108 homeobox transcriptio...	42	3.1
187	gb|DQ260056.1| Picea glauca genotype 77108 homeobox transcriptio...	42	3.1
188	gb|DQ260055.1| Picea glauca genotype 77107 homeobox transcriptio...	42	3.1
189	gb|DQ260054.1| Picea glauca genotype 77107 homeobox transcriptio...	42	3.1
190	gb|DQ260053.1| Picea glauca genotype 77105 homeobox transcriptio...	42	3.1
191	gb|DQ260052.1| Picea glauca genotype 77105 homeobox transcriptio...	42	3.1
192	gb|DQ260051.1| Picea glauca genotype 77104 homeobox transcriptio...	42	3.1
193	gb|DQ260050.1| Picea glauca genotype 77104 homeobox transcriptio...	42	3.1
194	gb|DQ260049.1| Picea glauca genotype 77101 homeobox transcriptio...	42	3.1
195	gb|DQ260048.1| Picea glauca genotype 77101 homeobox transcriptio...	42	3.1
196	gb|DQ260047.1| Picea glauca genotype 243856 homeobox transcripti...	42	3.1
197	gb|DQ260046.1| Picea glauca genotype 243856 homeobox transcripti...	42	3.1
198	gb|DQ260045.1| Picea glauca genotype 2393 homeobox transcription...	42	3.1
199	gb|DQ260044.1| Picea glauca genotype 2393 homeobox transcription...	42	3.1
200	gb|DQ260043.1| Picea glauca genotype 2388 homeobox transcription...	42	3.1
201	gb|DQ260042.1| Picea glauca genotype 2388 homeobox transcription...	42	3.1
202	gb|DQ260041.1| Picea glauca genotype 2380 homeobox transcription...	42	3.1
203	gb|DQ260040.1| Picea glauca genotype 2380 homeobox transcription...	42	3.1
204	gb|DQ260039.1| Picea glauca genotype 2327 homeobox transcription...	42	3.1
205	gb|DQ260038.1| Picea glauca genotype 2327 homeobox transcription...	42	3.1
206	gb|DQ260037.1| Picea glauca genotype 2313 homeobox transcription...	42	3.1
207	gb|DQ260036.1| Picea glauca genotype 2313 homeobox transcription...	42	3.1
208	gb|DQ258571.1| Picea mariana genotype 6994 homeobox transcriptio...	42	3.1
209	gb|DQ258570.1| Picea mariana genotype 6994 homeobox transcriptio...	42	3.1
210	gb|DQ258569.1| Picea mariana genotype 6986 homeobox transcriptio...	42	3.1
211	gb|DQ258568.1| Picea mariana genotype 6986 homeobox transcriptio...	42	3.1
212	gb|DQ258567.1| Picea mariana genotype 6979 homeobox transcriptio...	42	3.1
213	gb|DQ258566.1| Picea mariana genotype 6979 homeobox transcriptio...	42	3.1
214	gb|DQ258565.1| Picea mariana genotype 6976 homeobox transcriptio...	42	3.1
215	gb|DQ258564.1| Picea mariana genotype 6976 homeobox transcriptio...	42	3.1
216	gb|DQ258562.1| Picea mariana genotype 6970 homeobox transcriptio...	42	3.1
217	gb|DQ258561.1| Picea mariana genotype 6965 homeobox transcriptio...	42	3.1
218	gb|DQ258560.1| Picea mariana genotype 6965 homeobox transcriptio...	42	3.1
219	gb|DQ258559.1| Picea mariana genotype 6927 homeobox transcriptio...	42	3.1
220	gb|DQ258558.1| Picea mariana genotype 6927 homeobox transcriptio...	42	3.1
221	gb|DQ258557.1| Picea mariana genotype 6909 homeobox transcriptio...	42	3.1
222	gb|DQ258556.1| Picea mariana genotype 6909 homeobox transcriptio...	42	3.1
223	gb|DQ258555.1| Picea mariana genotype 6902 homeobox transcriptio...	42	3.1
224	gb|DQ258554.1| Picea mariana genotype 6902 homeobox transcriptio...	42	3.1
225	gb|DQ258553.1| Picea mariana genotype 6805 homeobox transcriptio...	42	3.1
226	gb|DQ258552.1| Picea mariana genotype 6805 homeobox transcriptio...	42	3.1
227	gb|DQ258551.1| Picea mariana genotype 6804 homeobox transcriptio...	42	3.1
228	gb|DQ258550.1| Picea mariana genotype 6804 homeobox transcriptio...	42	3.1
229	gb|DQ258549.1| Picea mariana genotype 6801 homeobox transcriptio...	42	3.1
230	gb|DQ258548.1| Picea mariana genotype 6801 homeobox transcriptio...	42	3.1
231	gb|DQ258547.1| Picea mariana genotype 4729 homeobox transcriptio...	42	3.1
232	gb|DQ258546.1| Picea mariana genotype 4729 homeobox transcriptio...	42	3.1
233	gb|DQ258545.1| Picea mariana genotype 4354 homeobox transcriptio...	42	3.1
234	gb|DQ258544.1| Picea mariana genotype 4354 homeobox transcriptio...	42	3.1
235	gb|DQ258543.1| Picea mariana genotype 4351 homeobox transcriptio...	42	3.1
236	gb|DQ258542.1| Picea mariana genotype 4351 homeobox transcriptio...	42	3.1
237	gb|DQ258541.1| Picea mariana genotype 3268 homeobox transcriptio...	42	3.1
238	gb|DQ258540.1| Picea mariana genotype 3268 homeobox transcriptio...	42	3.1
239	gb|DQ258539.1| Picea mariana genotype 1847 homeobox transcriptio...	42	3.1
240	gb|DQ258538.1| Picea mariana genotype 1847 homeobox transcriptio...	42	3.1
241	gb|DQ258537.1| Picea mariana genotype 1530 homeobox transcriptio...	42	3.1
242	gb|DQ258536.1| Picea mariana genotype 1530 homeobox transcriptio...	42	3.1
243	gb|DQ258535.1| Picea mariana genotype 1529 homeobox transcriptio...	42	3.1
244	gb|DQ258534.1| Picea mariana genotype 1529 homeobox transcriptio...	42	3.1
245	gb|DQ258533.1| Picea mariana genotype 360 homeobox transcription...	42	3.1
246	gb|DQ258532.1| Picea mariana genotype 360 homeobox transcription...	42	3.1
247	gb|DQ258531.1| Picea mariana genotype 355 homeobox transcription...	42	3.1
248	gb|DQ258530.1| Picea mariana genotype 355 homeobox transcription...	42	3.1
249	gb|DQ258529.1| Picea mariana genotype 326 homeobox transcription...	42	3.1
250	gb|DQ258528.1| Picea mariana genotype 326 homeobox transcription...	42	3.1
251	gb|DQ258527.1| Picea mariana genotype 325 homeobox transcription...	42	3.1
252	gb|DQ258526.1| Picea mariana genotype 325 homeobox transcription...	42	3.1
253	gb|DQ258525.1| Picea mariana genotype 425 homeobox transcription...	42	3.1
254	gb|DQ258524.1| Picea mariana genotype 425 homeobox transcription...	42	3.1
255	gb|DQ258523.1| Picea mariana genotype 422 homeobox transcription...	42	3.1
256	gb|DQ258522.1| Picea mariana genotype 422 homeobox transcription...	42	3.1
257	gb|DQ258521.1| Picea mariana genotype 11307 homeobox transcripti...	42	3.1
258	gb|DQ258520.1| Picea mariana genotype 11307 homeobox transcripti...	42	3.1
259	gb|DQ258057.1| Picea abies genotype 5460 homeobox transcription ...	42	3.1
260	gb|DQ258056.1| Picea abies genotype 5460 homeobox transcription ...	42	3.1
261	gb|DQ258055.1| Picea abies genotype 5434 homeobox transcription ...	42	3.1
262	gb|DQ258054.1| Picea abies genotype 5434 homeobox transcription ...	42	3.1
263	gb|DQ258053.1| Picea abies genotype 5433 homeobox transcription ...	42	3.1
264	gb|DQ258052.1| Picea abies genotype 5433 homeobox transcription ...	42	3.1
265	gb|DQ258051.1| Picea abies genotype 5431 homeobox transcription ...	42	3.1
266	gb|DQ258050.1| Picea abies genotype 5431 homeobox transcription ...	42	3.1
267	gb|DQ258049.1| Picea abies genotype 5428 homeobox transcription ...	42	3.1
268	gb|DQ258048.1| Picea abies genotype 5428 homeobox transcription ...	42	3.1
269	gb|DQ258047.1| Picea abies genotype 5426 homeobox transcription ...	42	3.1
270	gb|DQ258046.1| Picea abies genotype 5426 homeobox transcription ...	42	3.1
271	gb|DQ258045.1| Picea abies genotype 5418 homeobox transcription ...	42	3.1
272	gb|DQ258044.1| Picea abies genotype 5418 homeobox transcription ...	42	3.1
273	gb|DQ258043.1| Picea abies genotype 5416 homeobox transcription ...	42	3.1
274	gb|DQ258042.1| Picea abies genotype 5416 homeobox transcription ...	42	3.1
275	gb|DQ258041.1| Picea abies genotype 5414 homeobox transcription ...	42	3.1
276	gb|DQ258040.1| Picea abies genotype 5414 homeobox transcription ...	42	3.1
277	gb|DQ258039.1| Picea abies genotype 5411 homeobox transcription ...	42	3.1
278	gb|DQ258038.1| Picea abies genotype 5411 homeobox transcription ...	42	3.1
279	gb|DQ258037.1| Picea abies genotype 5409 homeobox transcription ...	42	3.1
280	gb|DQ258036.1| Picea abies genotype 5409 homeobox transcription ...	42	3.1
281	gb|DQ258035.1| Picea abies genotype 5407 homeobox transcription ...	42	3.1
282	gb|DQ258034.1| Picea abies genotype 5407 homeobox transcription ...	42	3.1
283	gb|DQ258033.1| Picea abies genotype 5406 homeobox transcription ...	42	3.1
284	gb|DQ258032.1| Picea abies genotype 5406 homeobox transcription ...	42	3.1
285	gb|DQ258031.1| Picea abies genotype 5404 homeobox transcription ...	42	3.1
286	gb|DQ258030.1| Picea abies genotype 5404 homeobox transcription ...	42	3.1
287	gb|DQ258029.1| Picea abies genotype 5403 homeobox transcription ...	42	3.1
288	gb|DQ258028.1| Picea abies genotype 5403 homeobox transcription ...	42	3.1
289	gb|DQ258027.1| Picea abies genotype 5400 homeobox transcription ...	42	3.1
290	gb|DQ258026.1| Picea abies genotype 5400 homeobox transcription ...	42	3.1
291	gb|DQ258025.1| Picea abies genotype 5399 homeobox transcription ...	42	3.1
292	gb|DQ258024.1| Picea abies genotype 5399 homeobox transcription ...	42	3.1
293	gb|DQ258023.1| Picea abies genotype 5398 homeobox transcription ...	42	3.1
294	gb|DQ258022.1| Picea abies genotype 5398 homeobox transcription ...	42	3.1
295	gb|DQ258021.1| Picea abies genotype 5397 homeobox transcription ...	42	3.1
296	gb|DQ258020.1| Picea abies genotype 5397 homeobox transcription ...	42	3.1
297	gb|DQ258019.1| Picea abies genotype 5394 homeobox transcription ...	42	3.1
298	gb|DQ258018.1| Picea abies genotype 5394 homeobox transcription ...	42	3.1
299	gb|DQ258017.1| Picea abies genotype 5393 homeobox transcription ...	42	3.1
300	gb|DQ258016.1| Picea abies genotype 5393 homeobox transcription ...	42	3.1
301	gb|DQ258015.1| Picea abies genotype 5390 homeobox transcription ...	42	3.1
302	gb|DQ258014.1| Picea abies genotype 5390 homeobox transcription ...	42	3.1
303	gb|DQ258013.1| Picea abies genotype 86453 homeobox transcription...	42	3.1
304	gb|DQ258012.1| Picea abies genotype 86453 homeobox transcription...	42	3.1
305	gb|CP000266.1| Shigella flexneri 5 str. 8401, complete genome	42	3.1
306	gb|CP000247.1| Escherichia coli 536, complete genome	42	3.1
307	gb|AC158956.6| Mus musculus chromosome 3, clone RP23-370F14, com...	42	3.1
308	gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome	42	3.1
309	gb|CP000243.1| Escherichia coli UTI89, complete genome	42	3.1
310	gb|AE005674.1| Shigella flexneri 2a str. 301, complete genome	42	3.1
311	gb|AY680405.1| Picea mariana homeobox transcription factor KN4 (...	42	3.1
312	gb|AY680390.1| Picea glauca homeobox transcription factor KN4 (K...	42	3.1
313	gb|AY680389.1| Picea abies homeobox transcription factor KN4 (Kn...	42	3.1
314	gb|AC123703.8| Mus musculus chromosome 3, clone RP23-345N18, com...	42	3.1
315	gb|AC108393.10| Mus musculus chromosome 3, clone RP23-388A19, co...	42	3.1
316	gb|AC123731.9| Mus musculus chromosome 15, clone RP23-458N23, co...	42	3.1
317	gb|AC135114.4| Mus musculus BAC clone RP24-69H7 from chromosome ...	42	3.1
318	gb|AC002990.1|HUAC002990 Human Chromosome 16 BAC clone CIT987SK-...	42	3.1
319	gb|AC117216.3| Mus musculus BAC clone RP23-310O5 from 2, complet...	42	3.1
320	dbj|AP009048.1| Escherichia coli W3110 DNA, complete genome	42	3.1
321	gb|U00096.2| Escherichia coli K12 MG1655, complete genome	42	3.1
322	gb|AE014075.1| Escherichia coli CFT073, complete genome	42	3.1
323	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	42	3.1
324	gb|AE014073.1| Shigella flexneri 2a str. 2457T, complete genome	42	3.1
325	emb|AL645849.17| Mouse DNA sequence from clone RP23-14F5 on chro...	42	3.1
326	gb|AC153921.5| Mus musculus 10 BAC RP23-89C21 (Roswell Park Canc...	42	3.1
327	gb|AF081501.1|AF081501 Mus musculus pantophysin gene, complete cds	42	3.1
328	dbj|BA000007.2| Escherichia coli O157:H7 str. Sakai DNA, complet...	42	3.1
329	dbj|AB183638.1| Ochrosphaera sp. MBIC10788 gene for 18S rRNA, pa...	42	3.1
330	dbj|AB183616.1| Pleurochrysis sp. MBIC10549 gene for 18S rRNA, p...	42	3.1
331	dbj|AB183615.1| Ochrosphaera sp. MBIC10548 gene for 18S rRNA, pa...	42	3.1
332	dbj|AB183604.1| Ochrosphaera sp. MBIC10476 gene for 18S rRNA, pa...	42	3.1
333	dbj|AB183603.1| Isochrysis sp. MBIC10475 gene for 18S rRNA, part...	42	3.1
334	dbj|AB183596.1| Pleurochrysis sp. MBIC10443 gene for 18S rRNA, p...	42	3.1
335	dbj|AB058348.1| Cruciplacolithus neohelis gene for 18S rRNA, par...	42	3.1
336	dbj|AB058347.1| Isochrysis sp. MBIC10464 gene for 18S rRNA, part...	42	3.1
337	gb|AC155258.2| Mus musculus BAC clone RP24-83B1 from 12, complet...	42	3.1
338	emb|AJ544121.1|PDE544121 Pleurochrysis dentata partial 18S rRNA ...	42	3.1
339	emb|AJ544119.1|UFO544119 Umbilicosphaera foliosa partial 18S rRN...	42	3.1
340	emb|AJ544118.1|USI544118 Umbilicosphaera sibogae partial 18S rRN...	42	3.1
341	emb|AJ544117.1|CBR544117 Coccolithus braarudii partial 18S rRNA ...	42	3.1
342	emb|AJ544116.1|CLE544116 Calcidiscus leptoporus partial 18S rRNA...	42	3.1
343	emb|AJ544115.1|CQU544115 Calcidiscus quadriperforatus partial 18...	42	3.1
344	gb|AC136020.5| Mus musculus BAC clone RP24-434I13 from 12, compl...	42	3.1
345	gb|AE005174.2| Escherichia coli O157:H7 EDL933, complete genome	42	3.1
346	gb|U29581.1|ECU29581 Escherichia coli K-12 genome; approximately...	42	3.1
347	emb|AL772407.4| Mouse DNA sequence from clone RP23-112N9 on chro...	42	3.1
348	emb|AJ246262.1|CNE246262 Cruciplaccolithus neohelis 18S rRNA gen...	42	3.1
349	emb|AJ246261.1|CPE246261 Coccolithus pelagicus 18S rRNA gene, st...	42	3.1
350	emb|X90992.1|RSSMSRRNA R.socialis small subunit ribosomal RNA	42	3.1
351	gb|CP000034.1| Shigella dysenteriae Sd197, complete genome	42	3.1
352	gb|CP000036.1| Shigella boydii Sb227, complete genome	42	3.1
353	gb|CP000038.1| Shigella sonnei Ss046, complete genome	42	3.1

---

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993
 Score = 50.1 bits (25), Expect = 0.013
 Identities = 28/29 (96%)
 Strand = Plus / Minus

                                             
Query: 53       ggaggccatcttcctcatctccggtcaga 81
                |||||||||||| ||||||||||||||||
Sbjct: 21485821 ggaggccatctttctcatctccggtcaga 21485793

---

>gb|AY368673.1| Triticum turgidum HMW-glutenin locus, complete sequence
          Length = 285506

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 426    gactggtcaaacctgatcagtgggccc 452
              |||||||||||||||| ||||||||||
Sbjct: 263665 gactggtcaaacctgaccagtgggccc 263691

---

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 46.1 bits (23), Expect = 0.20
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                      
Query: 372     gacgaccgctggaaccccgccac 394
               |||||||||||||||||||||||
Sbjct: 1626371 gacgaccgctggaaccccgccac 1626349



 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 280    ttcgcggccctttcgacctcc 300
              |||||||||||||||||||||
Sbjct: 195530 ttcgcggccctttcgacctcc 195510

---

>gb|AC153148.4| Mus musculus BAC clone RP23-189N11 from chromosome 5, complete sequence
          Length = 229020

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 605    ttattcaactcagctgttctgg 626
              ||||||||||||||||||||||
Sbjct: 101192 ttattcaactcagctgttctgg 101213

---

>gb|AC163398.5| Mus musculus chromosome 18, clone RP24-376O5, complete sequence
          Length = 136268

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 678   caaccagtagaaacatttttat 699
             ||||||||||||||||||||||
Sbjct: 72163 caaccagtagaaacatttttat 72142

---

>gb|AC140437.3| Mus musculus BAC clone RP23-88N2 from chromosome 8, complete sequence
          Length = 171402

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 605   ttattcaactcagctgttctgg 626
             ||||||||||||||||||||||
Sbjct: 21804 ttattcaactcagctgttctgg 21825

---

>gb|AC115629.3| Mus musculus BAC clone RP23-74J16 from chromosome 5, complete sequence
          Length = 242126

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 605   ttattcaactcagctgttctgg 626
             ||||||||||||||||||||||
Sbjct: 25451 ttattcaactcagctgttctgg 25472

---

>gb|AC122264.3| Mus musculus BAC clone RP23-197G20 from chromosome 12, complete
            sequence
          Length = 199646

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 607  attcaactcagctgttctggtg 628
            ||||||||||||||||||||||
Sbjct: 2704 attcaactcagctgttctggtg 2683

---

>gb|AC113969.7| Mus musculus chromosome 8, clone RP23-122L19, complete sequence
          Length = 182258

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 605    ttattcaactcagctgttctgg 626
              ||||||||||||||||||||||
Sbjct: 146145 ttattcaactcagctgttctgg 146166

---

>gb|AC165163.2| Mus musculus BAC clone RP23-146B12 from chromosome 14, complete
             sequence
          Length = 178254

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 605   ttattcaactcagctgttctgg 626
             ||||||||||||||||||||||
Sbjct: 90069 ttattcaactcagctgttctgg 90090

---

>gb|AC154904.4| Mus musculus BAC clone RP23-416C3 from chromosome 12, complete sequence
          Length = 194547

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 607    attcaactcagctgttctggtg 628
              ||||||||||||||||||||||
Sbjct: 140563 attcaactcagctgttctggtg 140542

---

>gb|AC155812.2| Mus musculus BAC clone RP24-139G23 from 12, complete sequence
          Length = 153018

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 605    ttattcaactcagctgttctgg 626
              ||||||||||||||||||||||
Sbjct: 120709 ttattcaactcagctgttctgg 120688

---

>emb|CT571268.7| Mouse DNA sequence from clone RP23-275M21 on chromosome 12, complete
             sequence
          Length = 178441

 Score = 44.1 bits (22), Expect = 0.79
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 605   ttattcaactcagctgttctgg 626
             ||||||||||||||||||||||
Sbjct: 85016 ttattcaactcagctgttctgg 85037

---

>gb|CP000468.1| Escherichia coli APEC O1, complete genome
          Length = 5082025

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 664     accgcttcttccatcaaccag 684
               |||||||||||||||||||||
Sbjct: 3092451 accgcttcttccatcaaccag 3092471

---

>gb|AC188467.2| Taeniopygia guttata BAC clone TGMCBa-28H12 from chromosome unknown,
             complete sequence
          Length = 125767

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 525   gattgcacatttggagaagag 545
             |||||||||||||||||||||
Sbjct: 91211 gattgcacatttggagaagag 91231

---

>gb|DQ260227.1| Picea glauca genotype 81115 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260226.1| Picea glauca genotype 81115 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260225.1| Picea glauca genotype 81114 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260224.1| Picea glauca genotype 81114 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260223.1| Picea glauca genotype 81111 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260222.1| Picea glauca genotype 81111 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260221.1| Picea glauca genotype 81110 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260220.1| Picea glauca genotype 81110 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260219.1| Picea glauca genotype 81109 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260218.1| Picea glauca genotype 81109 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1945

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260217.1| Picea glauca genotype 81107 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260216.1| Picea glauca genotype 81107 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260215.1| Picea glauca genotype 81103 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260214.1| Picea glauca genotype 81103 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260213.1| Picea glauca genotype 81102 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260212.1| Picea glauca genotype 81102 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260211.1| Picea glauca genotype 81101 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260210.1| Picea glauca genotype 81101 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260209.1| Picea glauca genotype 80139 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260208.1| Picea glauca genotype 80139 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260207.1| Picea glauca genotype 80135 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260206.1| Picea glauca genotype 80135 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260205.1| Picea glauca genotype 80133 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260204.1| Picea glauca genotype 80133 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260203.1| Picea glauca genotype 80131 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260202.1| Picea glauca genotype 80131 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260201.1| Picea glauca genotype 80128 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260200.1| Picea glauca genotype 80128 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260199.1| Picea glauca genotype 80120 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260198.1| Picea glauca genotype 80120 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260197.1| Picea glauca genotype 80118 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260196.1| Picea glauca genotype 80118 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260195.1| Picea glauca genotype 80117 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260194.1| Picea glauca genotype 80117 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260193.1| Picea glauca genotype 80114 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260192.1| Picea glauca genotype 80114 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260191.1| Picea glauca genotype 80110 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260190.1| Picea glauca genotype 80110 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260189.1| Picea glauca genotype 80102 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260188.1| Picea glauca genotype 80102 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260187.1| Picea glauca genotype 80101 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260186.1| Picea glauca genotype 80101 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260185.1| Picea glauca genotype 79108 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260184.1| Picea glauca genotype 79108 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260183.1| Picea glauca genotype 79106 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260182.1| Picea glauca genotype 79106 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260181.1| Picea glauca genotype 79105 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260180.1| Picea glauca genotype 79105 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260179.1| Picea glauca genotype 79101 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260178.1| Picea glauca genotype 79101 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260177.1| Picea glauca genotype 78107 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260176.1| Picea glauca genotype 78107 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260175.1| Picea glauca genotype 78102 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260174.1| Picea glauca genotype 78102 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260173.1| Picea glauca genotype 77133 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260172.1| Picea glauca genotype 77133 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260171.1| Picea glauca genotype 77114 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260170.1| Picea glauca genotype 77114 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260169.1| Picea glauca genotype 77106 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260168.1| Picea glauca genotype 77106 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260167.1| Picea glauca genotype 77102 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260166.1| Picea glauca genotype 77102 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260165.1| Picea glauca genotype 2397 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260164.1| Picea glauca genotype 2397 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260163.1| Picea glauca genotype 2385 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260162.1| Picea glauca genotype 2385 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260161.1| Picea glauca genotype 2379 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260160.1| Picea glauca genotype 2379 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260159.1| Picea glauca genotype 2312 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260158.1| Picea glauca genotype 2312 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260157.1| Picea glauca genotype 653 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260156.1| Picea glauca genotype 653 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260155.1| Picea glauca genotype 93125 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260154.1| Picea glauca genotype 93125 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260153.1| Picea glauca genotype 93124 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260152.1| Picea glauca genotype 93124 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260151.1| Picea glauca genotype 93122 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260150.1| Picea glauca genotype 93122 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260149.1| Picea glauca genotype 93121 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260148.1| Picea glauca genotype 93121 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260147.1| Picea glauca genotype 93118 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260146.1| Picea glauca genotype 93118 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260145.1| Picea glauca genotype 93116 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260144.1| Picea glauca genotype 93116 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260143.1| Picea glauca genotype 821118 homeobox transcription factor KN4
           (KN4) gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260142.1| Picea glauca genotype 821118 homeobox transcription factor KN4
           (KN4) gene, KN4-1 allele, partial cds
          Length = 1945

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260141.1| Picea glauca genotype 821099 homeobox transcription factor KN4
           (KN4) gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260140.1| Picea glauca genotype 821099 homeobox transcription factor KN4
           (KN4) gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260139.1| Picea glauca genotype 821095 homeobox transcription factor KN4
           (KN4) gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260138.1| Picea glauca genotype 821095 homeobox transcription factor KN4
           (KN4) gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260137.1| Picea glauca genotype 821084 homeobox transcription factor KN4
           (KN4) gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260136.1| Picea glauca genotype 821084 homeobox transcription factor KN4
           (KN4) gene, KN4-1 allele, partial cds
          Length = 1956

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260135.1| Picea glauca genotype 821025 homeobox transcription factor KN4
           (KN4) gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260134.1| Picea glauca genotype 821025 homeobox transcription factor KN4
           (KN4) gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260133.1| Picea glauca genotype 821019 homeobox transcription factor KN4
           (KN4) gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260132.1| Picea glauca genotype 821019 homeobox transcription factor KN4
           (KN4) gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260131.1| Picea glauca genotype 81113 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260130.1| Picea glauca genotype 81113 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260129.1| Picea glauca genotype 81106 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260128.1| Picea glauca genotype 81106 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260127.1| Picea glauca genotype 81104 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260126.1| Picea glauca genotype 81104 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260125.1| Picea glauca genotype 80140 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260124.1| Picea glauca genotype 80140 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260123.1| Picea glauca genotype 80138 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260122.1| Picea glauca genotype 80138 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260121.1| Picea glauca genotype 80137 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260120.1| Picea glauca genotype 80137 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260119.1| Picea glauca genotype 80136 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260118.1| Picea glauca genotype 80136 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260117.1| Picea glauca genotype 80134 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260116.1| Picea glauca genotype 80134 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260115.1| Picea glauca genotype 80132 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260114.1| Picea glauca genotype 80132 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260113.1| Picea glauca genotype 80130 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1923

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 892 cagctgttctggtgggaaatg 872

---

>gb|DQ260112.1| Picea glauca genotype 80130 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260111.1| Picea glauca genotype 80129 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260110.1| Picea glauca genotype 80129 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260109.1| Picea glauca genotype 80127 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260108.1| Picea glauca genotype 80127 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260107.1| Picea glauca genotype 80126 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260106.1| Picea glauca genotype 80126 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260105.1| Picea glauca genotype 80125 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260104.1| Picea glauca genotype 80125 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260103.1| Picea glauca genotype 80124 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260102.1| Picea glauca genotype 80124 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260101.1| Picea glauca genotype 80123 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260100.1| Picea glauca genotype 80123 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260099.1| Picea glauca genotype 80122 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260098.1| Picea glauca genotype 80122 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260097.1| Picea glauca genotype 80121 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260096.1| Picea glauca genotype 80121 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260095.1| Picea glauca genotype 80119 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260094.1| Picea glauca genotype 80119 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260093.1| Picea glauca genotype 80116 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260092.1| Picea glauca genotype 80116 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260091.1| Picea glauca genotype 80113 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1956

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260090.1| Picea glauca genotype 80113 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260089.1| Picea glauca genotype 80112 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260088.1| Picea glauca genotype 80112 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1945

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260087.1| Picea glauca genotype 80109 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260086.1| Picea glauca genotype 80109 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260085.1| Picea glauca genotype 80108 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260084.1| Picea glauca genotype 80108 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260083.1| Picea glauca genotype 80107 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260082.1| Picea glauca genotype 80107 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260081.1| Picea glauca genotype 80106 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260080.1| Picea glauca genotype 80106 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260079.1| Picea glauca genotype 80105 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260078.1| Picea glauca genotype 80105 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260077.1| Picea glauca genotype 80104 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1923

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 892 cagctgttctggtgggaaatg 872

---

>gb|DQ260076.1| Picea glauca genotype 80104 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260075.1| Picea glauca genotype 80103 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260074.1| Picea glauca genotype 80103 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260073.1| Picea glauca genotype 79109 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260072.1| Picea glauca genotype 79109 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260071.1| Picea glauca genotype 79107 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260070.1| Picea glauca genotype 79107 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260069.1| Picea glauca genotype 79104 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260068.1| Picea glauca genotype 79104 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260067.1| Picea glauca genotype 79102 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260066.1| Picea glauca genotype 79102 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260065.1| Picea glauca genotype 77115 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260064.1| Picea glauca genotype 77115 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260063.1| Picea glauca genotype 77113 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260062.1| Picea glauca genotype 77113 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260061.1| Picea glauca genotype 77111 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260060.1| Picea glauca genotype 77111 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260059.1| Picea glauca genotype 77109 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260058.1| Picea glauca genotype 77109 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260057.1| Picea glauca genotype 77108 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260056.1| Picea glauca genotype 77108 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260055.1| Picea glauca genotype 77107 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260054.1| Picea glauca genotype 77107 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260053.1| Picea glauca genotype 77105 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260052.1| Picea glauca genotype 77105 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260051.1| Picea glauca genotype 77104 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260050.1| Picea glauca genotype 77104 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260049.1| Picea glauca genotype 77101 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260048.1| Picea glauca genotype 77101 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260047.1| Picea glauca genotype 243856 homeobox transcription factor KN4
           (KN4) gene, KN4-2 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260046.1| Picea glauca genotype 243856 homeobox transcription factor KN4
           (KN4) gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260045.1| Picea glauca genotype 2393 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260044.1| Picea glauca genotype 2393 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260043.1| Picea glauca genotype 2388 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260042.1| Picea glauca genotype 2388 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1923

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 892 cagctgttctggtgggaaatg 872

---

>gb|DQ260041.1| Picea glauca genotype 2380 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260040.1| Picea glauca genotype 2380 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260039.1| Picea glauca genotype 2327 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260038.1| Picea glauca genotype 2327 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260037.1| Picea glauca genotype 2313 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ260036.1| Picea glauca genotype 2313 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258571.1| Picea mariana genotype 6994 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 921 cagctgttctggtgggaaatg 901

---

>gb|DQ258570.1| Picea mariana genotype 6994 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258569.1| Picea mariana genotype 6986 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 918 cagctgttctggtgggaaatg 898

---

>gb|DQ258568.1| Picea mariana genotype 6986 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258567.1| Picea mariana genotype 6979 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1952

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 919 cagctgttctggtgggaaatg 899

---

>gb|DQ258566.1| Picea mariana genotype 6979 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258565.1| Picea mariana genotype 6976 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1951

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 918 cagctgttctggtgggaaatg 898

---

>gb|DQ258564.1| Picea mariana genotype 6976 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258562.1| Picea mariana genotype 6970 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258561.1| Picea mariana genotype 6965 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258560.1| Picea mariana genotype 6965 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258559.1| Picea mariana genotype 6927 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258558.1| Picea mariana genotype 6927 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258557.1| Picea mariana genotype 6909 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258556.1| Picea mariana genotype 6909 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1952

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 919 cagctgttctggtgggaaatg 899

---

>gb|DQ258555.1| Picea mariana genotype 6902 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258554.1| Picea mariana genotype 6902 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258553.1| Picea mariana genotype 6805 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258552.1| Picea mariana genotype 6805 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1952

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 919 cagctgttctggtgggaaatg 899

---

>gb|DQ258551.1| Picea mariana genotype 6804 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258550.1| Picea mariana genotype 6804 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258549.1| Picea mariana genotype 6801 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258548.1| Picea mariana genotype 6801 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258547.1| Picea mariana genotype 4729 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258546.1| Picea mariana genotype 4729 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 921 cagctgttctggtgggaaatg 901

---

>gb|DQ258545.1| Picea mariana genotype 4354 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258544.1| Picea mariana genotype 4354 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258543.1| Picea mariana genotype 4351 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258542.1| Picea mariana genotype 4351 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1957

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 921 cagctgttctggtgggaaatg 901

---

>gb|DQ258541.1| Picea mariana genotype 3268 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258540.1| Picea mariana genotype 3268 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258539.1| Picea mariana genotype 1847 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258538.1| Picea mariana genotype 1847 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258537.1| Picea mariana genotype 1530 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258536.1| Picea mariana genotype 1530 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258535.1| Picea mariana genotype 1529 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258534.1| Picea mariana genotype 1529 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258533.1| Picea mariana genotype 360 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258532.1| Picea mariana genotype 360 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258531.1| Picea mariana genotype 355 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258530.1| Picea mariana genotype 355 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258529.1| Picea mariana genotype 326 homeobox transcription factor KN4 (KN4)
           gene, KN4-2 allele, partial cds
          Length = 1953

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 920 cagctgttctggtgggaaatg 900

---

>gb|DQ258528.1| Picea mariana genotype 326 homeobox transcription factor KN4 (KN4)
           gene, KN4-1 allele, partial cds
          Length = 1954

 Score = 42.1 bits (21), Expect = 3.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 615 cagctgttctggtgggaaatg 635
           |||||||||||||||||||||
Sbjct: 921 cagctgttctggtgggaaatg 901


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 129,016,951
Number of extensions: 7156559
Number of successful extensions: 150872
Number of sequences better than 10.0: 353
Number of HSP's gapped: 150872
Number of HSP's successfully gapped: 354
Length of query: 826
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 804
Effective length of database: 18,508,616,841
Effective search space: 14880927940164
Effective search space used: 14880927940164
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)

---