>gb|AC161463.3| Gallus gallus BAC clone CH261-127J9 from chromosome ul, complete
            sequence
          Length = 213261
 Score = 46.1 bits (23), Expect = 0.10
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 222  cgaacagattgcagcaaatgtaa 244
            |||||||||||||||||||||||
Sbjct: 9457 cgaacagattgcagcaaatgtaa 9435

>ref|XM_001212806.1| Aspergillus terreus NIH2624 predicted protein (ATEG_03628) mRNA,
           complete cds
          Length = 945

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 292 acggacaggcaacaagatgcagtt 315
           ||||||||| ||||||||||||||
Sbjct: 285 acggacaggtaacaagatgcagtt 308

>ref|XM_001143632.1| PREDICTED: Pan troglodytes SRB7 suppressor of RNA polymerase B
            homolog, transcript variant 1 (SURB7), mRNA
          Length = 2767

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  aacagattgcagcaaatgta 243
            ||||||||||||||||||||
Sbjct: 1550 aacagattgcagcaaatgta 1531

>gb|AE013599.4| Drosophila melanogaster chromosome 2R, complete sequence
          Length = 21146708

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 314      ttgccaccgttctcgcattcgcct 337
                |||||||||||||||| |||||||
Sbjct: 19867891 ttgccaccgttctcgccttcgcct 19867914

>ref|XM_001099368.1| PREDICTED: Macaca mulatta similar to SRB7 suppressor of RNA
            polymerase B homolog (LOC710699), mRNA
          Length = 2766

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  aacagattgcagcaaatgta 243
            ||||||||||||||||||||
Sbjct: 1563 aacagattgcagcaaatgta 1544

>ref|NM_004264.2| Homo sapiens SRB7 suppressor of RNA polymerase B homolog (yeast)
            (SURB7), mRNA
 gb|BC008380.1| Homo sapiens SRB7 suppressor of RNA polymerase B homolog (yeast),
            mRNA (cDNA clone MGC:12425 IMAGE:4041267), complete cds
          Length = 1783

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  aacagattgcagcaaatgta 243
            ||||||||||||||||||||
Sbjct: 1524 aacagattgcagcaaatgta 1505

>ref|NM_134290.1| Drosophila melanogaster Sox box protein 14 CG3090-RB, transcript
           variant B (Sox14), mRNA
          Length = 2485

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 314 ttgccaccgttctcgcattcgcct 337
           |||||||||||||||| |||||||
Sbjct: 474 ttgccaccgttctcgccttcgcct 497

>ref|NM_057546.2| Drosophila melanogaster Sox box protein 14 CG3090-RA, transcript
            variant A (Sox14), mRNA
          Length = 3159

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 314  ttgccaccgttctcgcattcgcct 337
            |||||||||||||||| |||||||
Sbjct: 1148 ttgccaccgttctcgccttcgcct 1171

>dbj|AB169149.1| Macaca fascicularis testis cDNA, clone: QtsA-17555, similar to human
            SRB7 suppressor of RNA polymerase B homolog
            (yeast)(SURB7), mRNA, RefSeq: NM_004264.2
          Length = 1802

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  aacagattgcagcaaatgta 243
            ||||||||||||||||||||
Sbjct: 1539 aacagattgcagcaaatgta 1520

>gb|AC092747.10| Homo sapiens 12p BAC RP11-582E3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 162400

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 224    aacagattgcagcaaatgta 243
              ||||||||||||||||||||
Sbjct: 146967 aacagattgcagcaaatgta 146986

>emb|AL121987.34|HSBA536C5 Human DNA sequence from clone RP11-536C5 on chromosome 1q23.1-24.1
             Contains the 5' end of the KCNJ10 gene for potassium
             inwardly-rectifying channel subfamily J member 10, a novel
             gene, the KCNJ9 gene for potassium inwardly-rectifying
             channel subfamily J member 9, the IGSF8 gene for
             immunoglobulin superfamily member 8, the ATP1A2 gene for
             Na+/K+ transporting ATPase alpha 2 (+) polypeptide, the
             ATP1A4 gene for Na+/K+ transporting ATPase alpha 4 (+)
             polypeptide, the CASQ1 gene for calsequestrin 1
             (fast-twitch, skeletal muscle), a novel gene, the PEA15
             gene for phosphoprotein enriched in astrocytes 15 and four
             CpG islands, complete sequence
          Length = 170834

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 228   gattgcagcaaatgtaacac 247
             ||||||||||||||||||||
Sbjct: 73842 gattgcagcaaatgtaacac 73861

>gb|AC099018.1| Drosophila melanogaster, chromosome 2R, region 60A-60B, BAC clone
             BACR28M05, complete sequence
          Length = 154840

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 314   ttgccaccgttctcgcattcgcct 337
             |||||||||||||||| |||||||
Sbjct: 71758 ttgccaccgttctcgccttcgcct 71781

>emb|AJ252125.1|DME252125 Drosophila melanogaster mRNA for Sox14 protein (Sox14 gene)
          Length = 1876

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 314 ttgccaccgttctcgcattcgcct 337
           |||||||||||||||| |||||||
Sbjct: 415 ttgccaccgttctcgccttcgcct 438

>emb|CR857692.1| Pongo pygmaeus mRNA; cDNA DKFZp468J0220 (from clone DKFZp468J0220)
          Length = 1740

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  aacagattgcagcaaatgta 243
            ||||||||||||||||||||
Sbjct: 1502 aacagattgcagcaaatgta 1483

>emb|CR621668.1| full-length cDNA clone CS0DI014YH17 of Placenta Cot 25-normalized of
            Homo sapiens (human)
          Length = 1700

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 224  aacagattgcagcaaatgta 243
            ||||||||||||||||||||
Sbjct: 1501 aacagattgcagcaaatgta 1482

>emb|CR593127.1| full-length cDNA clone CS0DL010YB14 of B cells (Ramos cell line)
           Cot 25-normalized of Homo sapiens (human)
          Length = 681

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 224 aacagattgcagcaaatgta 243
           ||||||||||||||||||||
Sbjct: 451 aacagattgcagcaaatgta 432

>emb|BX511000.12| Zebrafish DNA sequence from clone DKEY-217F4 in linkage group 2, complete
              sequence
          Length = 191671

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 238    aatgtaacaccacagactgt 257
              ||||||||||||||||||||
Sbjct: 165351 aatgtaacaccacagactgt 165332

>gb|AE016830.1| Enterococcus faecalis V583, complete genome
          Length = 3218031

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 51      aatgcgtgctgctgatgtag 70
               ||||||||||||||||||||
Sbjct: 1270414 aatgcgtgctgctgatgtag 1270433

>gb|AC004642.1|AC004642 Drosophila melanogaster DNA sequence (P1s DS00543 (D193) and DS02867
              (D200)), complete sequence
          Length = 148432

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 314    ttgccaccgttctcgcattcgcct 337
              |||||||||||||||| |||||||
Sbjct: 111464 ttgccaccgttctcgccttcgcct 111441

>gb|J05096.1|HUMATP1A2 Human Na,K-ATPase subunit alpha 2 (ATP1A2) gene, complete cds
          Length = 26668

 Score = 40.1 bits (20), Expect = 6.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 228  gattgcagcaaatgtaacac 247
            ||||||||||||||||||||
Sbjct: 4887 gattgcagcaaatgtaacac 4906


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 59,533,177
Number of extensions: 2808331
Number of successful extensions: 178609
Number of sequences better than 10.0: 20
Number of HSP's gapped: 178609
Number of HSP's successfully gapped: 20
Length of query: 436
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 414
Effective length of database: 18,508,616,841
Effective search space: 7662567372174
Effective search space used: 7662567372174
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 13 (26.3 bits)