ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf95l10
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1emb|CT828260.1| Oryza sativa (indica cultivar-group) cDNA clone:... 291 1e-75
2emb|CT828259.1| Oryza sativa (indica cultivar-group) cDNA clone:... 291 1e-75
3ref|NM_001070460.1| Oryza sativa (japonica cultivar-group) Os09g... 291 1e-75
4dbj|AK112051.1| Oryza sativa (japonica cultivar-group) cDNA clon... 291 1e-75
5dbj|AK099388.1| Oryza sativa (japonica cultivar-group) cDNA clon... 291 1e-75
6gb|AY104951.1| Zea mays PCO082478 mRNA sequence 278 2e-71
7dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
8dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
9dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic D... 214 2e-52
10emb|CT981019.1| partial cDNA sequence from a Lambda ZAP II norma... 149 1e-32
11gb|AY104915.1| Zea mays PCO082477 mRNA sequence 117 4e-23
12ref|NM_116283.2| Arabidopsis thaliana unknown protein (AT4G00585... 50 0.008
13gb|AY091239.1| Arabidopsis thaliana unknown protein (At4g00585) ... 50 0.008
14gb|AY063842.1| Arabidopsis thaliana unknown protein (At4g00585) ... 50 0.008
15gb|AY085811.1| Arabidopsis thaliana clone 18459 mRNA, complete s... 50 0.008
16emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, c... 50 0.008
17dbj|AK118700.1| Arabidopsis thaliana mRNA for unknown protein, c... 50 0.008
18emb|BX828090.1|CNS0A3SJ Arabidopsis thaliana Full-length cDNA Co... 50 0.008
19emb|BX827289.1|CNS0A3P8 Arabidopsis thaliana Full-length cDNA Co... 50 0.008
20gb|AF058919.2|F6N23 Arabidopsis thaliana BAC F6N23 50 0.008
21gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-2... 46 0.13
22gb|AC102680.10| Mus musculus chromosome 8, clone RP24-88L18, com... 46 0.13
23emb|AM236083.1| Rhizobium leguminosarum bv. viciae plasmid pRL9 ... 44 0.50
24ref|XM_001210879.1| Aspergillus terreus NIH2624 hypothetical pro... 42 2.0
25gb|CP000089.1| Dechloromonas aromatica RCB, complete genome 42 2.0
26gb|AC104012.11| Homo sapiens chromosome 8, clone RP11-281N10, co... 42 2.0
27emb|BX957275.7| Zebrafish DNA sequence from clone DKEY-220E22 in... 42 2.0
28dbj|BS000165.1| Pan troglodytes chromosome 22 clone:PTB-057B23, ... 42 2.0
29gb|AF165147.1|AF165147 Homo sapiens chromosome 21q22.1, PAC I228... 42 2.0
30emb|AL163247.2|HS21C047 Homo sapiens chromosome 21 segment HS21C047 42 2.0
31gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, com... 42 2.0
32gb|CP000479.1| Mycobacterium avium 104, complete genome 40 7.8
33gb|CP000478.1| Syntrophobacter fumaroxidans MPOB, complete genome 40 7.8
34emb|CR855051.1| Oryza sativa genomic DNA, chromosome 4, BAC clon... 40 7.8
35ref|XM_001218319.1| Aspergillus terreus NIH2624 predicted protei... 40 7.8
36emb|AM236080.1| Rhizobium leguminosarum bv. viciae chromosome co... 40 7.8
37emb|CT573213.2| Frankia alni str. ACN14A chromosome, complete se... 40 7.8
38gb|BT019290.1| Zea mays clone Contig963.F mRNA sequence 40 7.8
39gb|AC149783.2| Bos taurus BAC CH240-3K17 (Children's Hospital O... 40 7.8
40gb|AY813451.1| Schistosoma japonicum SJCHGC08298 protein mRNA, c... 40 7.8
41gb|AC159321.3| Mus musculus BAC clone RP23-18G14 from chromosome... 40 7.8
42gb|AC103934.10| Mus musculus chromosome 6, clone RP23-287O14, co... 40 7.8
43gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 7.8
44gb|AF457781.1| Schizothorax progastus haplotype SPR332-5f2 mitoc... 40 7.8
45gb|AF457780.1| Schizothorax progastus haplotype SPR332-3f2 mitoc... 40 7.8
46gb|AF457779.1| Schizothorax progastus haplotype SPR332-2f2 mitoc... 40 7.8
47gb|AF457778.1| Schizothorax progastus haplotype SPR332-1f2 mitoc... 40 7.8
48gb|AF457777.1| Schizothorax richardsonii haplotype SRI330-2f2 mi... 40 7.8
49gb|AF457776.1| Schizothorax richardsonii haplotype SRI330-1f2 mi... 40 7.8
50gb|AF457775.1| Schizothorax richardsonii haplotype SRI324-3f2 mi... 40 7.8
51gb|AF457774.1| Schizothorax richardsonii haplotype SRI324-2f2 mi... 40 7.8
52gb|AF457772.1| Schizothorax macrophthalmus haplotype SMA326-9f2 ... 40 7.8
53gb|AF457771.1| Schizothorax macrophthalmus haplotype SMA326-8f2 ... 40 7.8
54gb|AF457770.1| Schizothorax macrophthalmus haplotype SMA326-7f2 ... 40 7.8
55gb|AF457769.1| Schizothorax macrophthalmus haplotype SMA326-5f2 ... 40 7.8
56gb|AF457768.1| Schizothorax nepalensis haplotype SNE327-9f2 mito... 40 7.8
57gb|AF457767.1| Schizothorax nepalensis haplotype SNE327-8f2 mito... 40 7.8
58gb|AF457766.1| Schizothorax nepalensis haplotype SNE327-7f2 mito... 40 7.8
59gb|AF457765.1| Schizothorax nepalensis haplotype SNE327-6f2 mito... 40 7.8
60gb|AF457764.1| Schizothorax nepalensis haplotype SNE327-5f2 mito... 40 7.8
61gb|AF457763.1| Schizothorax nepalensis haplotype SNE327-4f2 mito... 40 7.8
62gb|AF457762.1| Schizothorax nepalensis haplotype SNE327-3f2 mito... 40 7.8
63gb|AF457761.1| Schizothorax nepalensis haplotype SNE327-1f2 mito... 40 7.8
64gb|AF457760.1| Schizothorax raraensis haplotype SrA325-8f2 mitoc... 40 7.8
65gb|AF457759.1| Schizothorax raraensis haplotype SRA325-7f2 mitoc... 40 7.8
66gb|AF457757.1| Schizothorax raraensis haplotype SRA325-4f2 mitoc... 40 7.8
67gb|AF457756.1| Schizothorax raraensis haplotype SRA325-3f2 mitoc... 40 7.8
68gb|AF457754.1| Schizothorax raraensis haplotype SRA326-13f2 mito... 40 7.8
69gb|AF457753.1| Schizothorax raraensis haplotype SRA326-12f2 mito... 40 7.8
70gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete... 40 7.8
71gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromo... 40 7.8
72gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome 40 7.8
73emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 i... 40 7.8
74gb|AC161386.4| Pan troglodytes BAC clone CH251-497P4 from chromo... 40 7.8
75emb|BX294138.1| Rhodopirellula baltica SH 1 complete genome; seg... 40 7.8
76gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Canc... 40 7.8
77gb|AE015927.1| Clostridium tetani E88, complete genome 40 7.8
78gb|AY110731.1| Zea mays CL6588_1 mRNA sequence 40 7.8
79emb|AL136298.5|CNS01DW2 Human chromosome 14 DNA sequence BAC R-1... 40 7.8
80dbj|AP003972.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 40 7.8 
>emb|CT828260.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA108C01, full
           insert sequence
          Length = 1242
 Score =  291 bits (147), Expect = 1e-75
 Identities = 192/207 (92%)
 Strand = Plus / Plus

                                                                       
Query: 124 agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
           ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 740 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccggaaca 799

                                                                       
Query: 184 ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
           |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 800 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 859

                                                                       
Query: 244 agctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaaga 303
           |||||||||||||||| || || |||||||||||||||||||| || ||||||||||| |
Sbjct: 860 agctcgagcaacgcccacatcatccagtccggccaatcccatctcaactttggtgcaaaa 919

                                      
Query: 304 actttggcaagaaggaatactgaagga 330
           ||||||||||||| || || |||||||
Sbjct: 920 actttggcaagaaagagtattgaagga 946
to top
>emb|CT828259.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA039F01, full
           insert sequence
          Length = 535

 Score =  291 bits (147), Expect = 1e-75
 Identities = 192/207 (92%)
 Strand = Plus / Plus

                                                                       
Query: 124 agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
           ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||
Sbjct: 122 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccggaaca 181

                                                                       
Query: 184 ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
           |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 182 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 241

                                                                       
Query: 244 agctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaaga 303
           |||||||||||||||| || || |||||||||||||||||||| || ||||||||||| |
Sbjct: 242 agctcgagcaacgcccacatcatccagtccggccaatcccatctcaactttggtgcaaaa 301

                                      
Query: 304 actttggcaagaaggaatactgaagga 330
           ||||||||||||| || || |||||||
Sbjct: 302 actttggcaagaaagagtattgaagga 328
to top
>ref|NM_001070460.1| Oryza sativa (japonica cultivar-group) Os09g0560300 (Os09g0560300)
           mRNA, complete cds
          Length = 636

 Score =  291 bits (147), Expect = 1e-75
 Identities = 192/207 (92%)
 Strand = Plus / Plus

                                                                       
Query: 124 agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
           ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 112 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 171

                                                                       
Query: 184 ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
           |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 172 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 231

                                                                       
Query: 244 agctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaaga 303
           |||||||||||||||| || ||||| |||||||| |||||||| || ||||||||||| |
Sbjct: 232 agctcgagcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaa 291

                                      
Query: 304 actttggcaagaaggaatactgaagga 330
           ||||||||||||| || || |||||||
Sbjct: 292 actttggcaagaaagagtattgaagga 318
to top
>dbj|AK112051.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-104-E03, full
           insert sequence
          Length = 636

 Score =  291 bits (147), Expect = 1e-75
 Identities = 192/207 (92%)
 Strand = Plus / Plus

                                                                       
Query: 124 agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
           ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 112 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 171

                                                                       
Query: 184 ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
           |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 172 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 231

                                                                       
Query: 244 agctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaaga 303
           |||||||||||||||| || ||||| |||||||| |||||||| || ||||||||||| |
Sbjct: 232 agctcgagcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaa 291

                                      
Query: 304 actttggcaagaaggaatactgaagga 330
           ||||||||||||| || || |||||||
Sbjct: 292 actttggcaagaaagagtattgaagga 318
to top
>dbj|AK099388.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033076P14, full
           insert sequence
          Length = 473

 Score =  291 bits (147), Expect = 1e-75
 Identities = 192/207 (92%)
 Strand = Plus / Plus

                                                                       
Query: 124 agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
           ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 101 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 160

                                                                       
Query: 184 ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
           |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 161 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 220

                                                                       
Query: 244 agctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaaga 303
           |||||||||||||||| || ||||| |||||||| |||||||| || ||||||||||| |
Sbjct: 221 agctcgagcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaa 280

                                      
Query: 304 actttggcaagaaggaatactgaagga 330
           ||||||||||||| || || |||||||
Sbjct: 281 actttggcaagaaagagtattgaagga 307
to top
>gb|AY104951.1| Zea mays PCO082478 mRNA sequence
          Length = 673

 Score =  278 bits (140), Expect = 2e-71
 Identities = 191/208 (91%)
 Strand = Plus / Plus

                                                                       
Query: 124 agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
           ||||||| ||||||||||||||||| || |||||||| ||||||||||||||||| ||||
Sbjct: 173 agaaggtatggagcatgacgggcggcccgtactgccgccccgtccactggcgccgtaaca 232

                                                                       
Query: 184 ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
           |||||||||||||| ||||| |||||||| |||||||||||||||| ||||| ||||| |
Sbjct: 233 ccgccatcgccatgttcggcgtcttcctcatctgcatccccatcgctatgaagtccgcag 292

                                                                       
Query: 244 agctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaaga 303
           ||||||||||||||||||| ||||||||||||||||||||||| || || |||||||| |
Sbjct: 293 agctcgagcaacgcccgcatcacccagtccggccaatcccatctcaactgtggtgcaaaa 352

                                       
Query: 304 actttggcaagaaggaatactgaaggac 331
           ||||||| ||||||||||||||||||||
Sbjct: 353 actttggtaagaaggaatactgaaggac 380
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9
          Length = 22696651

 Score =  214 bits (108), Expect = 2e-52
 Identities = 123/128 (96%)
 Strand = Plus / Minus

                                                                            
Query: 124      agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
                ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 21962869 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 21962810

                                                                            
Query: 184      ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
                |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 21962809 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 21962750

                        
Query: 244      agctcgag 251
                ||||||||
Sbjct: 21962749 agctcgag 21962742



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                            
Query: 250      agcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaactttg 309
                |||||||||| || ||||| |||||||| |||||||| || ||||||||||| |||||||
Sbjct: 21961212 agcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaaactttg 21961153

                                     
Query: 310      gcaagaaggaatactgaagga 330
                ||||||| || || |||||||
Sbjct: 21961152 gcaagaaagagtattgaagga 21961132
to top
>dbj|AP005396.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
            clone:P0635G10
          Length = 146728

 Score =  214 bits (108), Expect = 2e-52
 Identities = 123/128 (96%)
 Strand = Plus / Minus

                                                                        
Query: 124  agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
            ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 4933 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 4874

                                                                        
Query: 184  ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
            |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 4873 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 4814

                    
Query: 244  agctcgag 251
            ||||||||
Sbjct: 4813 agctcgag 4806



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                        
Query: 250  agcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaactttg 309
            |||||||||| || ||||| |||||||| |||||||| || ||||||||||| |||||||
Sbjct: 3276 agcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaaactttg 3217

                                 
Query: 310  gcaagaaggaatactgaagga 330
            ||||||| || || |||||||
Sbjct: 3216 gcaagaaagagtattgaagga 3196
to top
>dbj|AP005090.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
             clone:OJ1065_E04
          Length = 115865

 Score =  214 bits (108), Expect = 2e-52
 Identities = 123/128 (96%)
 Strand = Plus / Minus

                                                                         
Query: 124   agaaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaaca 183
             ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||
Sbjct: 93586 agaaggtatggagcatgacgggcgggccctactgccggcccgtgcactggcgccgcaaca 93527

                                                                         
Query: 184   ccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccg 243
             |||||||||||||| ||||| ||||||||||||||||||||||||||||||| |||||||
Sbjct: 93526 ccgccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgaagtccgccg 93467

                     
Query: 244   agctcgag 251
             ||||||||
Sbjct: 93466 agctcgag 93459



 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 71/81 (87%)
 Strand = Plus / Minus

                                                                         
Query: 250   agcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaactttg 309
             |||||||||| || ||||| |||||||| |||||||| || ||||||||||| |||||||
Sbjct: 91929 agcaacgcccacatcacccggtccggccgatcccatctcaactttggtgcaaaaactttg 91870

                                  
Query: 310   gcaagaaggaatactgaagga 330
             ||||||| || || |||||||
Sbjct: 91869 gcaagaaagagtattgaagga 91849
to top
>emb|CT981019.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 549

 Score =  149 bits (75), Expect = 1e-32
 Identities = 171/203 (84%)
 Strand = Plus / Plus

                                                                       
Query: 126 aaggtgtggagcatgacgggcgggccctactgccggcccgtccactggcgccgcaacacc 185
           ||||| ||||||||||  || ||||| ||||||||||||   ||||||   |||||||||
Sbjct: 145 aaggtatggagcatgagcggagggccgtactgccggcccaagcactggaagcgcaacacc 204

                                                                       
Query: 186 gccatcgccatggtcggcatcttcctcgtctgcatccccatcgccatgaaatccgccgag 245
           |||||||||||| ||||| ||||||||||||||||||||||||||||||  |||||| ||
Sbjct: 205 gccatcgccatgttcggcgtcttcctcgtctgcatccccatcgccatgacgtccgccaag 264

                                                                       
Query: 246 ctcgagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaac 305
           ||||||||||| || || || || || || || || || || || || ||||||||||||
Sbjct: 265 ctcgagcaacggcctcatcagcctgttcgccccattccttcacaactctggtgcaagaac 324

                                  
Query: 306 tttggcaagaaggaatactgaag 328
           ||||| || ||||| ||||||||
Sbjct: 325 tttggtaacaaggagtactgaag 347
to top
>gb|AY104915.1| Zea mays PCO082477 mRNA sequence
          Length = 1855

 Score =  117 bits (59), Expect = 4e-23
 Identities = 77/83 (92%)
 Strand = Plus / Plus

                                                                        
Query: 249  gagcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaacttt 308
            |||||||||||||| ||||||||||||||||||||||| || || |||||||| ||||||
Sbjct: 1616 gagcaacgcccgcatcacccagtccggccaatcccatctcaactgtggtgcaaaaacttt 1675

                                   
Query: 309  ggcaagaaggaatactgaaggac 331
            || ||||||||||||||||||||
Sbjct: 1676 ggtaagaaggaatactgaaggac 1698
to top
>ref|NM_116283.2| Arabidopsis thaliana unknown protein (AT4G00585) mRNA, complete cds
          Length = 558

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 171 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 186 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 245

            
Query: 231 a 231
           |
Sbjct: 246 a 246
to top
>gb|AY091239.1| Arabidopsis thaliana unknown protein (At4g00585) mRNA, complete cds
          Length = 298

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 171 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 97  tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 156

            
Query: 231 a 231
           |
Sbjct: 157 a 157
to top
>gb|AY063842.1| Arabidopsis thaliana unknown protein (At4g00585) mRNA, complete cds
          Length = 565

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 171 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 184 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 243

            
Query: 231 a 231
           |
Sbjct: 244 a 244
to top
>gb|AY085811.1| Arabidopsis thaliana clone 18459 mRNA, complete sequence
          Length = 550

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 171 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 184 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 243

            
Query: 231 a 231
           |
Sbjct: 244 a 244
to top
>emb|AL161472.2|ATCHRIV2 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 2
          Length = 197975

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                         
Query: 171   tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
             ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 58875 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 58816

              
Query: 231   a 231
             |
Sbjct: 58815 a 58815
to top
>dbj|AK118700.1| Arabidopsis thaliana mRNA for unknown protein, complete cds, clone:
           RAFL19-96-J18
          Length = 552

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 171 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 186 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 245

            
Query: 231 a 231
           |
Sbjct: 246 a 246
to top
>emb|BX828090.1|CNS0A3SJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH51ZB10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1370

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 171 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 189 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 248

            
Query: 231 a 231
           |
Sbjct: 249 a 249
to top
>emb|BX827289.1|CNS0A3P8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS34ZC07 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1365

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Plus

                                                                       
Query: 171 tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
           ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 173 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 232

            
Query: 231 a 231
           |
Sbjct: 233 a 233
to top
>gb|AF058919.2|F6N23 Arabidopsis thaliana BAC F6N23
          Length = 91849

 Score = 50.1 bits (25), Expect = 0.008
 Identities = 52/61 (85%)
 Strand = Plus / Minus

                                                                         
Query: 171   tggcgccgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatcgcc 230
             ||||| || ||||||||||| || ||| ||||| | ||||| || |||||||||||||||
Sbjct: 40001 tggcgtcggaacaccgccattgctatgttcggcgttttccttgtgtgcatccccatcgcc 39942

              
Query: 231   a 231
             |
Sbjct: 39941 a 39941
to top
>gb|AC148817.3| Medicago truncatula chromosome 7 BAC clone mth2-22c10, complete
             sequence
          Length = 123020

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 44/51 (86%)
 Strand = Plus / Minus

                                                                
Query: 177   cgcaacaccgccatcgccatggtcggcatcttcctcgtctgcatccccatc 227
             ||||||||||||||||| ||| |||| ||| ||||||| || || ||||||
Sbjct: 50191 cgcaacaccgccatcgctatgttcggtatcgtcctcgtttgtattcccatc 50141



 Score = 42.1 bits (21), Expect = 2.0
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                         
Query: 250   agcaacgcccgcaccacccagtccggccaatcccatcccagctttggtgcaagaactttg 309
             ||||||| || || ||||| || || |||||||| |||||  | ||||||||||||||||
Sbjct: 46621 agcaacgaccacatcacccggttcgtccaatcccttcccaaatgtggtgcaagaactttg 46562

              
Query: 310   g 310
             |
Sbjct: 46561 g 46561
to top
>gb|AC102680.10| Mus musculus chromosome 8, clone RP24-88L18, complete sequence
          Length = 201260

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 343   ttcacaaagaaaatcctgttttt 365
             |||||||||||||||||||||||
Sbjct: 89603 ttcacaaagaaaatcctgttttt 89625
to top
>emb|AM236083.1| Rhizobium leguminosarum bv. viciae plasmid pRL9 complete genome, strain
              3841
          Length = 352782

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 184    ccgccatcgccatggtcggcat 205
              ||||||||||||||||||||||
Sbjct: 334571 ccgccatcgccatggtcggcat 334550
to top
>ref|XM_001210879.1| Aspergillus terreus NIH2624 hypothetical protein (ATEG_00793) mRNA,
           complete cds
          Length = 1488

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 184 ccgccatcgccatggtcggcatcttcctc 212
           ||||||||| ||||| |||||||||||||
Sbjct: 794 ccgccatcgtcatggccggcatcttcctc 822
to top
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome
          Length = 4501104

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 186     gccatcgccatggtcggcatc 206
               |||||||||||||||||||||
Sbjct: 1169646 gccatcgccatggtcggcatc 1169626
to top
>gb|AC104012.11| Homo sapiens chromosome 8, clone RP11-281N10, complete sequence
          Length = 170668

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 338   agactttcacaaagaaaatcc 358
             |||||||||||||||||||||
Sbjct: 95610 agactttcacaaagaaaatcc 95590
to top
>emb|BX957275.7| Zebrafish DNA sequence from clone DKEY-220E22 in linkage group 20,
             complete sequence
          Length = 57535

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 340   actttcacaaagaaaatcctgtttt 364
             ||||||||||| |||||||||||||
Sbjct: 50876 actttcacaaaaaaaatcctgtttt 50852
to top
>dbj|BS000165.1| Pan troglodytes chromosome 22 clone:PTB-057B23, map 22, complete
             sequences
          Length = 142215

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 345   cacaaagaaaatcctgttttt 365
             |||||||||||||||||||||
Sbjct: 97301 cacaaagaaaatcctgttttt 97321
to top
>gb|AF165147.1|AF165147 Homo sapiens chromosome 21q22.1, PAC I2280, complete sequence
          Length = 146735

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 345   cacaaagaaaatcctgttttt 365
             |||||||||||||||||||||
Sbjct: 46044 cacaaagaaaatcctgttttt 46064
to top
>emb|AL163247.2|HS21C047 Homo sapiens chromosome 21 segment HS21C047
          Length = 340000

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 345    cacaaagaaaatcctgttttt 365
              |||||||||||||||||||||
Sbjct: 164522 cacaaagaaaatcctgttttt 164542
to top
>gb|CP000086.1| Burkholderia thailandensis E264 chromosome I, complete sequence
          Length = 3809201

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 247     tcgagcaacgcccgcaccacc 267
               |||||||||||||||||||||
Sbjct: 1505347 tcgagcaacgcccgcaccacc 1505327
to top
>gb|CP000479.1| Mycobacterium avium 104, complete genome
          Length = 5475491

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 9       acccgaccccgatctggttg 28
               ||||||||||||||||||||
Sbjct: 4852805 acccgaccccgatctggttg 4852786
to top
>gb|CP000478.1| Syntrophobacter fumaroxidans MPOB, complete genome
          Length = 4990251

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 410     gctggaagaagtatgctaccatag 433
               |||||||||||||||| |||||||
Sbjct: 2846915 gctggaagaagtatgcgaccatag 2846892
to top
>emb|CR855051.1| Oryza sativa genomic DNA, chromosome 4, BAC clone: OSIGBa0114I04,
             complete sequence
          Length = 102415

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 182   caccgccatcgccatggtcg 201
             ||||||||||||||||||||
Sbjct: 99101 caccgccatcgccatggtcg 99120
to top
>ref|XM_001218319.1| Aspergillus terreus NIH2624 predicted protein (ATEG_09698) mRNA,
           complete cds
          Length = 513

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                       
Query: 255 cgcccgcaccacccagtccggccaatcc 282
           |||| |||||||||| ||||||||||||
Sbjct: 439 cgccggcaccacccattccggccaatcc 412
to top
>emb|AM236080.1| Rhizobium leguminosarum bv. viciae chromosome complete genome, strain 3841
          Length = 5057142

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 190     tcgccatggtcggcatcttc 209
               ||||||||||||||||||||
Sbjct: 2784241 tcgccatggtcggcatcttc 2784222
to top
>emb|CT573213.2| Frankia alni str. ACN14A chromosome, complete sequence
          Length = 7497934

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 157     gccggcccgtccactggcgc 176
               ||||||||||||||||||||
Sbjct: 2222632 gccggcccgtccactggcgc 2222613
to top
>gb|BT019290.1| Zea mays clone Contig963.F mRNA sequence
          Length = 760

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 279 atcccatcccagctttggtgcaag 302
           ||||||||||| ||||||||||||
Sbjct: 187 atcccatcccatctttggtgcaag 164
to top
>gb|AC149783.2| Bos taurus  BAC CH240-3K17 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 205084

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 373   tgccttcttttgtcataacc 392
             ||||||||||||||||||||
Sbjct: 24505 tgccttcttttgtcataacc 24486
to top
>gb|AY813451.1| Schistosoma japonicum SJCHGC08298 protein mRNA, complete cds
          Length = 844

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 344 tcacaaagaaaatcctgttt 363
           ||||||||||||||||||||
Sbjct: 119 tcacaaagaaaatcctgttt 138
to top
>gb|AC159321.3| Mus musculus BAC clone RP23-18G14 from chromosome 6, complete sequence
          Length = 202584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 347    caaagaaaatcctgtttttacctt 370
              |||||||||||||||| |||||||
Sbjct: 150985 caaagaaaatcctgttcttacctt 150962
to top
>gb|AC103934.10| Mus musculus chromosome 6, clone RP23-287O14, complete sequence
          Length = 208817

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 347   caaagaaaatcctgtttttacctt 370
             |||||||||||||||| |||||||
Sbjct: 73953 caaagaaaatcctgttcttacctt 73976
to top
>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 190     tcgccatggtcggcatcttc 209
               ||||||||||||||||||||
Sbjct: 2428516 tcgccatggtcggcatcttc 2428497
to top
>gb|AF457781.1| Schizothorax progastus haplotype SPR332-5f2 mitochondrial control
           region, partial sequence
          Length = 583

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 199 tttattatcacatacaagga 180
to top
>gb|AF457780.1| Schizothorax progastus haplotype SPR332-3f2 mitochondrial control
           region, partial sequence
          Length = 585

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 199 tttattatcacatacaagga 180
to top
>gb|AF457779.1| Schizothorax progastus haplotype SPR332-2f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457778.1| Schizothorax progastus haplotype SPR332-1f2 mitochondrial control
           region, partial sequence
          Length = 580

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457777.1| Schizothorax richardsonii haplotype SRI330-2f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457776.1| Schizothorax richardsonii haplotype SRI330-1f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457775.1| Schizothorax richardsonii haplotype SRI324-3f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457774.1| Schizothorax richardsonii haplotype SRI324-2f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457772.1| Schizothorax macrophthalmus haplotype SMA326-9f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457771.1| Schizothorax macrophthalmus haplotype SMA326-8f2 mitochondrial
           control region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457770.1| Schizothorax macrophthalmus haplotype SMA326-7f2 mitochondrial
           control region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457769.1| Schizothorax macrophthalmus haplotype SMA326-5f2 mitochondrial
           control region, partial sequence
          Length = 580

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457768.1| Schizothorax nepalensis haplotype SNE327-9f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457767.1| Schizothorax nepalensis haplotype SNE327-8f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457766.1| Schizothorax nepalensis haplotype SNE327-7f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457765.1| Schizothorax nepalensis haplotype SNE327-6f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457764.1| Schizothorax nepalensis haplotype SNE327-5f2 mitochondrial control
           region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457763.1| Schizothorax nepalensis haplotype SNE327-4f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457762.1| Schizothorax nepalensis haplotype SNE327-3f2 mitochondrial control
           region, partial sequence
          Length = 586

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457761.1| Schizothorax nepalensis haplotype SNE327-1f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457760.1| Schizothorax raraensis haplotype SrA325-8f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457759.1| Schizothorax raraensis haplotype SRA325-7f2 mitochondrial control
           region, partial sequence
          Length = 582

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457757.1| Schizothorax raraensis haplotype SRA325-4f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457756.1| Schizothorax raraensis haplotype SRA325-3f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457754.1| Schizothorax raraensis haplotype SRA326-13f2 mitochondrial control
           region, partial sequence
          Length = 582

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AF457753.1| Schizothorax raraensis haplotype SRA326-12f2 mitochondrial control
           region, partial sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 456 tttattatcacatacaagga 475
           ||||||||||||||||||||
Sbjct: 200 tttattatcacatacaagga 181
to top
>gb|AC002382.1| Homo sapiens BAC clone CTB-22J17 from 7, complete sequence
          Length = 125590

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 351   gaaaatcctgtttttacctttgtg 374
             |||||||||||||||| |||||||
Sbjct: 29814 gaaaatcctgtttttatctttgtg 29791
to top
>gb|AC161005.4| Pan troglodytes BAC clone CH251-668M6 from chromosome 7, complete
              sequence
          Length = 217746

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 351    gaaaatcctgtttttacctttgtg 374
              |||||||||||||||| |||||||
Sbjct: 120963 gaaaatcctgtttttatctttgtg 120986
to top
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome
          Length = 2932766

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 473     ggagtgcctgtttgtttgcgattc 496
               ||||||||||||||| ||||||||
Sbjct: 1795696 ggagtgcctgtttgtctgcgattc 1795673
to top
>emb|CR450787.6| Zebrafish DNA sequence from clone CH211-222O17 in linkage group 12,
              complete sequence
          Length = 212974

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 349    aagaaaatcctgtttttacctttg 372
              ||||||||| ||||||||||||||
Sbjct: 113029 aagaaaatcttgtttttacctttg 113052
to top
>gb|AC161386.4| Pan troglodytes BAC clone CH251-497P4 from chromosome 7, complete
              sequence
          Length = 193048

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 351    gaaaatcctgtttttacctttgtg 374
              |||||||||||||||| |||||||
Sbjct: 187992 gaaaatcctgtttttatctttgtg 188015
to top
>emb|BX294138.1| Rhodopirellula baltica SH 1 complete genome; segment 6/24
          Length = 321950

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 268   cagtccggccaatcccatcc 287
             ||||||||||||||||||||
Sbjct: 33863 cagtccggccaatcccatcc 33882
to top
>gb|AC128714.15| Homo sapiens 3 BAC RP11-433C9 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 109972

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 361   tttttacctttgtgccttcttttg 384
             |||||||||||||||||| |||||
Sbjct: 47521 tttttacctttgtgcctttttttg 47544
to top
>gb|AE015927.1| Clostridium tetani E88, complete genome
          Length = 2799251

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 303     aactttggcaagaaggaata 322
               ||||||||||||||||||||
Sbjct: 1517226 aactttggcaagaaggaata 1517245
to top
>gb|AY110731.1| Zea mays CL6588_1 mRNA sequence
          Length = 874

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 279 atcccatcccagctttggtgcaag 302
           ||||||||||| ||||||||||||
Sbjct: 252 atcccatcccatctttggtgcaag 229
to top
>emb|AL136298.5|CNS01DW2 Human chromosome 14 DNA sequence BAC R-134E15 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 181532

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 363    tttacctttgtgccttcttttgtcataa 390
              |||||||| ||||||||||||| |||||
Sbjct: 115196 tttaccttggtgccttcttttgccataa 115169
to top
>dbj|AP003972.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-861E23, complete
             sequence
          Length = 181946

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 213   gtctgcatccccatcgccat 232
             ||||||||||||||||||||
Sbjct: 62029 gtctgcatccccatcgccat 62048


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 75,609,538
Number of extensions: 3746959
Number of successful extensions: 75249
Number of sequences better than 10.0: 80
Number of HSP's gapped: 75247
Number of HSP's successfully gapped: 84
Length of query: 534
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 512
Effective length of database: 18,508,616,841
Effective search space: 9476411822592
Effective search space used: 9476411822592
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top