ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf95h13
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_001067458.1| Oryza sativa (japonica cultivar-group) Os08g... 1005 0.0
2dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK7... 1005 0.0
3dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clon... 1005 0.0
4emb|CT833066.1| Oryza sativa (indica cultivar-group) cDNA clone:... 991 0.0
5ref|NM_001072216.1| Oryza sativa (japonica cultivar-group) Os11g... 946 0.0
6dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 462 e-126
7dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic D... 462 e-126
8gb|AC123528.2| Oryza sativa chromosome 11 clone OSJNBa0078E03, ... 430 e-117
9dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 430 e-117
10dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 406 e-110
11emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0 406 e-110
12emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa... 406 e-110
13emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575... 406 e-110
14gb|BT016531.1| Zea mays clone Contig364 mRNA sequence 398 e-107
15emb|CT983947.1| partial cDNA sequence from a Lambda ZAP II norma... 303 8e-79
16gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA... 250 1e-62
17ref|NM_111754.2| Arabidopsis thaliana structural constituent of ... 234 6e-58
18gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosoma... 234 6e-58
19gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosoma... 234 6e-58
20emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Co... 234 6e-58
21dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acid... 234 6e-58
22ref|NM_111960.2| Arabidopsis thaliana structural constituent of ... 230 1e-56
23gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosoma... 230 1e-56
24gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosoma... 230 1e-56
25gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete s... 230 1e-56
26gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal prote... 228 4e-56
27gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal prote... 228 4e-56
28gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence 226 2e-55
29gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete se... 226 2e-55
30emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Co... 224 6e-55
31gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal prot... 198 3e-47
32emb|X93587.1|LLP0 L.luteus mRNA for P0 ribosomal protein 186 1e-43
33dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic r... 176 1e-40
34dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic r... 176 1e-40
35emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein 170 8e-39
36gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC... 149 3e-32
37gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 ... 149 3e-32
38dbj|AK062008.1| Oryza sativa (japonica cultivar-group) cDNA clon... 141 7e-30
39ref|NM_129559.2| Arabidopsis thaliana structural constituent of ... 137 1e-28
40gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence 137 1e-28
41emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Co... 137 1e-28
42gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S a... 137 1e-28
43gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11... 121 7e-24
44gb|AC184089.2| Populus trichocarpa clone Pop1-58K16, complete se... 119 3e-23
45gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 ma... 113 2e-21
46gb|AC130799.19| Medicago truncatula clone mth2-34b13, complete s... 109 2e-20
47emb|CT982927.1| partial cDNA sequence from a Lambda ZAP II norma... 103 2e-18
48emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Co... 103 2e-18
49gb|DQ244437.1| Zea mays clone 7589 mRNA sequence 54 0.001
50gb|BT016538.1| Zea mays clone Contig371 mRNA sequence 54 0.001
51gb|DQ306774.1| Hevea brasiliensis isolate SSH45 mRNA sequence 54 0.001
52gb|DQ306752.1| Hevea brasiliensis isolate SSH23 mRNA sequence 54 0.001
53dbj|AK239428.1| Sus scrofa mRNA, clone:THY010103A05, expressed i... 52 0.005
54dbj|AK231505.1| Sus scrofa mRNA, clone:ITT010083C10, expressed i... 52 0.005
55dbj|AK234557.1| Sus scrofa mRNA, clone:OVR010084G10, expressed i... 52 0.005
56dbj|AK234485.1| Sus scrofa mRNA, clone:OVR010070H08, expressed i... 52 0.005
57gb|DQ235177.1| Solanum tuberosum clone 157H11 acidic ribosomal p... 52 0.005
58gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, c... 52 0.005
59gb|AY702006.1| Leishmania donovani strain MHOM/IN/1983/AG83 60S ... 52 0.005
60emb|X72714.1|LILIPOA L. infantum LiPO-A and LiPO-B gene 52 0.005
61gb|AY180912.1| Leishmania donovani ribosomal protein P0-like mRN... 52 0.005
62ref|XM_843004.1| Leishmania major strain Friedlin 60S acidic rib... 52 0.005
63ref|XM_843003.1| Leishmania major strain Friedlin 60S acidic rib... 52 0.005
64gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal pro... 52 0.005
65ref|XM_001211754.1| Aspergillus terreus NIH2624 60S acidic ribos... 50 0.020
66ref|XM_001104158.1| PREDICTED: Macaca mulatta hypothetical prote... 50 0.020
67gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, co... 50 0.020
68emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ri... 50 0.020
69dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I a... 50 0.020
70ref|XM_795562.2| PREDICTED: Strongylocentrotus purpuratus hypoth... 48 0.078
71ref|XM_001200349.1| PREDICTED: Strongylocentrotus purpuratus hyp... 48 0.078
72gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete s... 48 0.078
73gb|BT027040.1| Gasterosteus aculeatus clone CFW157-A07 mRNA sequ... 48 0.078
74gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosom... 48 0.078
75gb|AC122117.10| Mus musculus chromosome 18, clone RP23-61O22, co... 48 0.078
76gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, co... 48 0.078
77gb|BC042186.1| Homo sapiens cDNA clone IMAGE:5393404, partial cds 48 0.078
78ref|NM_079487.2| Drosophila melanogaster Ribosomal protein LP0 C... 48 0.078
79dbj|AK021773.1| Homo sapiens cDNA FLJ11711 fis, clone HEMBA1005152 48 0.078
80gb|AC010009.7| Drosophila melanogaster 3L BAC RP98-23D16 (Roswel... 48 0.078
81gb|AC010011.5| Drosophila melanogaster 3L BAC RP98-17D14 (Roswel... 48 0.078
82gb|AC069368.14| Homo sapiens chromosome 15, clone CTD-2017F17, c... 48 0.078
83gb|AY075528.1| Drosophila melanogaster RE74511 full length cDNA 48 0.078
84gb|AC019084.9| Homo sapiens BAC clone RP11-354O2 from 7, complet... 48 0.078
85emb|Z84486.1|HS528L19 Human DNA sequence from clone RP3-528L19 o... 48 0.078
86dbj|AB178287.1| Neospora caninum NcRP1 mRNA for ribosomal protei... 48 0.078
87emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-... 48 0.078
88emb|BX019003.1|CNS08MTR Single read from an extremity of a full-... 48 0.078
89emb|BX018793.1|CNS08MNX Single read from an extremity of a full-... 48 0.078
90emb|BX013777.1|CNS08ISL Single read from an extremity of a full-... 48 0.078
91emb|BX006032.1|CNS08CTG Single read from an extremity of a full-... 48 0.078
92emb|BX005998.1|CNS08CSI Single read from an extremity of a full-... 48 0.078
93gb|AC153881.4| Mus musculus 10 BAC RP23-257B9 (Roswell Park Canc... 48 0.078
94gb|BT021447.1| Drosophila melanogaster GH01513 full insert cDNA 48 0.078
95emb|AL928893.10| Mouse DNA sequence from clone RP23-55I14 on chr... 48 0.078
96gb|AC106843.11| Mus musculus chromosome 15, clone RP24-151M4, co... 48 0.078
97gb|M25772.1|DROAP3A Drosophila melanogaster DNA repair protein (... 48 0.078
98emb|CT830605.1| Oryza sativa (indica cultivar-group) cDNA clone:... 46 0.31
99ref|NM_001054614.1| Oryza sativa (japonica cultivar-group) Os02g... 46 0.31
100ref|NM_001053107.1| Oryza sativa (japonica cultivar-group) Os02g... 46 0.31
101tpe|BN000560.1| TPA_inf: Oryza sativa (japonica cultivar-group) ... 46 0.31
102gb|DQ440047.1| Aedes aegypti clone AE-294 60S acidic ribosomal p... 46 0.31
103gb|AC114644.10| Mus musculus chromosome 1, clone RP24-128L10, co... 46 0.31
104gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, c... 46 0.31
105gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, co... 46 0.31
106gb|AC115846.7| Mus musculus chromosome 1, clone RP24-245O4, comp... 46 0.31
107gb|BT018010.1| Zea mays clone EL01N0528A08.c mRNA sequence 46 0.31
108gb|AC106169.5| Rattus norvegicus x BAC CH230-105D14 (Children's ... 46 0.31
109gb|AY674236.1| Ixodes pacificus clone IP_7_60_92_569_CLU ribosom... 46 0.31
110ref|XM_656186.1| Aspergillus nidulans FGSC A4 hypothetical prote... 46 0.31
111ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosom... 46 0.31
112gb|AF039040.1| Caenorhabditis elegans cosmid T22B11, complete se... 46 0.31
113gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosom... 46 0.31
114gb|AC121604.3| Mus musculus BAC clone RP23-312E2 from chromosome... 46 0.31
115gb|AC131785.3| Mus musculus BAC clone RP24-397D13 from chromosom... 46 0.31
116gb|AC126670.4| Mus musculus BAC clone RP24-469G14 from chromosom... 46 0.31
117gb|AC127374.4| Mus musculus BAC clone RP23-46G11 from chromosome... 46 0.31
118gb|AC123558.5| Mus musculus BAC clone RP23-336N16 from chromosom... 46 0.31
119gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosom... 46 0.31
120gb|AC122246.5| Mus musculus BAC clone RP23-152K13 from 1, comple... 46 0.31
121gb|AC125344.2| Mus musculus BAC clone RP24-332H21 from 12, compl... 46 0.31
122gb|AY239227.1| Eimeria maxima TFP250 mRNA, complete cds 46 0.31
123gb|AC163649.3| Mus musculus BAC clone RP24-372B10 from chromosom... 46 0.31
124ref|NM_001028223.2| Caenorhabditis elegans T22B11.4b (T22B11.4) ... 46 0.31
125ref|NM_001028222.2| Caenorhabditis elegans T22B11.4a (T22B11.4) ... 46 0.31
126dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.31
127dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.31
128emb|CR637846.2|CNS0ER4S Tetraodon nigroviridis full-length cDNA 46 0.31
129emb|AL596188.6| Human DNA sequence from clone CTA-31J9 on chromo... 46 0.31
130emb|AL157388.12| Human DNA sequence from clone RP11-215A21 on ch... 46 0.31
131gb|AC110377.5| Mus musculus BAC clone RP23-460A13 from chromosom... 46 0.31
132emb|BX028182.1|CNS08TWQ Single read from an extremity of a full-... 46 0.31
133emb|BX028181.1|CNS08TWP Single read from an extremity of a full-... 46 0.31
134emb|BX028180.1|CNS08TWO Single read from an extremity of a full-... 46 0.31
135emb|BX028178.1|CNS08TWM Single read from an extremity of a full-... 46 0.31
136emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-... 46 0.31
137emb|BX072146.1|CNS09RTY Single read from an extremity of a full-... 46 0.31
138emb|BX072055.1|CNS09RRF Single read from an extremity of a full-... 46 0.31
139emb|BX072031.1|CNS09RQR Single read from an extremity of a full-... 46 0.31
140emb|BX071993.1|CNS09RPP Single read from an extremity of a full-... 46 0.31
141emb|BX071847.1|CNS09RLN Single read from an extremity of a full-... 46 0.31
142emb|BX071747.1|CNS09RIV Single read from an extremity of a full-... 46 0.31
143emb|BX071599.1|CNS09RER Single read from an extremity of a full-... 46 0.31
144emb|BX071518.1|CNS09RCI Single read from an extremity of a full-... 46 0.31
145emb|BX071445.1|CNS09RAH Single read from an extremity of a full-... 46 0.31
146emb|BX071386.1|CNS09R8U Single read from an extremity of a full-... 46 0.31
147emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-... 46 0.31
148emb|BX071251.1|CNS09R53 Single read from an extremity of a full-... 46 0.31
149emb|BX071226.1|CNS09R4E Single read from an extremity of a full-... 46 0.31
150emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-... 46 0.31
151emb|BX070622.1|CNS09QNM Single read from an extremity of a full-... 46 0.31
152emb|BX070589.1|CNS09QMP Single read from an extremity of a full-... 46 0.31
153emb|BX070541.1|CNS09QLD Single read from an extremity of a full-... 46 0.31
154emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-... 46 0.31
155emb|BX070973.1|CNS09QXD Single read from an extremity of a full-... 46 0.31
156emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-... 46 0.31
157emb|BX070900.1|CNS09QVC Single read from an extremity of a full-... 46 0.31
158emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-... 46 0.31
159emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-... 46 0.31
160emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-... 46 0.31
161emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-... 46 0.31
162emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-... 46 0.31
163emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-... 46 0.31
164emb|BX069588.1|CNS09PUW Single read from an extremity of a full-... 46 0.31
165emb|BX069403.1|CNS09PPR Single read from an extremity of a full-... 46 0.31
166emb|BX069336.1|CNS09PNW Single read from an extremity of a full-... 46 0.31
167emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-... 46 0.31
168emb|BX069142.1|CNS09PII Single read from an extremity of a full-... 46 0.31
169emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-... 46 0.31
170emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-... 46 0.31
171emb|BX068833.1|CNS09P9X Single read from an extremity of a full-... 46 0.31
172emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-... 46 0.31
173emb|BX068815.1|CNS09P9F Single read from an extremity of a full-... 46 0.31
174emb|BX068760.1|CNS09P7W Single read from an extremity of a full-... 46 0.31
175emb|BX068607.1|CNS09P3N Single read from an extremity of a full-... 46 0.31
176emb|BX068471.1|CNS09OZV Single read from an extremity of a full-... 46 0.31
177emb|BX067564.1|CNS09OAO Single read from an extremity of a full-... 46 0.31
178emb|BX067487.1|CNS09O8J Single read from an extremity of a full-... 46 0.31
179emb|BX067429.1|CNS09O6X Single read from an extremity of a full-... 46 0.31
180emb|BX068019.1|CNS09ONB Single read from an extremity of a full-... 46 0.31
181emb|BX067891.1|CNS09OJR Single read from an extremity of a full-... 46 0.31
182emb|BX067841.1|CNS09OID Single read from an extremity of a full-... 46 0.31
183emb|BX067819.1|CNS09OHR Single read from an extremity of a full-... 46 0.31
184emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-... 46 0.31
185emb|BX067752.1|CNS09OFW Single read from an extremity of a full-... 46 0.31
186emb|BX067707.1|CNS09OEN Single read from an extremity of a full-... 46 0.31
187emb|BX067216.1|CNS09O10 Single read from an extremity of a full-... 46 0.31
188emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-... 46 0.31
189emb|BX066992.1|CNS09NUS Single read from an extremity of a full-... 46 0.31
190emb|BX066854.1|CNS09NQY Single read from an extremity of a full-... 46 0.31
191emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-... 46 0.31
192emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-... 46 0.31
193emb|BX066597.1|CNS09NJT Single read from an extremity of a full-... 46 0.31
194emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-... 46 0.31
195emb|BX066412.1|CNS09NEO Single read from an extremity of a full-... 46 0.31
196emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-... 46 0.31
197emb|BX066329.1|CNS09NCD Single read from an extremity of a full-... 46 0.31
198emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-... 46 0.31
199emb|BX065714.1|CNS09MVA Single read from an extremity of a full-... 46 0.31
200emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-... 46 0.31
201emb|BX065465.1|CNS09MOD Single read from an extremity of a full-... 46 0.31
202emb|BX065359.1|CNS09MLF Single read from an extremity of a full-... 46 0.31
203emb|BX065269.1|CNS09MIX Single read from an extremity of a full-... 46 0.31
204emb|BX065249.1|CNS09MID Single read from an extremity of a full-... 46 0.31
205emb|BX065042.1|CNS09MCM Single read from an extremity of a full-... 46 0.31
206emb|BX065015.1|CNS09MBV Single read from an extremity of a full-... 46 0.31
207emb|BX065006.1|CNS09MBM Single read from an extremity of a full-... 46 0.31
208emb|BX065005.1|CNS09MBL Single read from an extremity of a full-... 46 0.31
209emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-... 46 0.31
210emb|BX064796.1|CNS09M5S Single read from an extremity of a full-... 46 0.31
211emb|BX064760.1|CNS09M4S Single read from an extremity of a full-... 46 0.31
212emb|BX064725.1|CNS09M3T Single read from an extremity of a full-... 46 0.31
213emb|BX064530.1|CNS09LYE Single read from an extremity of a full-... 46 0.31
214emb|BX064423.1|CNS09LVF Single read from an extremity of a full-... 46 0.31
215emb|BX064284.1|CNS09LRK Single read from an extremity of a full-... 46 0.31
216emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-... 46 0.31
217emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-... 46 0.31
218emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-... 46 0.31
219emb|BX064068.1|CNS09LLK Single read from an extremity of a full-... 46 0.31
220emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-... 46 0.31
221emb|BX063577.1|CNS09L7X Single read from an extremity of a full-... 46 0.31
222emb|BX063467.1|CNS09L4V Single read from an extremity of a full-... 46 0.31
223emb|BX063466.1|CNS09L4U Single read from an extremity of a full-... 46 0.31
224emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-... 46 0.31
225emb|BX063420.1|CNS09L3K Single read from an extremity of a full-... 46 0.31
226emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-... 46 0.31
227emb|BX062552.1|CNS09KFG Single read from an extremity of a full-... 46 0.31
228emb|BX062546.1|CNS09KFA Single read from an extremity of a full-... 46 0.31
229emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-... 46 0.31
230emb|BX062387.1|CNS09KAV Single read from an extremity of a full-... 46 0.31
231emb|BX062299.1|CNS09K8F Single read from an extremity of a full-... 46 0.31
232emb|BX062297.1|CNS09K8D Single read from an extremity of a full-... 46 0.31
233emb|BX062183.1|CNS09K57 Single read from an extremity of a full-... 46 0.31
234emb|BX062169.1|CNS09K4T Single read from an extremity of a full-... 46 0.31
235emb|BX062048.1|CNS09K1G Single read from an extremity of a full-... 46 0.31
236emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-... 46 0.31
237emb|BX061190.1|CNS09JDM Single read from an extremity of a full-... 46 0.31
238emb|BX061164.1|CNS09JCW Single read from an extremity of a full-... 46 0.31
239emb|BX061163.1|CNS09JCV Single read from an extremity of a full-... 46 0.31
240emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-... 46 0.31
241emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-... 46 0.31
242emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-... 46 0.31
243emb|BX061090.1|CNS09JAU Single read from an extremity of a full-... 46 0.31
244emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-... 46 0.31
245emb|BX061042.1|CNS09J9I Single read from an extremity of a full-... 46 0.31
246emb|BX060642.1|CNS09IYE Single read from an extremity of a full-... 46 0.31
247emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-... 46 0.31
248emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-... 46 0.31
249emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-... 46 0.31
250emb|BX060443.1|CNS09ISV Single read from an extremity of a full-... 46 0.31
251emb|BX060185.1|CNS09ILP Single read from an extremity of a full-... 46 0.31
252emb|BX059916.1|CNS09IE8 Single read from an extremity of a full-... 46 0.31
253emb|BX059866.1|CNS09ICU Single read from an extremity of a full-... 46 0.31
254emb|BX059758.1|CNS09I9U Single read from an extremity of a full-... 46 0.31
255emb|BX059741.1|CNS09I9D Single read from an extremity of a full-... 46 0.31
256emb|BX059642.1|CNS09I6M Single read from an extremity of a full-... 46 0.31
257emb|BX059587.1|CNS09I53 Single read from an extremity of a full-... 46 0.31
258emb|BX059585.1|CNS09I51 Single read from an extremity of a full-... 46 0.31
259emb|BX059469.1|CNS09I1T Single read from an extremity of a full-... 46 0.31
260emb|BX059305.1|CNS09HX9 Single read from an extremity of a full-... 46 0.31
261emb|BX059220.1|CNS09HUW Single read from an extremity of a full-... 46 0.31
262emb|BX059184.1|CNS09HTW Single read from an extremity of a full-... 46 0.31
263emb|BX059095.1|CNS09HRF Single read from an extremity of a full-... 46 0.31
264emb|BX058971.1|CNS09HNZ Single read from an extremity of a full-... 46 0.31
265emb|BX058839.1|CNS09HKB Single read from an extremity of a full-... 46 0.31
266emb|BX058760.1|CNS09HI4 Single read from an extremity of a full-... 46 0.31
267emb|BX058740.1|CNS09HHK Single read from an extremity of a full-... 46 0.31
268emb|BX058729.1|CNS09HH9 Single read from an extremity of a full-... 46 0.31
269emb|BX058315.1|CNS09H5R Single read from an extremity of a full-... 46 0.31
270emb|BX058203.1|CNS09H2N Single read from an extremity of a full-... 46 0.31
271emb|BX057924.1|CNS09GUW Single read from an extremity of a full-... 46 0.31
272emb|BX057796.1|CNS09GRC Single read from an extremity of a full-... 46 0.31
273emb|BX057631.1|CNS09GMR Single read from an extremity of a full-... 46 0.31
274emb|BX057605.1|CNS09GM1 Single read from an extremity of a full-... 46 0.31
275emb|BX057468.1|CNS09GI8 Single read from an extremity of a full-... 46 0.31
276emb|BX057218.1|CNS09GBA Single read from an extremity of a full-... 46 0.31
277emb|BX057213.1|CNS09GB5 Single read from an extremity of a full-... 46 0.31
278emb|BX057133.1|CNS09G8X Single read from an extremity of a full-... 46 0.31
279emb|BX057094.1|CNS09G7U Single read from an extremity of a full-... 46 0.31
280emb|BX057074.1|CNS09G7A Single read from an extremity of a full-... 46 0.31
281emb|BX056996.1|CNS09G54 Single read from an extremity of a full-... 46 0.31
282emb|BX056958.1|CNS09G42 Single read from an extremity of a full-... 46 0.31
283emb|BX056914.1|CNS09G2U Single read from an extremity of a full-... 46 0.31
284emb|BX056754.1|CNS09FYE Single read from an extremity of a full-... 46 0.31
285emb|BX056483.1|CNS09FQV Single read from an extremity of a full-... 46 0.31
286emb|BX056320.1|CNS09FMC Single read from an extremity of a full-... 46 0.31
287emb|BX056288.1|CNS09FLG Single read from an extremity of a full-... 46 0.31
288emb|BX056287.1|CNS09FLF Single read from an extremity of a full-... 46 0.31
289emb|BX056283.1|CNS09FLB Single read from an extremity of a full-... 46 0.31
290emb|BX055725.1|CNS09F5T Single read from an extremity of a full-... 46 0.31
291emb|BX055721.1|CNS09F5P Single read from an extremity of a full-... 46 0.31
292emb|BX055621.1|CNS09F2X Single read from an extremity of a full-... 46 0.31
293emb|BX055603.1|CNS09F2F Single read from an extremity of a full-... 46 0.31
294emb|BX055999.1|CNS09FDF Single read from an extremity of a full-... 46 0.31
295emb|BX055960.1|CNS09FCC Single read from an extremity of a full-... 46 0.31
296emb|BX055808.1|CNS09F84 Single read from an extremity of a full-... 46 0.31
297emb|BX055567.1|CNS09F1F Single read from an extremity of a full-... 46 0.31
298emb|BX054654.1|CNS09EC2 Single read from an extremity of a full-... 46 0.31
299emb|BX054435.1|CNS09E5Z Single read from an extremity of a full-... 46 0.31
300emb|BX054345.1|CNS09E3H Single read from an extremity of a full-... 46 0.31
301emb|BX054246.1|CNS09E0Q Single read from an extremity of a full-... 46 0.31
302emb|BX054186.1|CNS09DZ2 Single read from an extremity of a full-... 46 0.31
303emb|BX054114.1|CNS09DX2 Single read from an extremity of a full-... 46 0.31
304emb|BX054048.1|CNS09DV8 Single read from an extremity of a full-... 46 0.31
305emb|BX053890.1|CNS09DQU Single read from an extremity of a full-... 46 0.31
306emb|BX053889.1|CNS09DQT Single read from an extremity of a full-... 46 0.31
307emb|BX053751.1|CNS09DMZ Single read from an extremity of a full-... 46 0.31
308emb|BX053704.1|CNS09DLO Single read from an extremity of a full-... 46 0.31
309emb|BX053693.1|CNS09DLD Single read from an extremity of a full-... 46 0.31
310emb|BX053532.1|CNS09DGW Single read from an extremity of a full-... 46 0.31
311emb|BX053469.1|CNS09DF5 Single read from an extremity of a full-... 46 0.31
312emb|BX053214.1|CNS09D82 Single read from an extremity of a full-... 46 0.31
313emb|BX053185.1|CNS09D79 Single read from an extremity of a full-... 46 0.31
314emb|BX053146.1|CNS09D66 Single read from an extremity of a full-... 46 0.31
315emb|BX052948.1|CNS09D0O Single read from an extremity of a full-... 46 0.31
316emb|BX052946.1|CNS09D0M Single read from an extremity of a full-... 46 0.31
317emb|BX052874.1|CNS09CYM Single read from an extremity of a full-... 46 0.31
318emb|BX052836.1|CNS09CXK Single read from an extremity of a full-... 46 0.31
319emb|BX052835.1|CNS09CXJ Single read from an extremity of a full-... 46 0.31
320emb|BX052777.1|CNS09CVX Single read from an extremity of a full-... 46 0.31
321emb|BX052368.1|CNS09CKK Single read from an extremity of a full-... 46 0.31
322emb|BX052724.1|CNS09CUG Single read from an extremity of a full-... 46 0.31
323emb|BX052263.1|CNS09CHN Single read from an extremity of a full-... 46 0.31
324emb|BX052235.1|CNS09CGV Single read from an extremity of a full-... 46 0.31
325emb|BX052086.1|CNS09CCQ Single read from an extremity of a full-... 46 0.31
326emb|BX052085.1|CNS09CCP Single read from an extremity of a full-... 46 0.31
327emb|BX052064.1|CNS09CC4 Single read from an extremity of a full-... 46 0.31
328emb|BX052006.1|CNS09CAI Single read from an extremity of a full-... 46 0.31
329emb|BX051964.1|CNS09C9C Single read from an extremity of a full-... 46 0.31
330emb|BX051899.1|CNS09C7J Single read from an extremity of a full-... 46 0.31
331emb|BX051866.1|CNS09C6M Single read from an extremity of a full-... 46 0.31
332emb|BX051626.1|CNS09BZY Single read from an extremity of a full-... 46 0.31
333emb|BX051618.1|CNS09BZQ Single read from an extremity of a full-... 46 0.31
334emb|BX051600.1|CNS09BZ8 Single read from an extremity of a full-... 46 0.31
335emb|BX051577.1|CNS09BYL Single read from an extremity of a full-... 46 0.31
336emb|BX051509.1|CNS09BWP Single read from an extremity of a full-... 46 0.31
337emb|BX051472.1|CNS09BVO Single read from an extremity of a full-... 46 0.31
338emb|BX051379.1|CNS09BT3 Single read from an extremity of a full-... 46 0.31
339emb|BX050804.1|CNS09BD4 Single read from an extremity of a full-... 46 0.31
340emb|BX050797.1|CNS09BCX Single read from an extremity of a full-... 46 0.31
341emb|BX050762.1|CNS09BBY Single read from an extremity of a full-... 46 0.31
342emb|BX050723.1|CNS09BAV Single read from an extremity of a full-... 46 0.31
343emb|BX051301.1|CNS09BQX Single read from an extremity of a full-... 46 0.31
344emb|BX050711.1|CNS09BAJ Single read from an extremity of a full-... 46 0.31
345emb|BX050679.1|CNS09B9N Single read from an extremity of a full-... 46 0.31
346emb|BX050552.1|CNS09B64 Single read from an extremity of a full-... 46 0.31
347emb|BX050545.1|CNS09B5X Single read from an extremity of a full-... 46 0.31
348emb|BX050514.1|CNS09B52 Single read from an extremity of a full-... 46 0.31
349emb|BX050479.1|CNS09B43 Single read from an extremity of a full-... 46 0.31
350emb|BX050437.1|CNS09B2X Single read from an extremity of a full-... 46 0.31
351emb|BX050412.1|CNS09B28 Single read from an extremity of a full-... 46 0.31
352emb|BX049466.1|CNS09ABY Single read from an extremity of a full-... 46 0.31
353emb|BX050290.1|CNS09AYU Single read from an extremity of a full-... 46 0.31
354emb|BX050244.1|CNS09AXK Single read from an extremity of a full-... 46 0.31
355emb|BX050212.1|CNS09AWO Single read from an extremity of a full-... 46 0.31
356emb|BX050202.1|CNS09AWE Single read from an extremity of a full-... 46 0.31
357emb|BX050196.1|CNS09AW8 Single read from an extremity of a full-... 46 0.31
358emb|BX049856.1|CNS09AMS Single read from an extremity of a full-... 46 0.31
359emb|BX049758.1|CNS09AK2 Single read from an extremity of a full-... 46 0.31
360emb|BX049674.1|CNS09AHQ Single read from an extremity of a full-... 46 0.31
361emb|BX049615.1|CNS09AG3 Single read from an extremity of a full-... 46 0.31
362emb|BX049546.1|CNS09AE6 Single read from an extremity of a full-... 46 0.31
363emb|BX049524.1|CNS09ADK Single read from an extremity of a full-... 46 0.31
364emb|BX049240.1|CNS09A5O Single read from an extremity of a full-... 46 0.31
365emb|BX049187.1|CNS09A47 Single read from an extremity of a full-... 46 0.31
366emb|BX048234.1|CNS099DQ Single read from an extremity of a full-... 46 0.31
367emb|BX048199.1|CNS099CR Single read from an extremity of a full-... 46 0.31
368emb|BX048525.1|CNS099LT Single read from an extremity of a full-... 46 0.31
369emb|BX048433.1|CNS099J9 Single read from an extremity of a full-... 46 0.31
370emb|BX047843.1|CNS0992V Single read from an extremity of a full-... 46 0.31
371emb|BX047734.1|CNS098ZU Single read from an extremity of a full-... 46 0.31
372emb|BX047732.1|CNS098ZS Single read from an extremity of a full-... 46 0.31
373emb|BX047714.1|CNS098ZA Single read from an extremity of a full-... 46 0.31
374emb|BX047691.1|CNS098YN Single read from an extremity of a full-... 46 0.31
375emb|BX047999.1|CNS09977 Single read from an extremity of a full-... 46 0.31
376emb|BX047946.1|CNS0995Q Single read from an extremity of a full-... 46 0.31
377emb|BX047277.1|CNS098N5 Single read from an extremity of a full-... 46 0.31
378emb|BX047157.1|CNS098JT Single read from an extremity of a full-... 46 0.31
379emb|BX047017.1|CNS098FX Single read from an extremity of a full-... 46 0.31
380emb|BX046849.1|CNS098B9 Single read from an extremity of a full-... 46 0.31
381emb|BX046679.1|CNS0986J Single read from an extremity of a full-... 46 0.31
382emb|BX046163.1|CNS097S7 Single read from an extremity of a full-... 46 0.31
383emb|BX046117.1|CNS097QX Single read from an extremity of a full-... 46 0.31
384emb|BX046099.1|CNS097QF Single read from an extremity of a full-... 46 0.31
385emb|BX046025.1|CNS097OD Single read from an extremity of a full-... 46 0.31
386emb|BX046353.1|CNS097XH Single read from an extremity of a full-... 46 0.31
387emb|BX046290.1|CNS097VQ Single read from an extremity of a full-... 46 0.31
388emb|BX045705.1|CNS097FH Single read from an extremity of a full-... 46 0.31
389emb|BX045497.1|CNS0979P Single read from an extremity of a full-... 46 0.31
390emb|BX045440.1|CNS09784 Single read from an extremity of a full-... 46 0.31
391emb|BX045432.1|CNS0977W Single read from an extremity of a full-... 46 0.31
392emb|BX045257.1|CNS09731 Single read from an extremity of a full-... 46 0.31
393emb|BX045074.1|CNS096XY Single read from an extremity of a full-... 46 0.31
394emb|BX045040.1|CNS096X0 Single read from an extremity of a full-... 46 0.31
395emb|BX044741.1|CNS096OP Single read from an extremity of a full-... 46 0.31
396emb|BX044735.1|CNS096OJ Single read from an extremity of a full-... 46 0.31
397emb|BX044619.1|CNS096LB Single read from an extremity of a full-... 46 0.31
398emb|BX044857.1|CNS096RX Single read from an extremity of a full-... 46 0.31
399emb|BX044429.1|CNS096G1 Single read from an extremity of a full-... 46 0.31
400emb|BX043251.1|CNS095JB Single read from an extremity of a full-... 46 0.31
401emb|BX044185.1|CNS09699 Single read from an extremity of a full-... 46 0.31
402emb|BX044159.1|CNS0968J Single read from an extremity of a full-... 46 0.31
403emb|BX044153.1|CNS0968D Single read from an extremity of a full-... 46 0.31
404emb|BX044099.1|CNS0966V Single read from an extremity of a full-... 46 0.31
405emb|BX044052.1|CNS0965K Single read from an extremity of a full-... 46 0.31
406emb|BX044026.1|CNS0964U Single read from an extremity of a full-... 46 0.31
407emb|BX043798.1|CNS095YI Single read from an extremity of a full-... 46 0.31
408emb|BX043757.1|CNS095XD Single read from an extremity of a full-... 46 0.31
409emb|BX043702.1|CNS095VU Single read from an extremity of a full-... 46 0.31
410emb|BX043623.1|CNS095TN Single read from an extremity of a full-... 46 0.31
411emb|BX043472.1|CNS095PG Single read from an extremity of a full-... 46 0.31
412emb|BX043128.1|CNS095FW Single read from an extremity of a full-... 46 0.31
413emb|BX043127.1|CNS095FV Single read from an extremity of a full-... 46 0.31
414emb|BX043118.1|CNS095FM Single read from an extremity of a full-... 46 0.31
415emb|BX043090.1|CNS095EU Single read from an extremity of a full-... 46 0.31
416emb|BX043059.1|CNS095DZ Single read from an extremity of a full-... 46 0.31
417emb|BX042955.1|CNS095B3 Single read from an extremity of a full-... 46 0.31
418emb|BX042524.1|CNS094Z4 Single read from an extremity of a full-... 46 0.31
419emb|BX042434.1|CNS094WM Single read from an extremity of a full-... 46 0.31
420emb|BX042404.1|CNS094VS Single read from an extremity of a full-... 46 0.31
421emb|BX042353.1|CNS094UD Single read from an extremity of a full-... 46 0.31
422emb|BX042609.1|CNS0951H Single read from an extremity of a full-... 46 0.31
423emb|BX041748.1|CNS094DK Single read from an extremity of a full-... 46 0.31
424emb|BX041467.1|CNS0945R Single read from an extremity of a full-... 46 0.31
425emb|BX041389.1|CNS0943L Single read from an extremity of a full-... 46 0.31
426emb|BX041365.1|CNS0942X Single read from an extremity of a full-... 46 0.31
427emb|BX041651.1|CNS094AV Single read from an extremity of a full-... 46 0.31
428emb|BX041602.1|CNS0949I Single read from an extremity of a full-... 46 0.31
429emb|BX041135.1|CNS093WJ Single read from an extremity of a full-... 46 0.31
430emb|BX041109.1|CNS093VT Single read from an extremity of a full-... 46 0.31
431emb|BX041108.1|CNS093VS Single read from an extremity of a full-... 46 0.31
432emb|BX040887.1|CNS093PN Single read from an extremity of a full-... 46 0.31
433emb|BX040837.1|CNS093O9 Single read from an extremity of a full-... 46 0.31
434emb|BX040799.1|CNS093N7 Single read from an extremity of a full-... 46 0.31
435emb|BX040616.1|CNS093I4 Single read from an extremity of a full-... 46 0.31
436emb|BX040351.1|CNS093AR Single read from an extremity of a full-... 46 0.31
437emb|BX040297.1|CNS09399 Single read from an extremity of a full-... 46 0.31
438emb|BX040236.1|CNS0937K Single read from an extremity of a full-... 46 0.31
439emb|BX040137.1|CNS0934T Single read from an extremity of a full-... 46 0.31
440emb|BX040069.1|CNS0932X Single read from an extremity of a full-... 46 0.31
441emb|BX039907.1|CNS092YF Single read from an extremity of a full-... 46 0.31
442emb|BX039734.1|CNS092TM Single read from an extremity of a full-... 46 0.31
443emb|BX039373.1|CNS092JL Single read from an extremity of a full-... 46 0.31
444emb|BX039309.1|CNS092HT Single read from an extremity of a full-... 46 0.31
445emb|BX039262.1|CNS092GI Single read from an extremity of a full-... 46 0.31
446emb|BX037386.1|CNS0910E Single read from an extremity of a full-... 46 0.31
447emb|BX037345.1|CNS090Z9 Single read from an extremity of a full-... 46 0.31
448emb|BX037247.1|CNS090WJ Single read from an extremity of a full-... 46 0.31
449emb|BX037012.1|CNS090Q0 Single read from an extremity of a full-... 46 0.31
450emb|BX036831.1|CNS090KZ Single read from an extremity of a full-... 46 0.31
451emb|BX037215.1|CNS090VN Single read from an extremity of a full-... 46 0.31
452emb|BX037189.1|CNS090UX Single read from an extremity of a full-... 46 0.31
453emb|BX037187.1|CNS090UV Single read from an extremity of a full-... 46 0.31
454emb|BX037165.1|CNS090U9 Single read from an extremity of a full-... 46 0.31
455emb|BX037106.1|CNS090SM Single read from an extremity of a full-... 46 0.31
456emb|BX033976.1|CNS08YDO Single read from an extremity of a full-... 46 0.31
457emb|BX033938.1|CNS08YCM Single read from an extremity of a full-... 46 0.31
458emb|BX033860.1|CNS08YAG Single read from an extremity of a full-... 46 0.31
459emb|BX033846.1|CNS08YA2 Single read from an extremity of a full-... 46 0.31
460emb|BX033821.1|CNS08Y9D Single read from an extremity of a full-... 46 0.31
461emb|BX033820.1|CNS08Y9C Single read from an extremity of a full-... 46 0.31
462emb|BX033818.1|CNS08Y9A Single read from an extremity of a full-... 46 0.31
463emb|BX036759.1|CNS090IZ Single read from an extremity of a full-... 46 0.31
464emb|BX036700.1|CNS090HC Single read from an extremity of a full-... 46 0.31
465emb|BX036670.1|CNS090GI Single read from an extremity of a full-... 46 0.31
466emb|BX036518.1|CNS090CA Single read from an extremity of a full-... 46 0.31
467emb|BX036428.1|CNS0909S Single read from an extremity of a full-... 46 0.31
468emb|BX036405.1|CNS09095 Single read from an extremity of a full-... 46 0.31
469emb|BX036358.1|CNS0907U Single read from an extremity of a full-... 46 0.31
470emb|BX035782.1|CNS08ZRU Single read from an extremity of a full-... 46 0.31
471emb|BX036158.1|CNS0902A Single read from an extremity of a full-... 46 0.31
472emb|BX036109.1|CNS0900X Single read from an extremity of a full-... 46 0.31
473emb|BX035671.1|CNS08ZOR Single read from an extremity of a full-... 46 0.31
474emb|BX035626.1|CNS08ZNI Single read from an extremity of a full-... 46 0.31
475emb|BX035617.1|CNS08ZN9 Single read from an extremity of a full-... 46 0.31
476emb|BX035548.1|CNS08ZLC Single read from an extremity of a full-... 46 0.31
477emb|BX035515.1|CNS08ZKF Single read from an extremity of a full-... 46 0.31
478emb|BX035485.1|CNS08ZJL Single read from an extremity of a full-... 46 0.31
479emb|BX035372.1|CNS08ZGG Single read from an extremity of a full-... 46 0.31
480emb|BX035343.1|CNS08ZFN Single read from an extremity of a full-... 46 0.31
481emb|BX035328.1|CNS08ZF8 Single read from an extremity of a full-... 46 0.31
482emb|BX035267.1|CNS08ZDJ Single read from an extremity of a full-... 46 0.31
483emb|BX035228.1|CNS08ZCG Single read from an extremity of a full-... 46 0.31
484emb|BX035165.1|CNS08ZAP Single read from an extremity of a full-... 46 0.31
485emb|BX035008.1|CNS08Z6C Single read from an extremity of a full-... 46 0.31
486emb|BX034906.1|CNS08Z3I Single read from an extremity of a full-... 46 0.31
487emb|BX034370.1|CNS08YOM Single read from an extremity of a full-... 46 0.31
488emb|BX034264.1|CNS08YLO Single read from an extremity of a full-... 46 0.31
489emb|BX034229.1|CNS08YKP Single read from an extremity of a full-... 46 0.31
490emb|BX034221.1|CNS08YKH Single read from an extremity of a full-... 46 0.31
491emb|BX034904.1|CNS08Z3G Single read from an extremity of a full-... 46 0.31
492emb|BX034886.1|CNS08Z2Y Single read from an extremity of a full-... 46 0.31
493emb|BX034882.1|CNS08Z2U Single read from an extremity of a full-... 46 0.31
494emb|BX034881.1|CNS08Z2T Single read from an extremity of a full-... 46 0.31
495emb|BX034803.1|CNS08Z0N Single read from an extremity of a full-... 46 0.31
496emb|BX034670.1|CNS08YWY Single read from an extremity of a full-... 46 0.31
497emb|BX034538.1|CNS08YTA Single read from an extremity of a full-... 46 0.31
498emb|BX034506.1|CNS08YSE Single read from an extremity of a full-... 46 0.31
499emb|BX034480.1|CNS08YRO Single read from an extremity of a full-... 46 0.31
500emb|BX030693.1|CNS08VUH Single read from an extremity of a full-... 46 0.31

>ref|NM_001067458.1| Oryza sativa (japonica cultivar-group) Os08g0130500 (Os08g0130500)
           mRNA, complete cds
          Length = 1235
 Score = 1005 bits (507), Expect = 0.0
 Identities = 753/835 (90%)
 Strand = Plus / Plus

                                                                       
Query: 137 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 196
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 127 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 186

                                                                       
Query: 197 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 256
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 187 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 246

                                                                       
Query: 257 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 316
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 247 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 306

                                                                       
Query: 317 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 376
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 307 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 366

                                                                       
Query: 377 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 436
           ||||||    |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 367 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 426

                                                                       
Query: 437 aggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttg 496
           |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| || ||||
Sbjct: 427 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 486

                                                                       
Query: 497 cacctgttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtcct 556
           | |||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
Sbjct: 487 ctcctgttgatgtggtggttccccctggcaacactggtctggatccatcccagacctctt 546

                                                                       
Query: 557 tcttccaggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcc 616
           ||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||
Sbjct: 547 tcttccaggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcaccc 606

                                                                       
Query: 617 cagtggagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgcca 676
           | |||||||| || |||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 607 ctgtggagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgcca 666

                                                                       
Query: 677 agcttggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggt 736
           |||||||||||||||||||||||||||| ||||| ||   ||||||||||||||||||||
Sbjct: 667 agcttggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggt 726

                                                                       
Query: 737 cagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgctt 796
           ||||||||||||| ||||| ||||||||||||||||| || |||||||| ||||||||||
Sbjct: 727 cagtcttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttgctt 786

                                                                       
Query: 797 ctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctg 856
           |||||||||| |||||||||||| | |||||||| ||||| ||||| || || |||||||
Sbjct: 787 ctggtgtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctg 846

                                                                       
Query: 857 caccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagact 916
           |||| ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || |
Sbjct: 847 caccacacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaat 906

                                                                  
Query: 917 actcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
           |||||||    |||||||||||||||||||||||  | || ||||| ||||||||
Sbjct: 907 actcgtacccacatgctgataagatcaaggagtatttgaaagaccccagcaagtt 961



 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                    
Query: 4  aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 45
          ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1  aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 42



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1025 ccaaggaggaggagaagaaggaagaacccgaggaggaatcagatgg 1070
            |||||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 1015 ccaaggaggaagagaagaaggaagagcccgaggaggagtccgatgg 1060



to top

>dbj|D21130.1|RICYK704 Oryza sativa (japonica cultivar-group) YK704 mRNA for acidic
           ribosomal protein P0, complete cds
          Length = 1220

 Score = 1005 bits (507), Expect = 0.0
 Identities = 753/835 (90%)
 Strand = Plus / Plus

                                                                       
Query: 137 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 196
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 110 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 169

                                                                       
Query: 197 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 256
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 170 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 229

                                                                       
Query: 257 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 316
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 230 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 289

                                                                       
Query: 317 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 376
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 290 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 349

                                                                       
Query: 377 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 436
           ||||||    |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 350 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 409

                                                                       
Query: 437 aggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttg 496
           |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| || ||||
Sbjct: 410 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 469

                                                                       
Query: 497 cacctgttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtcct 556
           | |||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
Sbjct: 470 ctcctgttgatgtggtggttccccctggcaacactggtctggatccatcccagacctctt 529

                                                                       
Query: 557 tcttccaggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcc 616
           ||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||
Sbjct: 530 tcttccaggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcaccc 589

                                                                       
Query: 617 cagtggagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgcca 676
           | |||||||| || |||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 590 ctgtggagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgcca 649

                                                                       
Query: 677 agcttggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggt 736
           |||||||||||||||||||||||||||| ||||| ||   ||||||||||||||||||||
Sbjct: 650 agcttggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggt 709

                                                                       
Query: 737 cagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgctt 796
           ||||||||||||| ||||| ||||||||||||||||| || |||||||| ||||||||||
Sbjct: 710 cagtcttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttgctt 769

                                                                       
Query: 797 ctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctg 856
           |||||||||| |||||||||||| | |||||||| ||||| ||||| || || |||||||
Sbjct: 770 ctggtgtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctg 829

                                                                       
Query: 857 caccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagact 916
           |||| ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || |
Sbjct: 830 caccacacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaat 889

                                                                  
Query: 917 actcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
           |||||||    |||||||||||||||||||||||  | || ||||| ||||||||
Sbjct: 890 actcgtacccacatgctgataagatcaaggagtatttgaaagaccccagcaagtt 944



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1025 ccaaggaggaggagaagaaggaagaacccgaggaggaatcagatgg 1070
            |||||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 998  ccaaggaggaagagaagaaggaagagcccgaggaggagtccgatgg 1043



to top

>dbj|AK064857.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000H12, full
           insert sequence
          Length = 1236

 Score = 1005 bits (507), Expect = 0.0
 Identities = 753/835 (90%)
 Strand = Plus / Plus

                                                                       
Query: 137 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 196
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 128 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 187

                                                                       
Query: 197 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 256
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 188 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 247

                                                                       
Query: 257 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 316
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 248 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 307

                                                                       
Query: 317 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 376
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 308 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 367

                                                                       
Query: 377 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 436
           ||||||    |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 368 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 427

                                                                       
Query: 437 aggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttg 496
           |||| ||||||||||| ||||||||||||||||| ||||||||||||||||| || ||||
Sbjct: 428 aggtccgcgaggaggttgccaagtacaaggttggagctcctgctcgtgttggtcttgttg 487

                                                                       
Query: 497 cacctgttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtcct 556
           | |||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
Sbjct: 488 ctcctgttgatgtggtggttccccctggcaacactggtctggatccatcccagacctctt 547

                                                                       
Query: 557 tcttccaggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcc 616
           ||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||
Sbjct: 548 tcttccaggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcaccc 607

                                                                       
Query: 617 cagtggagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgcca 676
           | |||||||| || |||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 608 ctgtggagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgcca 667

                                                                       
Query: 677 agcttggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggt 736
           |||||||||||||||||||||||||||| ||||| ||   ||||||||||||||||||||
Sbjct: 668 agcttggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggt 727

                                                                       
Query: 737 cagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgctt 796
           ||||||||||||| ||||| ||||||||||||||||| || |||||||| ||||||||||
Sbjct: 728 cagtcttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttgctt 787

                                                                       
Query: 797 ctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctg 856
           |||||||||| |||||||||||| | |||||||| ||||| ||||| || || |||||||
Sbjct: 788 ctggtgtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctg 847

                                                                       
Query: 857 caccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagact 916
           |||| ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || |
Sbjct: 848 caccacacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaat 907

                                                                  
Query: 917 actcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
           |||||||    |||||||||||||||||||||||  | || ||||| ||||||||
Sbjct: 908 actcgtacccacatgctgataagatcaaggagtatttgaaagaccccagcaagtt 962



 Score = 75.8 bits (38), Expect = 3e-10
 Identities = 41/42 (97%)
 Strand = Plus / Plus

                                                    
Query: 4  aggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 45
          ||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 2  aggttaaagcgacgccgccgccgcaagccgtccgccttgctc 43



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1025 ccaaggaggaggagaagaaggaagaacccgaggaggaatcagatgg 1070
            |||||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 1016 ccaaggaggaagagaagaaggaagagcccgaggaggagtccgatgg 1061



to top

>emb|CT833066.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA108E23, full
           insert sequence
          Length = 1235

 Score =  991 bits (500), Expect = 0.0
 Identities = 753/836 (90%), Gaps = 1/836 (0%)
 Strand = Plus / Plus

                                                                       
Query: 137 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 196
           ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 124 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 183

                                                                       
Query: 197 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 256
           || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 184 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 243

                                                                       
Query: 257 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 316
           |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 244 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 303

                                                                       
Query: 317 ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 376
           |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 304 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 363

                                                                       
Query: 377 agctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaagg 436
           ||||||    |||||||||||| |||||||||||||||||||||||||||||||||||||
Sbjct: 364 agctcatgcccctcctcgtcggaaacgttggcctcatcttcaccaagggtgacctcaagg 423

                                                                       
Query: 437 aggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttg 496
           |||| ||||||||||| ||||||||||||| ||| ||||||||||||||||| || ||||
Sbjct: 424 aggtccgcgaggaggttgccaagtacaagggtggagctcctgctcgtgttggtcttgttg 483

                                                                       
Query: 497 cacctgttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtcct 556
           | |||||||||||||||||||||||||||||||||||||||||||| |||||||| || |
Sbjct: 484 ctcctgttgatgtggtggttccccctggcaacactggtctggatccatcccagacctctt 543

                                                                       
Query: 557 tcttccaggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcc 616
           ||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||
Sbjct: 544 tcttccaggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcaccc 603

                                                                       
Query: 617 cagtggagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgcca 676
           | |||||||| || |||||||||||||||||||||||||| |||||||| ||||||||||
Sbjct: 604 ctgtggagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgcca 663

                                                                       
Query: 677 agcttggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggt 736
           |||||||||||||||||||||||||||| ||||| ||   ||||||||||||||||||||
Sbjct: 664 agcttggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggt 723

                                                                       
Query: 737 cagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgctt 796
           ||||||||||||| ||||| ||||||||||||||||| || |||||||| ||||||||||
Sbjct: 724 cagtcttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttgctt 783

                                                                       
Query: 797 ctggtgtttccatggttgcctcact-gtccctggcgatctcataccccaccatggctgct 855
           |||||||||| |||||||||||| |  |||||||| ||||| ||||| || || ||||||
Sbjct: 784 ctggtgtttctatggttgcctcagtcttccctggcaatctcgtacccaactattgctgct 843

                                                                       
Query: 856 gcaccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagac 915
           ||||| ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || 
Sbjct: 844 gcaccacacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaa 903

                                                                   
Query: 916 tactcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
           ||||||||    |||||||||||||||||||||||  | |||||||| ||||||||
Sbjct: 904 tactcgtacccacatgctgataagatcaaggagtatttgaaggaccccagcaagtt 959



 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 40/41 (97%)
 Strand = Plus / Plus

                                                   
Query: 5  ggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 45
          |||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1  ggttaaagcgacgccgccgccgcaagccgtccgccttgctc 41



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1025 ccaaggaggaggagaagaaggaagaacccgaggaggaatcagatgg 1070
            |||||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 1013 ccaaggaggaagagaagaaggaagagcccgaggaggagtccgatgg 1058



to top

>ref|NM_001072216.1| Oryza sativa (japonica cultivar-group) Os11g0135400 (Os11g0135400)
           mRNA, complete cds
          Length = 963

 Score =  946 bits (477), Expect = 0.0
 Identities = 744/833 (89%)
 Strand = Plus / Plus

                                                                       
Query: 139 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 198
           |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1   atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 60

                                                                       
Query: 199 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 258
            | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 61  cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 120

                                                                       
Query: 259 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 318
           || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 121 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 180

                                                                       
Query: 319 ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 378
           || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 181 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 240

                                                                       
Query: 379 ctcagcaacctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggag 438
           ||||    |||||||||||| |||||||| ||||||||||||||||||||||||||||||
Sbjct: 241 ctcatgcccctcctcgtcggaaacgttggtctcatcttcaccaagggtgacctcaaggag 300

                                                                       
Query: 439 gttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgca 498
           || ||||| ||||||||||||||||||||||| ||||||||||||||||| || ||||| 
Sbjct: 301 gtccgcgaagaggtcgccaagtacaaggttggagctcctgctcgtgttggtctggttgct 360

                                                                       
Query: 499 cctgttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtccttc 558
           |||||||||||||||||||||||||| |||||||||||||||||||||||||| || |||
Sbjct: 361 cctgttgatgtggtggttccccctggaaacactggtctggatccctcccagacttctttc 420

                                                                       
Query: 559 ttccaggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatccca 618
           || |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| 
Sbjct: 421 tttcaggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccct 480

                                                                       
Query: 619 gtggagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaag 678
           |||||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 481 gtggagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaag 540

                                                                       
Query: 679 cttggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtca 738
           |||||||||||||||||||||||||| ||||| |||  |||||| || ||||||||||||
Sbjct: 541 cttggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtca 600

                                                                       
Query: 739 gtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttct 798
           ||||||||||| ||||| || ||||||||||| || || |||||||| |||||||| |||
Sbjct: 601 gtcttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatct 660

                                                                       
Query: 799 ggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgca 858
           |||||||| |||||||||||| |||||||||| ||||||||||| || || |||||||| 
Sbjct: 661 ggtgtttcgatggttgcctcagtgtccctggcaatctcatacccaactattgctgctgcg 720

                                                                       
Query: 859 ccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagactac 918
           || ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || |||
Sbjct: 721 ccacacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaatac 780

                                                                
Query: 919 tcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
           || ||    |||||||||||||||||||||||  | |||||||| ||||||||
Sbjct: 781 tcatacccacatgctgataagatcaaggagtatttgaaggaccccagcaagtt 833



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 35/37 (94%)
 Strand = Plus / Plus

                                                 
Query: 1025 ccaaggaggaggagaagaaggaagaacccgaggagga 1061
            |||||||||| |||||||||||||| |||||||||||
Sbjct: 890  ccaaggaggaagagaagaaggaagagcccgaggagga 926



to top

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8
          Length = 28434780

 Score =  462 bits (233), Expect = e-126
 Identities = 350/389 (89%)
 Strand = Plus / Minus

                                                                           
Query: 562     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 621
               |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 1715190 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtg 1715131

                                                                           
Query: 622     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 681
               ||||| || |||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 1715130 gagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagctt 1715071

                                                                           
Query: 682     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 741
               ||||||||||||||||||||||| ||||| ||   |||||||||||||||||||||||||
Sbjct: 1715070 ggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtc 1715011

                                                                           
Query: 742     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 801
               |||||||| ||||| ||||||||||||||||| || |||||||| |||||||||||||||
Sbjct: 1715010 ttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttgcttctggt 1714951

                                                                           
Query: 802     gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 861
               ||||| |||||||||||| | |||||||| ||||| ||||| || || ||||||||||| 
Sbjct: 1714950 gtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctgcacca 1714891

                                                                           
Query: 862     cacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagactactcg 921
               ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || ||||||
Sbjct: 1714890 cacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaatactcg 1714831

                                            
Query: 922     tatgaccatgctgataagatcaaggagta 950
               ||    |||||||||||||||||||||||
Sbjct: 1714830 tacccacatgctgataagatcaaggagta 1714802



 Score =  297 bits (150), Expect = 5e-77
 Identities = 222/246 (90%)
 Strand = Plus / Minus

                                                                           
Query: 137     cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 196
               ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 1716667 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 1716608

                                                                           
Query: 197     agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 256
               || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 1716607 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 1716548

                                                                           
Query: 257     agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 316
               |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 1716547 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 1716488

                                                                           
Query: 317     ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 376
               |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 1716487 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 1716428

                     
Query: 377     agctca 382
               ||||||
Sbjct: 1716427 agctca 1716422



 Score =  151 bits (76), Expect = 7e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                           
Query: 464     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
               ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 1715379 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctg 1715320

                                                           
Query: 524     gcaacactggtctggatccctcccagacgtccttcttccaggtg 567
               ||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 1715319 gcaacactggtctggatccatcccagacctctttcttccaggtg 1715276



 Score =  119 bits (60), Expect = 3e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                           
Query: 400     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 459
               ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 1716313 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 1716254

                       
Query: 460     tacaaggt 467
               ||||||||
Sbjct: 1716253 tacaaggt 1716246



 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                           
Query: 2       ctaggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 45
               ||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 1716795 ctaggttaaagcgacgccgccgccgcaagccgtccgccttgctc 1716752



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                             
Query: 1025    ccaaggaggaggagaagaaggaagaacccgaggaggaatcagatgg 1070
               |||||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 1714297 ccaaggaggaagagaagaaggaagagcccgaggaggagtccgatgg 1714252



to top

>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
              clone:P0582D05
          Length = 150483

 Score =  462 bits (233), Expect = e-126
 Identities = 350/389 (89%)
 Strand = Plus / Minus

                                                                          
Query: 562    caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 621
              |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| |||
Sbjct: 114690 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgtg 114631

                                                                          
Query: 622    gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 681
              ||||| || |||||||||||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 114630 gagctcattaagaagggtgacaaggtgggctcctccgagtctgctctgcttgccaagctt 114571

                                                                          
Query: 682    ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 741
              ||||||||||||||||||||||| ||||| ||   |||||||||||||||||||||||||
Sbjct: 114570 ggtatccgccccttctcatatgggctggttattaccaatgtctatgacagtgggtcagtc 114511

                                                                          
Query: 742    ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 801
              |||||||| ||||| ||||||||||||||||| || |||||||| |||||||||||||||
Sbjct: 114510 ttcagccctgaggtgcttgacctcactgaggatgacctgatggagaagtttgcttctggt 114451

                                                                          
Query: 802    gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 861
              ||||| |||||||||||| | |||||||| ||||| ||||| || || ||||||||||| 
Sbjct: 114450 gtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctgcacca 114391

                                                                          
Query: 862    cacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagactactcg 921
              ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || ||||||
Sbjct: 114390 cacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaatactcg 114331

                                           
Query: 922    tatgaccatgctgataagatcaaggagta 950
              ||    |||||||||||||||||||||||
Sbjct: 114330 tacccacatgctgataagatcaaggagta 114302



 Score =  297 bits (150), Expect = 5e-77
 Identities = 222/246 (90%)
 Strand = Plus / Minus

                                                                          
Query: 137    cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 196
              ||||||||||||||||||||||||| ||||||||| | ||||||||| ||||||||||||
Sbjct: 116167 cgatggcgatcaagaggaccaaggcggagaagaaggtggcgtacgacaagaagctctgcc 116108

                                                                          
Query: 197    agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 256
              || | ||||| ||||||||||||||||||||||||||||||||||| ||||| ||||| |
Sbjct: 116107 agcttctcgacgagtacaccaaggtgctcatcgccgtcgccgacaacgtcgggtccaacc 116048

                                                                          
Query: 257    agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 316
              |||| ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||
Sbjct: 116047 agctgcaggagatccgcaagggcctcaggggcgactccatcgtcctcatggggaagaaca 115988

                                                                          
Query: 317    ccctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcg 376
              |||| |||||||||||||||||||||||| | || || || ||||||||||| |||||||
Sbjct: 115987 ccctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggagttcctcg 115928

                    
Query: 377    agctca 382
              ||||||
Sbjct: 115927 agctca 115922



 Score =  151 bits (76), Expect = 7e-33
 Identities = 97/104 (93%)
 Strand = Plus / Minus

                                                                          
Query: 464    aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
              ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 114879 aggttggagctcctgctcgtgttggtcttgttgctcctgttgatgtggtggttccccctg 114820

                                                          
Query: 524    gcaacactggtctggatccctcccagacgtccttcttccaggtg 567
              ||||||||||||||||||| |||||||| || ||||||||||||
Sbjct: 114819 gcaacactggtctggatccatcccagacctctttcttccaggtg 114776



 Score =  119 bits (60), Expect = 3e-23
 Identities = 66/68 (97%)
 Strand = Plus / Minus

                                                                          
Query: 400    aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 459
              ||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||
Sbjct: 115813 aacgttggcctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggttgccaag 115754

                      
Query: 460    tacaaggt 467
              ||||||||
Sbjct: 115753 tacaaggt 115746



 Score = 79.8 bits (40), Expect = 2e-11
 Identities = 43/44 (97%)
 Strand = Plus / Minus

                                                          
Query: 2      ctaggttaaagcgacgccgccgccgcaagccgtccgcctcgctc 45
              ||||||||||||||||||||||||||||||||||||||| ||||
Sbjct: 116295 ctaggttaaagcgacgccgccgccgcaagccgtccgccttgctc 116252



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 42/46 (91%)
 Strand = Plus / Minus

                                                            
Query: 1025   ccaaggaggaggagaagaaggaagaacccgaggaggaatcagatgg 1070
              |||||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 113797 ccaaggaggaagagaagaaggaagagcccgaggaggagtccgatgg 113752



to top

>gb|AC123528.2| Oryza sativa chromosome 11 clone  OSJNBa0078E03, complete sequence
          Length = 149493

 Score =  430 bits (217), Expect = e-117
 Identities = 346/389 (88%)
 Strand = Plus / Minus

                                                                        
Query: 562  caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 621
            |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||
Sbjct: 4568 caggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtg 4509

                                                                        
Query: 622  gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 681
            ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 4508 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 4449

                                                                        
Query: 682  ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 741
            ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 4448 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 4389

                                                                        
Query: 742  ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 801
            |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 4388 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 4329

                                                                        
Query: 802  gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 861
            ||||| |||||||||||| |||||||||| ||||||||||| || || |||||||| || 
Sbjct: 4328 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactattgctgctgcgcca 4269

                                                                        
Query: 862  cacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagactactcg 921
            ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || ||||| 
Sbjct: 4268 cacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaatactca 4209

                                         
Query: 922  tatgaccatgctgataagatcaaggagta 950
            ||    |||||||||||||||||||||||
Sbjct: 4208 tacccacatgctgataagatcaaggagta 4180



 Score =  278 bits (140), Expect = 5e-71
 Identities = 218/244 (89%)
 Strand = Plus / Minus

                                                                        
Query: 139  atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 198
            |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 5848 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 5789

                                                                        
Query: 199  ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 258
             | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 5788 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 5729

                                                                        
Query: 259  ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 318
            || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 5728 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 5669

                                                                        
Query: 319  ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 378
            || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 5668 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 5609

                
Query: 379  ctca 382
            ||||
Sbjct: 5608 ctca 5605



 Score =  143 bits (72), Expect = 2e-30
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                        
Query: 464  aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
            ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 4744 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 4685

                                                        
Query: 524  gcaacactggtctggatccctcccagacgtccttcttccaggtg 567
            | |||||||||||||||||||||||||| || ||||| ||||||
Sbjct: 4684 gaaacactggtctggatccctcccagacttctttctttcaggtg 4641



 Score =  119 bits (60), Expect = 3e-23
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                        
Query: 400  aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 459
            |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 5485 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 5426

                        
Query: 460  tacaaggttggc 471
            ||||||||||||
Sbjct: 5425 tacaaggttggc 5414



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                 
Query: 1025 ccaaggaggaggagaagaaggaagaacccgaggagga 1061
            |||||||||| |||||||||||||| |||||||||||
Sbjct: 3709 ccaaggaggaagagaagaaggaagagcccgaggagga 3673



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11
          Length = 28386948

 Score =  430 bits (217), Expect = e-117
 Identities = 346/389 (88%)
 Strand = Plus / Minus

                                                                           
Query: 562     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 621
               |||||||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||
Sbjct: 1648854 caggtgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtg 1648795

                                                                           
Query: 622     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 681
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1648794 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1648735

                                                                           
Query: 682     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 741
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1648734 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1648675

                                                                           
Query: 742     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 801
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 1648674 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 1648615

                                                                           
Query: 802     gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 861
               ||||| |||||||||||| |||||||||| ||||||||||| || || |||||||| || 
Sbjct: 1648614 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactattgctgctgcgcca 1648555

                                                                           
Query: 862     cacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagactactcg 921
               ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || ||||| 
Sbjct: 1648554 cacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaatactca 1648495

                                            
Query: 922     tatgaccatgctgataagatcaaggagta 950
               ||    |||||||||||||||||||||||
Sbjct: 1648494 tacccacatgctgataagatcaaggagta 1648466



 Score =  278 bits (140), Expect = 5e-71
 Identities = 218/244 (89%)
 Strand = Plus / Minus

                                                                           
Query: 139     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 198
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1650134 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1650075

                                                                           
Query: 199     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 258
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1650074 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1650015

                                                                           
Query: 259     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 318
               || ||||||||||||||||| ||| | || ||||||||||| ||||||||||||||||||
Sbjct: 1650014 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatgggcaagaacacc 1649955

                                                                           
Query: 319     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 378
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1649954 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1649895

                   
Query: 379     ctca 382
               ||||
Sbjct: 1649894 ctca 1649891



 Score =  143 bits (72), Expect = 2e-30
 Identities = 96/104 (92%)
 Strand = Plus / Minus

                                                                           
Query: 464     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
               ||||||| ||||||||||||||||| || ||||| |||||||||||||||||||||||||
Sbjct: 1649030 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggtggttccccctg 1648971

                                                           
Query: 524     gcaacactggtctggatccctcccagacgtccttcttccaggtg 567
               | |||||||||||||||||||||||||| || ||||| ||||||
Sbjct: 1648970 gaaacactggtctggatccctcccagacttctttctttcaggtg 1648927



 Score =  119 bits (60), Expect = 3e-23
 Identities = 69/72 (95%)
 Strand = Plus / Minus

                                                                           
Query: 400     aacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaag 459
               |||||||| |||||||||||||||||||||||||||||||| ||||| ||||||||||||
Sbjct: 1649771 aacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaagaggtcgccaag 1649712

                           
Query: 460     tacaaggttggc 471
               ||||||||||||
Sbjct: 1649711 tacaaggttggc 1649700



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 35/37 (94%)
 Strand = Plus / Minus

                                                    
Query: 1025    ccaaggaggaggagaagaaggaagaacccgaggagga 1061
               |||||||||| |||||||||||||| |||||||||||
Sbjct: 1647995 ccaaggaggaagagaagaaggaagagcccgaggagga 1647959



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12
          Length = 27566993

 Score =  406 bits (205), Expect = e-110
 Identities = 343/389 (88%)
 Strand = Plus / Minus

                                                                           
Query: 562     caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 621
               |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 1602065 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 1602006

                                                                           
Query: 622     gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 681
               ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 1602005 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 1601946

                                                                           
Query: 682     ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 741
               ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 1601945 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 1601886

                                                                           
Query: 742     ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 801
               |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 1601885 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 1601826

                                                                           
Query: 802     gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 861
               ||||| |||||||||||| |||||||||| ||||||||||| || || || ||||| || 
Sbjct: 1601825 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactatcgcagctgcgcca 1601766

                                                                           
Query: 862     cacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagactactcg 921
               ||||||||||||||||  ||||||||||| || || || ||| ||||||| || ||||| 
Sbjct: 1601765 cacatgttcctcaatgggtacaagaatgtgctcgctgttgctgtggagaccgaatactca 1601706

                                            
Query: 922     tatgaccatgctgataagatcaaggagta 950
               ||    |||||||| ||||||||||||||
Sbjct: 1601705 tacccacatgctgacaagatcaaggagta 1601677



 Score =  270 bits (136), Expect = 1e-68
 Identities = 217/244 (88%)
 Strand = Plus / Minus

                                                                           
Query: 139     atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 198
               |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 1603328 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 1603269

                                                                           
Query: 199     ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 258
                | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 1603268 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 1603209

                                                                           
Query: 259     ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 318
               || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 1603208 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 1603149

                                                                           
Query: 319     ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 378
               || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 1603148 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 1603089

                   
Query: 379     ctca 382
               ||||
Sbjct: 1603088 ctca 1603085



 Score =  135 bits (68), Expect = 4e-28
 Identities = 95/104 (91%)
 Strand = Plus / Minus

                                                                           
Query: 464     aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
               ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 1602242 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 1602183

                                                           
Query: 524     gcaacactggtctggatccctcccagacgtccttcttccaggtg 567
               | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 1602182 gaaacactggtctcgatccctcccagacttctttcttccaggtg 1602139



 Score =  125 bits (63), Expect = 4e-25
 Identities = 69/71 (97%)
 Strand = Plus / Minus

                                                                           
Query: 397     ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 456
               ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 1602988 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 1602929

                          
Query: 457     aagtacaaggt 467
               |||||||||||
Sbjct: 1602928 aagtacaaggt 1602918



 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 37/40 (92%)
 Strand = Plus / Minus

                                                       
Query: 1025    ccaaggaggaggagaagaaggaagaacccgaggaggaatc 1064
               |||||||||| |||||||||||||| |||||||| |||||
Sbjct: 1601202 ccaaggaggaagagaagaaggaagagcccgaggaagaatc 1601163



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 1028     aggaggaggagaagaaggaag 1048
                |||||||||||||||||||||
Sbjct: 27302645 aggaggaggagaagaaggaag 27302625



to top

>emb|Y07959.1|ZMRPP0 Z.mays mRNA for acidic ribosomal protein P0
          Length = 1253

 Score =  406 bits (205), Expect = e-110
 Identities = 286/313 (91%)
 Strand = Plus / Plus

                                                                       
Query: 386 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 445
           ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||
Sbjct: 380 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 439

                                                                       
Query: 446 aggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 505
           |||||||||||||||||||||| || ||||||||||||||||| || ||||| || ||||
Sbjct: 440 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 499

                                                                       
Query: 506 atgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccagg 565
           |||| || || ||||||||||||||||| |||||||| |||||||| || ||||||||||
Sbjct: 500 atgttgttgtgccccctggcaacactgggctggatccgtcccagacctctttcttccagg 559

                                                                       
Query: 566 tgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagc 625
           |||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||||||
Sbjct: 560 tgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtggagc 619

                                                                       
Query: 626 tgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggta 685
           |||||||||||||||| ||||||||||| ||||||||||||||||| |||||||| ||||
Sbjct: 620 tgatcaagaagggtgaaaaggtgggctcgtctgagtctgccctgctcgccaagctgggta 679

                        
Query: 686 tccgccccttctc 698
           |||||||||||||
Sbjct: 680 tccgccccttctc 692



 Score =  182 bits (92), Expect = 2e-42
 Identities = 203/240 (84%)
 Strand = Plus / Plus

                                                                       
Query: 732 tgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtt 791
           |||||| || |||||||| ||||| ||||||||  | ||||| || ||||| || |||||
Sbjct: 726 tgggtccgtgttcagccctgaggtgcttgacctttccgaggaggacctgattgagaagtt 785

                                                                       
Query: 792 tgcttctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggc 851
           |||  ||||||| |||||||||||||| ||||| ||||||||||| ||||| ||| | ||
Sbjct: 786 tgccactggtgtctccatggttgcctccctgtcactggcgatctcgtacccgacccttgc 845

                                                                       
Query: 852 tgctgcaccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagac 911
           |||||  || ||||||||| ||||||  ||||||||||| ||||| || ||| | |||||
Sbjct: 846 tgctgtgccccacatgttcatcaatgggtacaagaatgtgcttgctgttgctgtcgagac 905

                                                                       
Query: 912 agactactcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
           ||||||||||||    |||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 906 agactactcgtacccacatgctgacaagatcaaggagtacctcaaggacccaagcaagtt 965



 Score =  174 bits (88), Expect = 5e-40
 Identities = 187/220 (85%)
 Strand = Plus / Plus

                                                                       
Query: 137 cgatggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgcc 196
           |||||||||||||| |||| ||||| ||||||||||||||||||||| ||||||| ||| 
Sbjct: 131 cgatggcgatcaagcggactaaggcggagaagaagatcgcgtacgacaagaagctgtgca 190

                                                                       
Query: 197 agttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagc 256
              ||||||| |||||||||||||||||||||||| | |||||||| ||||| |||||||
Sbjct: 191 gcctgctcgatgagtacaccaaggtgctcatcgccctggccgacaacgtcggttccaagc 250

                                                                       
Query: 257 agctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaaca 316
           |||||||||| ||||||  ||| ||| | || |||||  | ||||||||||| |||||||
Sbjct: 251 agctccaggacatccgccggggcctcaggggcgactcggtggtgctcatggggaagaaca 310

                                                   
Query: 317 ccctgatccgccgctgcatcaaggtgcactcggagaagac 356
           | || ||| | || |||||||||||| || | ||||||||
Sbjct: 311 cgctcatcaggcgttgcatcaaggtgtacgccgagaagac 350



 Score = 73.8 bits (37), Expect = 1e-09
 Identities = 37/37 (100%)
 Strand = Plus / Plus

                                               
Query: 4  aggttaaagcgacgccgccgccgcaagccgtccgcct 40
          |||||||||||||||||||||||||||||||||||||
Sbjct: 2  aggttaaagcgacgccgccgccgcaagccgtccgcct 38



to top

>emb|BX000498.1|CNS08CDO Oryza sativa chromosome 12, . BAC OSJNBa0009F13 of library OSJNBa from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 183385

 Score =  406 bits (205), Expect = e-110
 Identities = 343/389 (88%)
 Strand = Plus / Plus

                                                                         
Query: 562   caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 621
             |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 23667 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 23726

                                                                         
Query: 622   gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 681
             ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 23727 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 23786

                                                                         
Query: 682   ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 741
             ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 23787 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 23846

                                                                         
Query: 742   ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 801
             |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 23847 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 23906

                                                                         
Query: 802   gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 861
             ||||| |||||||||||| |||||||||| ||||||||||| || || || ||||| || 
Sbjct: 23907 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactatcgcagctgcgcca 23966

                                                                         
Query: 862   cacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagactactcg 921
             ||||||||||||||||  ||||||||||| || || || ||| ||||||| || ||||| 
Sbjct: 23967 cacatgttcctcaatgggtacaagaatgtgctcgctgttgctgtggagaccgaatactca 24026

                                          
Query: 922   tatgaccatgctgataagatcaaggagta 950
             ||    |||||||| ||||||||||||||
Sbjct: 24027 tacccacatgctgacaagatcaaggagta 24055



 Score =  270 bits (136), Expect = 1e-68
 Identities = 217/244 (88%)
 Strand = Plus / Plus

                                                                         
Query: 139   atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 198
             |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 22404 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 22463

                                                                         
Query: 199   ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 258
              | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 22464 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 22523

                                                                         
Query: 259   ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 318
             || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 22524 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 22583

                                                                         
Query: 319   ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 378
             || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 22584 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 22643

                 
Query: 379   ctca 382
             ||||
Sbjct: 22644 ctca 22647



 Score =  135 bits (68), Expect = 4e-28
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                         
Query: 464   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
             ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 23490 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 23549

                                                         
Query: 524   gcaacactggtctggatccctcccagacgtccttcttccaggtg 567
             | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 23550 gaaacactggtctcgatccctcccagacttctttcttccaggtg 23593



 Score =  125 bits (63), Expect = 4e-25
 Identities = 69/71 (97%)
 Strand = Plus / Plus

                                                                         
Query: 397   ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 456
             ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 22744 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 22803

                        
Query: 457   aagtacaaggt 467
             |||||||||||
Sbjct: 22804 aagtacaaggt 22814



 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 1025  ccaaggaggaggagaagaaggaagaacccgaggaggaatc 1064
             |||||||||| |||||||||||||| |||||||| |||||
Sbjct: 24530 ccaaggaggaagagaagaaggaagagcccgaggaagaatc 24569



to top

>emb|BX000508.1|CNS08CDY Oryza sativa chromosome 12, . BAC OJ1575_G05 of library Monsanto from
             chromosome 12 of cultivar Nipponbare of ssp. japonica of
             Oryza sativa (rice), complete sequence
          Length = 91883

 Score =  406 bits (205), Expect = e-110
 Identities = 343/389 (88%)
 Strand = Plus / Plus

                                                                         
Query: 562   caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 621
             |||||||||||||| |||||||||||||||||||||||||||||||||| || ||| || 
Sbjct: 90857 caggtgcttaacatccccaccaagattaacaagggtactgtggaaattatcacccctgta 90916

                                                                         
Query: 622   gagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagctt 681
             ||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 90917 gagctcattaagaagggtgacaaggttggctcctctgagtctgccctgcttgccaagctt 90976

                                                                         
Query: 682   ggtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtc 741
             ||||||||||||||||||||||| ||||| |||  |||||| || |||||||||||||||
Sbjct: 90977 ggtatccgccccttctcatatgggctggtgatcaccaatgtgtacgacagtgggtcagtc 91036

                                                                         
Query: 742   ttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggt 801
             |||||||| ||||| || ||||||||||| || || |||||||| |||||||| ||||||
Sbjct: 91037 ttcagccctgaggtgctcgacctcactgaagaggacctgatggagaagtttgcatctggt 91096

                                                                         
Query: 802   gtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccg 861
             ||||| |||||||||||| |||||||||| ||||||||||| || || || ||||| || 
Sbjct: 91097 gtttcgatggttgcctcagtgtccctggcaatctcatacccaactatcgcagctgcgcca 91156

                                                                         
Query: 862   cacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagactactcg 921
             ||||||||||||||||  ||||||||||| || || || ||| ||||||| || ||||| 
Sbjct: 91157 cacatgttcctcaatgggtacaagaatgtgctcgctgttgctgtggagaccgaatactca 91216

                                          
Query: 922   tatgaccatgctgataagatcaaggagta 950
             ||    |||||||| ||||||||||||||
Sbjct: 91217 tacccacatgctgacaagatcaaggagta 91245



 Score =  270 bits (136), Expect = 1e-68
 Identities = 217/244 (88%)
 Strand = Plus / Plus

                                                                         
Query: 139   atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 198
             |||||||||||| |||||||||| ||||||||| | ||||||||| ||||||| ||||||
Sbjct: 89594 atggcgatcaagcggaccaaggcggagaagaaggtggcgtacgacaagaagctgtgccag 89653

                                                                         
Query: 199   ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 258
              | || || ||||||||||||||||||||||||||||||||||| || || ||||| |||
Sbjct: 89654 cttctggacgagtacaccaaggtgctcatcgccgtcgccgacaacgtgggatccaaccag 89713

                                                                         
Query: 259   ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 318
             || ||||||||||||||||| ||| | || ||||||||||| |||||||| |||||||||
Sbjct: 89714 ctgcaggagatccgcaaggggctcaggggcgactccatcgtcctcatggggaagaacacc 89773

                                                                         
Query: 319   ctgatccgccgctgcatcaaggtgcactcggagaagactggcaacaaggacttcctcgag 378
             || |||||||||||||||||||||||| | || || || |||||||||||||||||||||
Sbjct: 89774 ctcatccgccgctgcatcaaggtgcacgccgacaacaccggcaacaaggacttcctcgag 89833

                 
Query: 379   ctca 382
             ||||
Sbjct: 89834 ctca 89837



 Score =  135 bits (68), Expect = 4e-28
 Identities = 95/104 (91%)
 Strand = Plus / Plus

                                                                         
Query: 464   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
             ||||||| ||||||||||||||||| || ||||| |||||||||||||| ||||||||||
Sbjct: 90680 aggttggagctcctgctcgtgttggtctggttgctcctgttgatgtggttgttccccctg 90739

                                                         
Query: 524   gcaacactggtctggatccctcccagacgtccttcttccaggtg 567
             | ||||||||||| |||||||||||||| || ||||||||||||
Sbjct: 90740 gaaacactggtctcgatccctcccagacttctttcttccaggtg 90783



 Score =  125 bits (63), Expect = 4e-25
 Identities = 69/71 (97%)
 Strand = Plus / Plus

                                                                         
Query: 397   ggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgcc 456
             ||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||
Sbjct: 89934 ggtaacgttggtctcatcttcaccaagggtgacctcaaggaggtccgcgaggaggtcgcc 89993

                        
Query: 457   aagtacaaggt 467
             |||||||||||
Sbjct: 89994 aagtacaaggt 90004



 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                     
Query: 1025  ccaaggaggaggagaagaaggaagaacccgaggaggaatc 1064
             |||||||||| |||||||||||||| |||||||| |||||
Sbjct: 91720 ccaaggaggaagagaagaaggaagagcccgaggaagaatc 91759



to top

>gb|BT016531.1| Zea mays clone Contig364 mRNA sequence
          Length = 1230

 Score =  398 bits (201), Expect = e-107
 Identities = 285/313 (91%)
 Strand = Plus / Plus

                                                                       
Query: 386 acctcctcgtcggtaacgttggcctcatcttcaccaagggtgacctcaaggaggttcgcg 445
           ||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||| ||||
Sbjct: 361 acctcctggtcggcaacgtaggcctcatcttcaccaagggagacctcaaggaggtgcgcg 420

                                                                       
Query: 446 aggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttg 505
           |||||||||||||||||||||| || ||||||||||||||||| || ||||| || ||||
Sbjct: 421 aggaggtcgccaagtacaaggtgggggctcctgctcgtgttggtctggttgctccagttg 480

                                                                       
Query: 506 atgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttccagg 565
           |||| || || ||||||||||||||||| |||||||| |||||||| || ||||||||||
Sbjct: 481 atgttgttgtgccccctggcaacactgggctggatccgtcccagacctctttcttccagg 540

                                                                       
Query: 566 tgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtggagc 625
           |||||||||| ||||||||||||||||||||||| |||||||||| || ||| |||||||
Sbjct: 541 tgcttaacatccccaccaagattaacaagggtaccgtggaaattatcacccctgtggagc 600

                                                                       
Query: 626 tgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggta 685
           |||||||||||||||| ||||||||||| || |||||||||||||| |||||||| ||||
Sbjct: 601 tgatcaagaagggtgaaaaggtgggctcgtccgagtctgccctgctcgccaagctgggta 660

                        
Query: 686 tccgccccttctc 698
           |||||||||||||
Sbjct: 661 tccgccccttctc 673



 Score =  194 bits (98), Expect = 5e-46
 Identities = 188/218 (86%)
 Strand = Plus / Plus

                                                                       
Query: 139 atggcgatcaagaggaccaaggccgagaagaagatcgcgtacgaccagaagctctgccag 198
           |||||||||||| |||||||||| ||||||||||||||||||||| ||||||| |||   
Sbjct: 114 atggcgatcaagcggaccaaggcggagaagaagatcgcgtacgacaagaagctgtgcagc 173

                                                                       
Query: 199 ttgctcgaggagtacaccaaggtgctcatcgccgtcgccgacaatgtcggctccaagcag 258
            ||||||| |||||||||||||||||||||||| |||||||||| ||||| |||||||||
Sbjct: 174 ctgctcgatgagtacaccaaggtgctcatcgccctcgccgacaacgtcggttccaagcag 233

                                                                       
Query: 259 ctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaacacc 318
           |||||||| ||||||  ||| ||| | || |||||  | ||||||||||| |||||||| 
Sbjct: 234 ctccaggacatccgccggggcctcaggggcgactcggtggtgctcatggggaagaacacg 293

                                                 
Query: 319 ctgatccgccgctgcatcaaggtgcactcggagaagac 356
           || ||| | ||||||||||||||| || | ||||||||
Sbjct: 294 ctcatcaggcgctgcatcaaggtgtacgccgagaagac 331



 Score =  174 bits (88), Expect = 5e-40
 Identities = 202/240 (84%)
 Strand = Plus / Plus

                                                                       
Query: 732 tgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtt 791
           |||||| || |||||||| ||||| || |||||  ||||||| || ||||| || |||||
Sbjct: 707 tgggtccgtgttcagccctgaggtgctcgacctttctgaggaggacctgattgagaagtt 766

                                                                       
Query: 792 tgcttctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggc 851
           |||  ||||||| |||||||||||||| ||||| ||||||||||| ||||| ||| | ||
Sbjct: 767 tgccactggtgtctccatggttgcctccctgtcactggcgatctcgtacccgacccttgc 826

                                                                       
Query: 852 tgctgcaccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagac 911
           |||||  || ||||||||| ||||||  ||||||||||| ||||| || ||| | |||||
Sbjct: 827 tgctgtgccccacatgttcatcaatgggtacaagaatgtgcttgctgttgctgtcgagac 886

                                                                       
Query: 912 agactactcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
           ||||||||| ||    |||||||| |||||||||||||||||||||||||| ||||||||
Sbjct: 887 agactactcatacccacatgctgacaagatcaaggagtacctcaaggacccaagcaagtt 946



to top

>emb|CT983947.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 834

 Score =  303 bits (153), Expect = 8e-79
 Identities = 399/479 (83%), Gaps = 4/479 (0%)
 Strand = Plus / Plus

                                                                       
Query: 415 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 474
           ||||||||||||||| | ||||| ||  | || ||||| ||||||||||||||||| |||
Sbjct: 74  ttcaccaagggtgacttgaaggaagtcagtgaagaggttgccaagtacaaggttggagct 133

                                                                       
Query: 475 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 534
           ||||||||||| ||  | ||||| ||  |||||||  | || || || ||||||||||| 
Sbjct: 134 cctgctcgtgtgggtttggttgctccaattgatgtcatcgtcccaccgggcaacactggg 193

                                                                       
Query: 535 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 594
           || || || || ||||| ||||||||||||||||| |||||||| |||||||||||||||
Sbjct: 194 ctcgacccttctcagacttccttcttccaggtgctcaacattccaaccaagattaacaag 253

                                                                       
Query: 595 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggctcc 654
           |||||||||||||||| || ||| || ||||| |||||||||||||||||||| ||||| 
Sbjct: 254 ggtactgtggaaattatcacccctgttgagcttatcaagaagggtgacaaggttggctct 313

                                                                       
Query: 655 tctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtcatc 714
           |||||| ||||||| ||||| |||||||| ||| | |||||||| ||||| || ||  | 
Sbjct: 314 tctgaggctgcccttcttgctaagcttgggatcaggcccttctcgtatggtctcgt--tg 371

                                                                       
Query: 715 tgcaa--tgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgagg 772
           |||||  ||| ||||||| |||||| ||||||||||| ||||| || ||||| |||||||
Sbjct: 372 tgcaaagtgtttatgacaatgggtcggtcttcagcccagaggtgctcgaccttactgagg 431

                                                                       
Query: 773 aagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcga 832
           | || || ||||| |||||||||  |||||| || |||||  |  | || || || || |
Sbjct: 432 atgacctcatggagaagtttgctcttggtgtctctatggtcacagctctctcgcttgcca 491

                                                                      
Query: 833 tctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 891
           |||||||||| ||| ||||||| ||||||||||||||| ||||||| ||||||||||||
Sbjct: 492 tctcatacccgaccctggctgccgcaccgcacatgttcatcaatgcctacaagaatgtt 550



to top

>gb|L46848.1|SOYARPP Glycine max acidic ribosomal protein P0 mRNA, complete cds
          Length = 1247

 Score =  250 bits (126), Expect = 1e-62
 Identities = 393/482 (81%)
 Strand = Plus / Plus

                                                                       
Query: 415 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 474
           ||||||||||||||||| ||||||||  | |||||||| || |||||||||||||| |||
Sbjct: 404 ttcaccaagggtgacctgaaggaggtcagtgaggaggttgctaagtacaaggttggagct 463

                                                                       
Query: 475 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 534
           ||||||||||||||  | ||||| ||  ||||||| || ||||| ||||||||||| || 
Sbjct: 464 cctgctcgtgttggtttggttgctccaattgatgtcgttgttcctcctggcaacacaggg 523

                                                                       
Query: 535 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 594
           || |||||||| ||||| || ||||||||||||||||||||||| |||||||||||||||
Sbjct: 524 ctcgatccctctcagacctctttcttccaggtgcttaacattcctaccaagattaacaag 583

                                                                       
Query: 595 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggctcc 654
           |||||||||||||| |  |  || ||||| || || | |||||| |||||||| || || 
Sbjct: 584 ggtactgtggaaatcattacacctgtggaactcattaggaagggagacaaggttggatct 643

                                                                       
Query: 655 tctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtcatc 714
           |||||  ||||  ||||||||||||| || ||  | |||||||||||||| || ||  | 
Sbjct: 644 tctgaagctgcattgcttgccaagctaggcataaggcccttctcatatgggcttgtggtt 703

                                                                       
Query: 715 tgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgaggaa 774
             |   || ||||| | ||| ||||| |||||||| ||||||||||| || |||||||| 
Sbjct: 704 ctctccgtttatgataatggttcagtgttcagccctgaggttcttgatcttactgaggat 763

                                                                       
Query: 775 gatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcgatc 834
           ||||| || |  ||||||||| ||||||| || |||||| | ||||| ||  |||| || 
Sbjct: 764 gatctcattgggaagtttgctgctggtgtctcaatggttacttcactttcattggctatt 823

                                                                       
Query: 835 tcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgttctt 894
           ||||| || ||  | ||||| ||||| ||||||||  ||||||| |||||||||||||||
Sbjct: 824 tcatatccaacacttgctgcagcaccacacatgtttgtcaatgcctacaagaatgttctt 883

             
Query: 895 gc 896
           ||
Sbjct: 884 gc 885



 Score = 48.1 bits (24), Expect = 0.078
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                       
Query: 256 cagctccaggagatccgcaagggtctccgcggtgactccatcgtgctcatgggcaagaac 315
           ||||||||| | || ||||||||||| ||||| |||||  | || |||||||| ||||||
Sbjct: 245 cagctccagaacattcgcaagggtcttcgcggcgactctgttgtcctcatggggaagaac 304

                   
Query: 316 accctgat 323
           ||| ||||
Sbjct: 305 accatgat 312



 Score = 48.1 bits (24), Expect = 0.078
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                        
Query: 1025 ccaaggaggaggagaagaaggaagaacc 1052
            ||||||||||||| ||||||||||||||
Sbjct: 1017 ccaaggaggaggaaaagaaggaagaacc 1044



 Score = 44.1 bits (22), Expect = 1.2
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 153 gaccaaggccgagaagaagatcgcgtacga 182
           ||||||||| |||||||||||||| |||||
Sbjct: 142 gaccaaggctgagaagaagatcgcttacga 171



to top

>ref|NM_111754.2| Arabidopsis thaliana structural constituent of ribosome (AT3G09200)
           mRNA, complete cds
          Length = 1307

 Score =  234 bits (118), Expect = 6e-58
 Identities = 388/478 (81%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 401 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 460

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 461 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 520

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 521 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 580

                                                                       
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 711
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 581 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 640

                                                                       
Query: 712 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 771
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 641 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 700

                                                                       
Query: 772 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 831
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 701 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 760

                                                                     
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 889
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 761 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 818



to top

>gb|AY059117.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 994

 Score =  234 bits (118), Expect = 6e-58
 Identities = 388/478 (81%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 271 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 330

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 331 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 390

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 391 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 450

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 451 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 510

                                                                       
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 711
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 511 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 570

                                                                       
Query: 712 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 771
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 571 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 630

                                                                       
Query: 772 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 831
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 631 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 690

                                                                     
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 889
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 691 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 748



to top

>gb|AF370225.1| Arabidopsis thaliana putative 60S acidic ribosomal protein P0
           (At3g09200) mRNA, complete cds
          Length = 1160

 Score =  234 bits (118), Expect = 6e-58
 Identities = 388/478 (81%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 341 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 400

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 401 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 460

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 461 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 520

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 521 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 580

                                                                       
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 711
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 581 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 640

                                                                       
Query: 712 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 771
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 641 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 700

                                                                       
Query: 772 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 831
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 701 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 760

                                                                     
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 889
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 761 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 818



to top

>emb|BX823923.1|CNS0A6KD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS92ZG11 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1136

 Score =  234 bits (118), Expect = 6e-58
 Identities = 388/478 (81%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           ||||| ||||| |||||||||||||| ||  |||||||||| || |||||||||||||| 
Sbjct: 308 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggttggt 367

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 368 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 427

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 428 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 487

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 488 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 547

                                                                       
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 711
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 548 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 607

                                                                       
Query: 712 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 771
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 608 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 667

                                                                       
Query: 772 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 831
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 668 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 727

                                                                     
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 889
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 728 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 785



to top

>dbj|AB091076.1| Zinnia elegans ZeRPP0 mRNA for putative 60S acidic ribosomal
           protein P0, partial cds
          Length = 820

 Score =  234 bits (118), Expect = 6e-58
 Identities = 220/254 (86%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| ||||||||| | ||||||||||| || ||||| || ||||||||||| || 
Sbjct: 481 atcttcacaaagggtgacttgaaggaggttcgtgaagaggttgctaagtacaaggtcgga 540

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||| ||  | || || || ||||||||||| || || ||||||||||||
Sbjct: 541 gcacctgctcgtgtcggtttggtggctccagttgatgtggttgtccctcctggcaacact 600

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || ||||| || ||||||||||||||||||||||||||||||||||||
Sbjct: 601 ggtcttgacccatctcagacctctttcttccaggtgcttaacattcccaccaagattaac 660

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           ||||||||||| ||||||| || |||||||||||| ||||||||||||||||| ||||| 
Sbjct: 661 aagggtactgttgaaattatcaccccagtggagcttatcaagaagggtgacaaagtgggt 720

                         
Query: 652 tcctctgagtctgc 665
           || |||||| ||||
Sbjct: 721 tcatctgaggctgc 734



 Score = 52.0 bits (26), Expect = 0.005
 Identities = 38/42 (90%)
 Strand = Plus / Plus

                                                     
Query: 157 aaggccgagaagaagatcgcgtacgaccagaagctctgccag 198
           ||||| || ||||||||||| ||||| |||||||||||||||
Sbjct: 226 aaggctgataagaagatcgcttacgatcagaagctctgccag 267



to top

>ref|NM_111960.2| Arabidopsis thaliana structural constituent of ribosome (AT3G11250)
           mRNA, complete cds
          Length = 1239

 Score =  230 bits (116), Expect = 1e-56
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 364 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 423

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 424 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 483

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 484 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 543

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 544 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 603

                                           
Query: 652 tcctctgagtctgccctgcttgccaagcttgg 683
           || |||||| ||||||| || || ||||||||
Sbjct: 604 tcttctgaggctgcccttctagctaagcttgg 635



 Score = 50.1 bits (25), Expect = 0.020
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 853 gctgcaccgcacatgttcctcaatgcatacaagaatg 889
           ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 805 gctgcaccgcatatgttcatcaatgcctacaagaatg 841



to top

>gb|AY091201.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1003

 Score =  230 bits (116), Expect = 1e-56
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 271 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 330

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 331 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 390

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 391 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 450

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 451 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 510

                                           
Query: 652 tcctctgagtctgccctgcttgccaagcttgg 683
           || |||||| ||||||| || || ||||||||
Sbjct: 511 tcttctgaggctgcccttctagctaagcttgg 542



 Score = 50.1 bits (25), Expect = 0.020
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 853 gctgcaccgcacatgttcctcaatgcatacaagaatg 889
           ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 712 gctgcaccgcatatgttcatcaatgcctacaagaatg 748



to top

>gb|AY056150.1| Arabidopsis thaliana putative 60S acidic ribosomal protein
           (At3g11250) mRNA, complete cds
          Length = 1174

 Score =  230 bits (116), Expect = 1e-56
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 334 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 393

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 394 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 453

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 454 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 513

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 514 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 573

                                           
Query: 652 tcctctgagtctgccctgcttgccaagcttgg 683
           || |||||| ||||||| || || ||||||||
Sbjct: 574 tcttctgaggctgcccttctagctaagcttgg 605



 Score = 50.1 bits (25), Expect = 0.020
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 853 gctgcaccgcacatgttcctcaatgcatacaagaatg 889
           ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 775 gctgcaccgcatatgttcatcaatgcctacaagaatg 811



to top

>gb|AY087728.1| Arabidopsis thaliana clone 38036 mRNA, complete sequence
          Length = 1185

 Score =  230 bits (116), Expect = 1e-56
 Identities = 233/272 (85%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| || ||||| |||||||| ||  |||||||||| ||||| ||||||||||| 
Sbjct: 311 atcttcactaaaggtgatctcaaggaagtgagcgaggaggttgccaaatacaaggttggt 370

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||||||||||
Sbjct: 371 gctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctggcaacact 430

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || || || || |||||||||||||||||||||||||| |||||||||
Sbjct: 431 ggtcttgacccatctcaaacatcgttcttccaggtgcttaacattcccactaagattaac 490

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           ||||||||||| ||||||| || ||| |||||||| |||||| | ||||||||||| || 
Sbjct: 491 aagggtactgttgaaattatcacccctgtggagcttatcaagcaaggtgacaaggttggg 550

                                           
Query: 652 tcctctgagtctgccctgcttgccaagcttgg 683
           || |||||| ||||||| || || ||||||||
Sbjct: 551 tcttctgaggctgcccttctagctaagcttgg 582



 Score = 50.1 bits (25), Expect = 0.020
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 853 gctgcaccgcacatgttcctcaatgcatacaagaatg 889
           ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 752 gctgcaccgcatatgttcatcaatgcctacaagaatg 788



to top

>gb|DQ235176.1| Solanum tuberosum clone 156H10 P0 ribosomal protein-like mRNA,
           complete cds
          Length = 1254

 Score =  228 bits (115), Expect = 4e-56
 Identities = 316/383 (82%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||||||||||||||||||||| ||  | ||||| ||||| |||||||||||||| 
Sbjct: 437 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 496

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||||||  | || || || |||||||| || || || ||||| ||||||
Sbjct: 497 gcacctgctcgtgttggtttggtggctccagttgatgttgttgtccctcctggtaacact 556

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| ||||| || ||||| || |||||||||||||| ||||| || || |||||||||
Sbjct: 557 ggtcttgatccatctcagacctctttcttccaggtgctcaacatcccaactaagattaac 616

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           ||||||||||| ||||||| ||  || || || || ||||||||||||||||| || || 
Sbjct: 617 aagggtactgttgaaattatcactcctgttgaactcatcaagaagggtgacaaagttggt 676

                                                                       
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 711
           ||||||||  |||||||||||||||| ||||| ||  | || ||||||||||| || || 
Sbjct: 677 tcctctgaagctgccctgcttgccaaacttggaattaggccattctcatatggtcttgtt 736

                                                                       
Query: 712 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 771
            |   |  ||| || |||| ||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 737 gttgtctctgtttacgacaatggatccgtcttcagccctgaggttcttgacctgactgag 796

                                  
Query: 772 gaagatctgatggacaagtttgc 794
           || ||||| || || ||||||||
Sbjct: 797 gatgatctcattgagaagtttgc 819



 Score = 48.1 bits (24), Expect = 0.078
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1027 aaggaggaggagaagaaggaagaacccgaggaggaatcagatggcgagatgggattcagt 1086
            ||||||||||||||||||||||| || |  ||||  |||||||  || ||||| ||||||
Sbjct: 1055 aaggaggaggagaagaaggaagagcctgctgaggtctcagatgatgacatgggtttcagt 1114

                    
Query: 1087 ctgtttga 1094
             |||||||
Sbjct: 1115 ttgtttga 1122



to top

>gb|DQ241840.1| Solanum tuberosum clone 181G12 P0 ribosomal protein-like mRNA,
           complete cds
          Length = 1253

 Score =  228 bits (115), Expect = 4e-56
 Identities = 316/383 (82%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||||||||||||||||||||| ||  | ||||| ||||| |||||||||||||| 
Sbjct: 415 atcttcaccaagggtgacctcaaggaagtgagtgaggaagtcgcaaagtacaaggttgga 474

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||||||  | || || || |||||||| || || || ||||| ||||||
Sbjct: 475 gcacctgctcgtgttggtttggtggctccagttgatgttgttgtccctcctggtaacact 534

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| ||||| || ||||| || |||||||||||||| ||||| || || |||||||||
Sbjct: 535 ggtcttgatccatctcagacctctttcttccaggtgctcaacatcccaactaagattaac 594

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           ||||||||||| ||||||| ||  || || || || ||||||||||||||||| || || 
Sbjct: 595 aagggtactgttgaaattatcactcctgttgaactcatcaagaagggtgacaaagttggt 654

                                                                       
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 711
           ||||||||  |||||||||||||||| ||||| ||  | || ||||||||||| || || 
Sbjct: 655 tcctctgaagctgccctgcttgccaaacttggaattaggccattctcatatggtcttgtt 714

                                                                       
Query: 712 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 771
            |   |  ||| || |||| ||| || ||||||||||| |||||||||||||| ||||||
Sbjct: 715 gttgtctctgtttacgacaatggatccgtcttcagccctgaggttcttgacctgactgag 774

                                  
Query: 772 gaagatctgatggacaagtttgc 794
           || ||||| || || ||||||||
Sbjct: 775 gatgatctcattgagaagtttgc 797



 Score = 48.1 bits (24), Expect = 0.078
 Identities = 57/68 (83%)
 Strand = Plus / Plus

                                                                        
Query: 1027 aaggaggaggagaagaaggaagaacccgaggaggaatcagatggcgagatgggattcagt 1086
            ||||||||||||||||||||||| || |  ||||  |||||||  || ||||| ||||||
Sbjct: 1033 aaggaggaggagaagaaggaagagcctgctgaggtctcagatgatgacatgggtttcagt 1092

                    
Query: 1087 ctgtttga 1094
             |||||||
Sbjct: 1093 ttgtttga 1100



to top

>gb|BT018921.1| Zea mays clone Contig30.F mRNA sequence
          Length = 820

 Score =  226 bits (114), Expect = 2e-55
 Identities = 167/182 (91%), Gaps = 2/182 (1%)
 Strand = Plus / Plus

                                                                       
Query: 517 ccccctggcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacatt 576
           ||||||||||||||||| ||||||||||||||||| || |||||| ||||||| ||||| 
Sbjct: 14  ccccctggcaacactgggctggatccctcccagacctctttcttc-aggtgct-aacatc 71

                                                                       
Query: 577 cccaccaagattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaag 636
           |||||||||||||||||||||||||||||||||| || ||| ||||||||||||||||||
Sbjct: 72  cccaccaagattaacaagggtactgtggaaattatcacccctgtggagctgatcaagaag 131

                                                                       
Query: 637 ggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatccgccccttc 696
           ||||| ||||||||||| || |||||||||||||| |||||||| || ||||||||||||
Sbjct: 132 ggtgagaaggtgggctcgtccgagtctgccctgctcgccaagctgggcatccgccccttc 191

             
Query: 697 tc 698
           ||
Sbjct: 192 tc 193



 Score =  111 bits (56), Expect = 6e-21
 Identities = 194/240 (80%)
 Strand = Plus / Plus

                                                                       
Query: 732 tgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtt 791
           |||||| || |||||||| ||||| ||||||||  ||||||| || || || || |||||
Sbjct: 227 tgggtctgtgttcagccctgaggtgcttgacctttctgaggaggacctaatcgagaagtt 286

                                                                       
Query: 792 tgcttctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggc 851
            ||  ||||||| |||||||| || || || ||||||||  | || ||||| ||| | ||
Sbjct: 287 cgccactggtgtctccatggtcgcttctctttccctggcattatcgtacccgacccttgc 346

                                                                       
Query: 852 tgctgcaccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagac 911
           |||||  || ||||||||  ||||||  |||||||| || ||||| || ||| |||||||
Sbjct: 347 tgctgtgccccacatgtttatcaatgggtacaagaacgtgcttgctgttgctgtggagac 406

                                                                       
Query: 912 agactactcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
            |||||||||||    || || || |||||||||||||||||||||||||||||||||||
Sbjct: 407 ggactactcgtacccacacgccgacaagatcaaggagtacctcaaggacccgagcaagtt 466



to top

>gb|AY086582.1| Arabidopsis thaliana clone 2595 mRNA, complete sequence
          Length = 1199

 Score =  226 bits (114), Expect = 2e-55
 Identities = 387/478 (80%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||| || 
Sbjct: 339 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtcggt 398

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 399 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 458

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 459 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 518

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 519 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 578

                                                                       
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 711
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 579 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 638

                                                                       
Query: 712 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 771
            ||     ||||||||||| ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 639 gtccagtctgtctatgacaatggctcagtcttcagcccagaggttcttgatcttactgaa 698

                                                                       
Query: 772 gaagatctgatggacaagtttgcttctggtgtttccatggttgcctcactgtccctggcg 831
           ||  | ||  |||| ||||||||||||||| | ||||||||  | ||  || | || || 
Sbjct: 699 gaccaacttgtggagaagtttgcttctggtatctccatggtcacttccttggctcttgct 758

                                                                     
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatg 889
            | || ||||| ||| | |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 759 gtgtcgtaccctacccttgctgctgcaccgcatatgttcatcaatgcgtacaagaatg 816



to top

>emb|BX824039.1|CNS0A6RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH17ZF06 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1185

 Score =  224 bits (113), Expect = 6e-55
 Identities = 329/401 (82%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           ||||| ||||| |||||||||||||| ||| |||||||||| || |||||||||||||| 
Sbjct: 325 atctttaccaaaggtgacctcaaggaagttagcgaggaggttgctaagtacaaggttggt 384

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||| ||  | || || ||  |||||||||| || |  ||||||||||||
Sbjct: 385 gcccctgctcgtgtgggtttggtggctccaattgatgtggttgtccaacctggcaacact 444

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || ||||| || || |||||||||||||||||||| || ||||||||||||
Sbjct: 445 ggtctcgacccatcccaaacatctttcttccaggtgcttaacatcccaaccaagattaac 504

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           |||||||| || ||||| | || |||||| ||||| |||||| | ||||||||||| || 
Sbjct: 505 aagggtaccgtcgaaatcatcaccccagttgagcttatcaagcaaggtgacaaggtcggg 564

                                                                       
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatggactggtc 711
           || |||||| |||| || || ||||||||||| ||| | || ||||||||||| || || 
Sbjct: 565 tcttctgaggctgcgcttctagccaagcttggcatcaggccgttctcatatggtcttgtt 624

                                                                       
Query: 712 atctgcaatgtctatgacagtgggtcagtcttcagccccgaggttcttgacctcactgag 771
            ||     ||||||||| | ||| |||||||||||||| ||||||||||| || ||||| 
Sbjct: 625 gtccagtctgtctatgaaaatggctcagtcttcagcccagaggttcttgatcttactgaa 684

                                                    
Query: 772 gaagatctgatggacaagtttgcttctggtgtttccatggt 812
           ||  | ||  |||| ||||||||||||||| | ||||||||
Sbjct: 685 gaccaacttgtggagaagtttgcttctggtatctccatggt 725



 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 37/40 (92%)
 Strand = Plus / Plus

                                                   
Query: 850 gctgctgcaccgcacatgttcctcaatgcatacaagaatg 889
           |||||||||||||| |||||| ||||||| ||||||||||
Sbjct: 763 gctgctgcaccgcatatgttcatcaatgcgtacaagaatg 802



to top

>gb|AF227622.1|AF227622 Euphorbia esula 60S acidic ribosomal protein PO mRNA, partial cds
          Length = 1127

 Score =  198 bits (100), Expect = 3e-47
 Identities = 220/260 (84%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           ||||||||||||||||| |||||||| ||  | || ||||| ||||||||||||||||| 
Sbjct: 265 atcttcaccaagggtgatctcaaggaagtcagtgaagaggttgccaagtacaaggttgga 324

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           || ||||||||||||||  | ||||| ||  |||||||||| || || ||||||||||| 
Sbjct: 325 gcccctgctcgtgttggtttggttgctccaattgatgtggttgtcccacctggcaacaca 384

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           || || || || |||||||| || ||||||||||| ||||||||||| ||||||||||||
Sbjct: 385 gggctcgacccttcccagacctctttcttccaggtccttaacattcctaccaagattaac 444

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           ||||| || || ||||| | || ||| ||||| || ||||||||||| ||||||||||||
Sbjct: 445 aagggaacagtcgaaatcatcacccctgtggaactaatcaagaagggagacaaggtgggc 504

                               
Query: 652 tcctctgagtctgccctgct 671
           ||||| ||| ||||| ||||
Sbjct: 505 tcctccgaggctgccttgct 524



 Score = 44.1 bits (22), Expect = 1.2
 Identities = 49/58 (84%)
 Strand = Plus / Plus

                                                                     
Query: 833 tctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgt 890
           |||||||||| ||  | |||||||| || ||||||||| | ||||| |||||||||||
Sbjct: 686 tctcatacccaactctagctgctgccccccacatgttcattaatgcctacaagaatgt 743



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 42/49 (85%)
 Strand = Plus / Plus

                                                            
Query: 155 ccaaggccgagaagaagatcgcgtacgaccagaagctctgccagttgct 203
           ||||||| |||||||||||||| || ||    |||||||||||||||||
Sbjct: 8   ccaaggctgagaagaagatcgcttatgatgctaagctctgccagttgct 56



to top

>emb|X93587.1|LLP0 L.luteus mRNA for P0 ribosomal protein
          Length = 1393

 Score =  186 bits (94), Expect = 1e-43
 Identities = 232/278 (83%)
 Strand = Plus / Plus

                                                                       
Query: 433 aaggaggttcgcgaggaggtcgccaagtacaaggttggcgctcctgctcgtgttgggcta 492
           ||||||||| ||||||| || || ||||||||||| || ||||||||  |||||||  | 
Sbjct: 451 aaggaggttagcgaggaagttgctaagtacaaggtcggagctcctgcctgtgttggtttg 510

                                                                       
Query: 493 gttgcacctgttgatgtggtggttccccctggcaacactggtctggatccctcccagacg 552
           ||||| ||  ||||||| || || || || ||||||||||| || ||||| || ||||| 
Sbjct: 511 gttgctccaattgatgttgttgtccctccaggcaacactgggctcgatccatctcagacc 570

                                                                       
Query: 553 tccttcttccaggtgcttaacattcccaccaagattaacaagggtactgtggaaattacc 612
           || |||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |
Sbjct: 571 tctttcttccaggtgctcaacattcccaccaagattaacaagggtactgttgaaattatc 630

                                                                       
Query: 613 atcccagtggagctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgctt 672
           |  || |||||||| || |||||||| |||||||| ||||| |||||  ||||  |||||
Sbjct: 631 acacccgtggagctcattaagaagggagacaaggttggctcttctgaagctgcattgctt 690

                                                 
Query: 673 gccaagcttggtatccgccccttctcatatggactggt 710
           ||||||||||| ||  | || ||||||||||| |||||
Sbjct: 691 gccaagcttggcataaggccattctcatatggtctggt 728



to top

>dbj|AB236824.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C2319
          Length = 1345

 Score =  176 bits (89), Expect = 1e-40
 Identities = 197/233 (84%)
 Strand = Plus / Plus

                                                                       
Query: 415 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 474
           ||||||||||||||| | ||||| ||| | |||||||| || |||||||||||||| |||
Sbjct: 433 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 492

                                                                       
Query: 475 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 534
           ||||||||||||||  | ||||| ||  ||||||| || || || ||||| ||||| || 
Sbjct: 493 cctgctcgtgttggtttggttgctccaattgatgttgttgtgcctcctggtaacacaggg 552

                                                                       
Query: 535 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 594
           || || || |||||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 553 ctcgacccatcccagacctctttcttccaggtgcttaacatccccaccaagattaacaag 612

                                                                
Query: 595 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggt 647
           |||||||||||||| |  | ||| || || || ||||||||||| ||||||||
Sbjct: 613 ggtactgtggaaatcattacccctgttgaactcatcaagaagggagacaaggt 665



 Score = 65.9 bits (33), Expect = 3e-07
 Identities = 81/97 (83%)
 Strand = Plus / Plus

                                                                       
Query: 798 tggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgc 857
           ||||||||| |||||| | ||||| ||  |||| ||||| ||||| ||  | || |||||
Sbjct: 816 tggtgtttcaatggttacttcactttcgttggccatctcttacccaacacttgcagctgc 875

                                                
Query: 858 accgcacatgttcctcaatgcatacaagaatgttctt 894
           ||| ||||||||| ||||||| |||||||||||||||
Sbjct: 876 acctcacatgttcgtcaatgcctacaagaatgttctt 912



to top

>dbj|AB236811.1| Trifolium pratense RNA for putative 60S acidic ribosomal protein
           P0, complete cds, clone: C212
          Length = 1326

 Score =  176 bits (89), Expect = 1e-40
 Identities = 197/233 (84%)
 Strand = Plus / Plus

                                                                       
Query: 415 ttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggcgct 474
           ||||||||||||||| | ||||| ||| | |||||||| || |||||||||||||| |||
Sbjct: 440 ttcaccaagggtgacttgaaggaagttagtgaggaggttgctaagtacaaggttggagct 499

                                                                       
Query: 475 cctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacactggt 534
           ||||||||||||||  | ||||| ||  ||||||| || || || ||||| ||||| || 
Sbjct: 500 cctgctcgtgttggtttggttgctccaattgatgttgttgtgcctcctggtaacacaggg 559

                                                                       
Query: 535 ctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaacaag 594
           || || || |||||||| || |||||||||||||||||||| ||||||||||||||||||
Sbjct: 560 ctcgacccatcccagacctctttcttccaggtgcttaacatccccaccaagattaacaag 619

                                                                
Query: 595 ggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggt 647
           |||||||||||||| |  | ||| || || || ||||||||||| ||||||||
Sbjct: 620 ggtactgtggaaatcattacccctgttgaactcatcaagaagggagacaaggt 672



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 80/97 (82%)
 Strand = Plus / Plus

                                                                       
Query: 798 tggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgc 857
           ||||||||| |||||| | ||||| ||  |||| ||||| ||||| ||  | || |||||
Sbjct: 823 tggtgtttcaatggttacttcactttcgttggccatctcttacccaacacttgcagctgc 882

                                                
Query: 858 accgcacatgttcctcaatgcatacaagaatgttctt 894
           ||| ||||||||| | ||||| |||||||||||||||
Sbjct: 883 acctcacatgttcgtgaatgcctacaagaatgttctt 919



to top

>emb|X15206.1|CRCRE2 C.rubrum mRNA for light-induced 34kD protein
          Length = 1332

 Score =  170 bits (86), Expect = 8e-39
 Identities = 209/250 (83%)
 Strand = Plus / Plus

                                                                       
Query: 455 ccaagtacaaggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtgg 514
           |||||||||||||||| |||||||||||| ||||  | ||||||||  ||||||| || |
Sbjct: 556 ccaagtacaaggttggagctcctgctcgttttggtttggttgcaccaattgatgttgttg 615

                                                                       
Query: 515 ttccccctggcaacactggtctggatccctcccagacgtccttcttccaggtgcttaaca 574
           | || || |||||||||||||| || ||||||||||| || ||||||||||| |||||||
Sbjct: 616 tcccaccaggcaacactggtcttgacccctcccagacatctttcttccaggttcttaaca 675

                                                                       
Query: 575 ttcccaccaagattaacaagggtactgtggaaattaccatcccagtggagctgatcaaga 634
           | ||||| |||||||||||||||||||| ||||||| ||   | || ||||| |||||||
Sbjct: 676 tccccactaagattaacaagggtactgtcgaaattatcactgctgtagagctcatcaaga 735

                                                                       
Query: 635 agggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttggtatccgcccct 694
           |||| || |||||||| || |||||| | || || ||||| |||||||| ||  | || |
Sbjct: 736 agggcgaaaaggtgggttcttctgaggcagctctacttgcaaagcttggaattaggcctt 795

                     
Query: 695 tctcatatgg 704
           ||||||||||
Sbjct: 796 tctcatatgg 805



 Score = 61.9 bits (31), Expect = 5e-06
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1032 ggaggagaagaaggaagaacccgaggaggaatcagatggcgagatgggattcagtctgtt 1091
            |||||| |||||||||||||| ||||| ||||||||||  || || || |||||||| ||
Sbjct: 1136 ggaggaaaagaaggaagaacctgaggaagaatcagatgatgacatcggtttcagtctctt 1195

                       
Query: 1092 tgacgactaag 1102
            |||||| ||||
Sbjct: 1196 tgacgattaag 1206



 Score = 56.0 bits (28), Expect = 3e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                       
Query: 154 accaaggccgagaagaagatcgcgtacgaccagaagctctgcca 197
           |||||||| |||||||||||||| ||||| |||||||| |||||
Sbjct: 255 accaaggctgagaagaagatcgcatacgatcagaagctatgcca 298



to top

>gb|AC011436.7|ATAC011436 Arabidopsis thaliana chromosome III BAC F3L24 genomic sequence,
             complete sequence
          Length = 106688

 Score =  149 bits (75), Expect = 3e-32
 Identities = 264/327 (80%)
 Strand = Plus / Minus

                                                                         
Query: 563   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 622
             ||||||||||||| || |||||||||||||||||||| || ||||| | || |||||| |
Sbjct: 20578 aggtgcttaacatcccaaccaagattaacaagggtaccgtcgaaatcatcaccccagttg 20519

                                                                         
Query: 623   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 682
             |||| |||||| | ||||||||||| || || |||||| |||| || || ||||||||||
Sbjct: 20518 agcttatcaagcaaggtgacaaggtcgggtcttctgaggctgcgcttctagccaagcttg 20459

                                                                         
Query: 683   gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 742
             | ||| | || ||||||||||| || ||  ||     ||||||||||| ||| |||||||
Sbjct: 20458 gcatcaggccgttctcatatggtcttgttgtccagtctgtctatgacaatggctcagtct 20399

                                                                         
Query: 743   tcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggtg 802
             ||||||| ||||||||||| || ||||| ||  | ||  |||| ||||||||||||||| 
Sbjct: 20398 tcagcccagaggttcttgatcttactgaagaccaacttgtggagaagtttgcttctggta 20339

                                                                         
Query: 803   tttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccgc 862
             | ||||||||  | ||  || | || ||  | || ||||| ||| | |||||||||||||
Sbjct: 20338 tctccatggtcacttccttggctcttgctgtgtcgtaccctacccttgctgctgcaccgc 20279

                                        
Query: 863   acatgttcctcaatgcatacaagaatg 889
             | |||||| ||||||| ||||||||||
Sbjct: 20278 atatgttcatcaatgcgtacaagaatg 20252



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 412   atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 468
             ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||||
Sbjct: 21237 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 21181



 Score = 48.1 bits (24), Expect = 0.078
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 503   ttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttcc 562
             |||||||||| || |  ||||||||||||||||| || || ||||| || || |||||||
Sbjct: 20730 ttgatgtggttgtccaacctggcaacactggtctcgacccatcccaaacatctttcttcc 20671

                 
Query: 563   aggt 566
             ||||
Sbjct: 20670 aggt 20667



to top

>gb|AC009326.8|ATAC009326 Arabidopsis thaliana chromosome III P1 MZB10 genomic sequence, complete
             sequence
          Length = 85561

 Score =  149 bits (75), Expect = 3e-32
 Identities = 264/327 (80%)
 Strand = Plus / Minus

                                                                         
Query: 563   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 622
             ||||||||||||| || |||||||||||||||||||| || ||||| | || |||||| |
Sbjct: 84901 aggtgcttaacatcccaaccaagattaacaagggtaccgtcgaaatcatcaccccagttg 84842

                                                                         
Query: 623   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 682
             |||| |||||| | ||||||||||| || || |||||| |||| || || ||||||||||
Sbjct: 84841 agcttatcaagcaaggtgacaaggtcgggtcttctgaggctgcgcttctagccaagcttg 84782

                                                                         
Query: 683   gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 742
             | ||| | || ||||||||||| || ||  ||     ||||||||||| ||| |||||||
Sbjct: 84781 gcatcaggccgttctcatatggtcttgttgtccagtctgtctatgacaatggctcagtct 84722

                                                                         
Query: 743   tcagccccgaggttcttgacctcactgaggaagatctgatggacaagtttgcttctggtg 802
             ||||||| ||||||||||| || ||||| ||  | ||  |||| ||||||||||||||| 
Sbjct: 84721 tcagcccagaggttcttgatcttactgaagaccaacttgtggagaagtttgcttctggta 84662

                                                                         
Query: 803   tttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctgcaccgc 862
             | ||||||||  | ||  || | || ||  | || ||||| ||| | |||||||||||||
Sbjct: 84661 tctccatggtcacttccttggctcttgctgtgtcgtaccctacccttgctgctgcaccgc 84602

                                        
Query: 863   acatgttcctcaatgcatacaagaatg 889
             | |||||| ||||||| ||||||||||
Sbjct: 84601 atatgttcatcaatgcgtacaagaatg 84575



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                      
Query: 412   atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggtt 468
             ||||| ||||| |||||||||||||| ||  |||||||||| || ||||||||||||
Sbjct: 85560 atctttaccaaaggtgacctcaaggaagtgagcgaggaggttgctaagtacaaggtt 85504



 Score = 48.1 bits (24), Expect = 0.078
 Identities = 54/64 (84%)
 Strand = Plus / Minus

                                                                         
Query: 503   ttgatgtggtggttccccctggcaacactggtctggatccctcccagacgtccttcttcc 562
             |||||||||| || |  ||||||||||||||||| || || ||||| || || |||||||
Sbjct: 85053 ttgatgtggttgtccaacctggcaacactggtctcgacccatcccaaacatctttcttcc 84994

                 
Query: 563   aggt 566
             ||||
Sbjct: 84993 aggt 84990



to top

>dbj|AK062008.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-043-E02, full
           insert sequence
          Length = 451

 Score =  141 bits (71), Expect = 7e-30
 Identities = 149/175 (85%)
 Strand = Plus / Plus

                                                                       
Query: 797 ctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggctgctg 856
           |||||||||| |||||||||||| | |||||||| ||||| ||||| || || |||||||
Sbjct: 1   ctggtgtttctatggttgcctcagtctccctggcaatctcgtacccaactattgctgctg 60

                                                                       
Query: 857 caccgcacatgttcctcaatgcatacaagaatgttcttgcggtcgctttggagacagact 916
           |||| ||||||||||||||||  ||||||||||| ||||| || ||| ||||||| || |
Sbjct: 61  caccacacatgttcctcaatgggtacaagaatgtgcttgctgttgctgtggagaccgaat 120

                                                                  
Query: 917 actcgtatgaccatgctgataagatcaaggagtacctcaaggacccgagcaagtt 971
           |||||||    |||||||||||||||||||||||  | || ||||| ||||||||
Sbjct: 121 actcgtacccacatgctgataagatcaaggagtatttgaaagaccccagcaagtt 175



 Score = 60.0 bits (30), Expect = 2e-05
 Identities = 42/46 (91%)
 Strand = Plus / Plus

                                                          
Query: 1025 ccaaggaggaggagaagaaggaagaacccgaggaggaatcagatgg 1070
            |||||||||| |||||||||||||| ||||||||||| || |||||
Sbjct: 229  ccaaggaggaagagaagaaggaagagcccgaggaggagtccgatgg 274



to top

>ref|NM_129559.2| Arabidopsis thaliana structural constituent of ribosome (AT2G40010)
           mRNA, complete cds
          Length = 1153

 Score =  137 bits (69), Expect = 1e-28
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 334 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 393

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 394 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 453

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 454 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 513

                                                                
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 704
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 514 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 566



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 891
           ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 694 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 753

                
Query: 892 cttgc 896
           |||||
Sbjct: 754 cttgc 758



to top

>gb|AY070448.1| Arabidopsis thaliana At2g40010 mRNA sequence
          Length = 1373

 Score =  137 bits (69), Expect = 1e-28
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 478 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 537

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 538 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 597

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 598 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 657

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 658 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 717

                                                                
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 704
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 718 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 770



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 891
           ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 898 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 957

                
Query: 892 cttgc 896
           |||||
Sbjct: 958 cttgc 962



to top

>emb|BX819391.1|CNS0A9W8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB74ZC11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 961

 Score =  137 bits (69), Expect = 1e-28
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 130 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 189

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 190 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 249

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 250 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 309

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 310 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 369

                                                                
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 704
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 370 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 422



 Score = 52.0 bits (26), Expect = 0.005
 Identities = 32/34 (94%)
 Strand = Plus / Plus

                                             
Query: 863 acatgttcctcaatgcatacaagaatgttcttgc 896
           |||||||||||||||| |||||||| ||||||||
Sbjct: 581 acatgttcctcaatgcttacaagaacgttcttgc 614



to top

>gb|BT001919.1| Arabidopsis thaliana clone C105444 putative 60S acidic ribosomal
           protein P0 (At2g40010) mRNA, complete cds
          Length = 985

 Score =  137 bits (69), Expect = 1e-28
 Identities = 237/293 (80%)
 Strand = Plus / Plus

                                                                       
Query: 412 atcttcaccaagggtgacctcaaggaggttcgcgaggaggtcgccaagtacaaggttggc 471
           |||||||| ||||||||| | ||||| ||  | || ||||| || |||||||||||||| 
Sbjct: 274 atcttcactaagggtgacttgaaggaagtcagtgaagaggttgctaagtacaaggttgga 333

                                                                       
Query: 472 gctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctggcaacact 531
           |||||||||||||| ||  |||| || ||  |||||||||| || |  || |||||||||
Sbjct: 334 gctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccaggcaacact 393

                                                                       
Query: 532 ggtctggatccctcccagacgtccttcttccaggtgcttaacattcccaccaagattaac 591
           ||||| || || || ||||| |||||||||||||||||||||||||| ||||| || |||
Sbjct: 394 ggtcttgacccttcacagacctccttcttccaggtgcttaacattccaaccaaaatcaac 453

                                                                       
Query: 592 aagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgacaaggtgggc 651
           || ||||| || || || |  | ||| |||||||| |||||||| || ||||| || || 
Sbjct: 454 aaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgacaaagtcggt 513

                                                                
Query: 652 tcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatgg 704
           || || ||| |||| || |||||||||||||| ||| | ||||| || |||||
Sbjct: 514 tcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatgg 566



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 56/65 (86%)
 Strand = Plus / Plus

                                                                       
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 891
           ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 694 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 753

                
Query: 892 cttgc 896
           |||||
Sbjct: 754 cttgc 758



to top

>gb|AC073395.6|AC073395 Arabidopsis thaliana chromosome 3 BAC F11B9 genomic sequence, complete
             sequence
          Length = 103517

 Score =  121 bits (61), Expect = 7e-24
 Identities = 106/121 (87%)
 Strand = Plus / Plus

                                                                         
Query: 563   aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 622
             ||||||||||||||||||| |||||||||||||||||||| ||||||| || ||| ||||
Sbjct: 59343 aggtgcttaacattcccactaagattaacaagggtactgttgaaattatcacccctgtgg 59402

                                                                         
Query: 623   agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 682
             |||| |||||| | ||||||||||| || || |||||| ||||||| || || |||||||
Sbjct: 59403 agcttatcaagcaaggtgacaaggttgggtcttctgaggctgcccttctagctaagcttg 59462

              
Query: 683   g 683
             |
Sbjct: 59463 g 59463



 Score = 77.8 bits (39), Expect = 9e-11
 Identities = 87/103 (84%)
 Strand = Plus / Plus

                                                                         
Query: 464   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
             ||||||| |||||||||||||| ||  ||||||| ||| |||||||||| ||||  ||||
Sbjct: 59147 aggttggtgctcctgctcgtgtgggtttagttgctcctattgatgtggttgttcaacctg 59206

                                                        
Query: 524   gcaacactggtctggatccctcccagacgtccttcttccaggt 566
             ||||||||||||| || || || || || || |||||||||||
Sbjct: 59207 gcaacactggtcttgacccatctcaaacatcgttcttccaggt 59249



 Score = 50.1 bits (25), Expect = 0.020
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 853   gctgcaccgcacatgttcctcaatgcatacaagaatg 889
             ||||||||||| |||||| ||||||| ||||||||||
Sbjct: 59633 gctgcaccgcatatgttcatcaatgcctacaagaatg 59669



to top

>gb|AC184089.2| Populus trichocarpa clone Pop1-58K16, complete sequence
          Length = 103310

 Score =  119 bits (60), Expect = 3e-23
 Identities = 93/104 (89%)
 Strand = Plus / Minus

                                                                       
Query: 562 caggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtg 621
           |||||||| || ||||| |||||||||||||||||||| || ||||||| || |||||| 
Sbjct: 120 caggtgctcaatattccaaccaagattaacaagggtacagtcgaaattatcaccccagtc 61

                                                       
Query: 622 gagctgatcaagaagggtgacaaggtgggctcctctgagtctgc 665
           |||||||||||||||||||||||||| ||||| |||||| ||||
Sbjct: 60  gagctgatcaagaagggtgacaaggttggctcttctgaggctgc 17



 Score = 77.8 bits (39), Expect = 9e-11
 Identities = 87/103 (84%)
 Strand = Plus / Minus

                                                                       
Query: 464 aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
           ||||||| ||||||||||||||||| || ||||| ||  ||||||| || || || ||||
Sbjct: 356 aggttggagctcctgctcgtgttggtctggttgccccaattgatgttgttgtacctcctg 297

                                                      
Query: 524 gcaacactggtctggatccctcccagacgtccttcttccaggt 566
           ||||||| || || ||||| |||||||| || |||||||||||
Sbjct: 296 gcaacacagggcttgatccatcccagacctctttcttccaggt 254



to top

>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete
             sequence
          Length = 108847

 Score =  113 bits (57), Expect = 2e-21
 Identities = 195/241 (80%)
 Strand = Plus / Minus

                                                                         
Query: 464   aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
             ||||||| |||||||||||||| ||  |||| || ||  |||||||||| || |  || |
Sbjct: 77949 aggttggagctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccag 77890

                                                                         
Query: 524   gcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacattcccacca 583
             ||||||||||||| || || || ||||| |||||||||||||||||||||||||| ||||
Sbjct: 77889 gcaacactggtcttgacccttcacagacctccttcttccaggtgcttaacattccaacca 77830

                                                                         
Query: 584   agattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgaca 643
             | || ||||| ||||| || || || |  | ||| |||||||| |||||||| || ||||
Sbjct: 77829 aaatcaacaaaggtacggttgagatcataacccctgtggagctcatcaagaaaggcgaca 77770

                                                                         
Query: 644   aggtgggctcctctgagtctgccctgcttgccaagcttggtatccgccccttctcatatg 703
             | || || || || ||| |||| || |||||||||||||| ||| | ||||| || ||||
Sbjct: 77769 aagtcggttcatccgaggctgcgcttcttgccaagcttggaatcaggcccttttcgtatg 77710

              
Query: 704   g 704
             |
Sbjct: 77709 g 77709



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                         
Query: 832   atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 891
             ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 77581 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 77522

                  
Query: 892   cttgc 896
             |||||
Sbjct: 77521 cttgc 77517



to top

>gb|AC130799.19| Medicago truncatula clone mth2-34b13, complete sequence
          Length = 133305

 Score =  109 bits (55), Expect = 2e-20
 Identities = 172/211 (81%)
 Strand = Plus / Minus

                                                                          
Query: 563    aggtgcttaacattcccaccaagattaacaagggtactgtggaaattaccatcccagtgg 622
              ||||||| ||||| || ||||||||||||||||||||||||||||| |  | ||||||||
Sbjct: 104236 aggtgctcaacatcccaaccaagattaacaagggtactgtggaaatcattaccccagtgg 104177

                                                                          
Query: 623    agctgatcaagaagggtgacaaggtgggctcctctgagtctgccctgcttgccaagcttg 682
              | ||||| ||||| || |||||||| || || |||||  ||||  ||||||||||| | |
Sbjct: 104176 aactgattaagaaaggagacaaggttggatcttctgaagctgcattgcttgccaagttag 104117

                                                                          
Query: 683    gtatccgccccttctcatatggactggtcatctgcaatgtctatgacagtgggtcagtct 742
              ||||  | ||||| |||||||| || ||  ||     ||| ||||||| ||| ||||| |
Sbjct: 104116 gtattaggcccttttcatatgggcttgtggtcctttctgtttatgacaatggttcagtgt 104057

                                             
Query: 743    tcagccccgaggttcttgacctcactgagga 773
              | ||||| |||||||||||||||||||||||
Sbjct: 104056 ttagccctgaggttcttgacctcactgagga 104026



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 83/103 (80%)
 Strand = Plus / Minus

                                                                          
Query: 464    aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
              ||||||| |||||||| ||||||||  | ||||| ||  ||||||| || ||||| || |
Sbjct: 104410 aggttggagctcctgcccgtgttggtttggttgctccaattgatgtcgttgttcctccag 104351

                                                         
Query: 524    gcaacactggtctggatccctcccagacgtccttcttccaggt 566
              ||||||| || || || || || ||||| || |||||||||||
Sbjct: 104350 gcaacacagggctcgacccatctcagacctctttcttccaggt 104308



to top

>emb|CT982927.1| partial cDNA sequence from a Lambda ZAP II normalized full-length
           cDNA library of differentiating xylem from Eucalyptus
           gunnii
          Length = 591

 Score =  103 bits (52), Expect = 2e-18
 Identities = 133/160 (83%)
 Strand = Plus / Plus

                                                                       
Query: 732 tgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatggacaagtt 791
           |||||| ||||||||||| ||||| || ||||| |||||||| || || ||||| |||||
Sbjct: 8   tgggtcggtcttcagcccagaggtgctcgaccttactgaggatgacctcatggagaagtt 67

                                                                       
Query: 792 tgcttctggtgtttccatggttgcctcactgtccctggcgatctcataccccaccatggc 851
           ||||  |||||| || |||||  |  | || || || || ||||||||||| ||| ||||
Sbjct: 68  tgctcttggtgtctctatggtcacagctctctcgcttgccatctcatacccgaccctggc 127

                                                   
Query: 852 tgctgcaccgcacatgttcctcaatgcatacaagaatgtt 891
           ||| ||||||||||||||| ||||||| ||||||||||||
Sbjct: 128 tgccgcaccgcacatgttcatcaatgcctacaagaatgtt 167



to top

>emb|BX816288.1|CNS0AE9F Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH39ZH02 of Hormone Treated Callus of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1296

 Score =  103 bits (52), Expect = 2e-18
 Identities = 178/220 (80%)
 Strand = Plus / Minus

                                                                        
Query: 464  aggttggcgctcctgctcgtgttgggctagttgcacctgttgatgtggtggttccccctg 523
            ||||||| |||||||||||||| ||  |||| || ||  |||||||||| || |  || |
Sbjct: 1148 aggttggagctcctgctcgtgtaggtttagtcgctccaattgatgtggtcgtgcaaccag 1089

                                                                        
Query: 524  gcaacactggtctggatccctcccagacgtccttcttccaggtgcttaacattcccacca 583
            ||||||||||||| || || || ||||| |||||||||||||||||||||||||| ||||
Sbjct: 1088 gcaacactggtcttgacccttcacagacctccttcttccaggtgcttaacattccaacca 1029

                                                                        
Query: 584  agattaacaagggtactgtggaaattaccatcccagtggagctgatcaagaagggtgaca 643
            | || ||||| ||||| || || || |  | ||| || ||||| |||||||| || ||||
Sbjct: 1028 aaatcaacaaaggtacggttgagatcataacccctgtagagctcatcaagaaaggcgaca 969

                                                    
Query: 644  aggtgggctcctctgagtctgccctgcttgccaagcttgg 683
            | || || || || ||| |||| || ||||||||||||||
Sbjct: 968  aagtcggttcatccgaggctgcgcttcttgccaagcttgg 929



 Score = 58.0 bits (29), Expect = 8e-05
 Identities = 56/65 (86%)
 Strand = Plus / Minus

                                                                       
Query: 832 atctcataccccaccatggctgctgcaccgcacatgttcctcaatgcatacaagaatgtt 891
           ||||| ||||| ||| | || ||||| || ||||||||||||||||| |||||||| |||
Sbjct: 780 atctcttacccaaccgtagcagctgcgcctcacatgttcctcaatgcttacaagaacgtt 721

                
Query: 892 cttgc 896
           |||||
Sbjct: 720 cttgc 716



to top

>gb|DQ244437.1| Zea mays clone 7589 mRNA sequence
          Length = 647

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1033 gaggagaagaaggaagaacccgaggaggaatcagatggcgagatgggattcagtctgtt 1091
            ||||||||||||||||| ||| ||||||| || |||| ||| ||||| ||||| |||||
Sbjct: 370  gaggagaagaaggaagagcccaaggaggagtctgatgacgacatgggcttcagcctgtt 428



to top

>gb|BT016538.1| Zea mays clone Contig371 mRNA sequence
          Length = 707

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 51/59 (86%)
 Strand = Plus / Plus

                                                                       
Query: 1033 gaggagaagaaggaagaacccgaggaggaatcagatggcgagatgggattcagtctgtt 1091
            ||||||||||||||||| ||| ||||||| || |||| ||| ||||| ||||| |||||
Sbjct: 356  gaggagaagaaggaagagcccaaggaggagtctgatgacgacatgggcttcagcctgtt 414



to top

>gb|DQ306774.1| Hevea brasiliensis isolate SSH45 mRNA sequence
          Length = 308

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 724 tatgacagtgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatg 783
           ||||||| ||| || || |||||||| ||||| ||||| || ||||| || |||||  | 
Sbjct: 83  tatgacaatggctctgtattcagcccagaggtgcttgatctgactgaagatgatcttgtt 142

                                                                       
Query: 784 gacaagtttgcttctggtgtttccatggttgcctcactgtccctggcgatctcatacccc 843
           || ||||||||  ||||||| ||||||||  | ||| |  |  |||| || |||||||| 
Sbjct: 143 gagaagtttgcaactggtgtctccatggtcacttcattagcattggccatatcataccca 202

                                                          
Query: 844 accatggctgctgcaccgcacatgttcctcaatgcatacaagaatgt 890
           ||  |||| |||||||| ||||||||| | ||||| |||||||||||
Sbjct: 203 actctggcagctgcaccacacatgttcgttaatgcctacaagaatgt 249



to top

>gb|DQ306752.1| Hevea brasiliensis isolate SSH23 mRNA sequence
          Length = 308

 Score = 54.0 bits (27), Expect = 0.001
 Identities = 132/167 (79%)
 Strand = Plus / Plus

                                                                       
Query: 724 tatgacagtgggtcagtcttcagccccgaggttcttgacctcactgaggaagatctgatg 783
           ||||||| ||| || || |||||||| ||||| ||||| || ||||| || |||||  | 
Sbjct: 83  tatgacaatggctctgtattcagcccagaggtgcttgatctgactgaagatgatcttgtt 142

                                                                       
Query: 784 gacaagtttgcttctggtgtttccatggttgcctcactgtccctggcgatctcatacccc 843
           || ||||||||  ||||||| ||||||||  | ||| |  |  |||| || |||||||| 
Sbjct: 143 gagaagtttgcaactggtgtctccatggtcacttcattagcattggccatatcataccca 202

                                                          
Query: 844 accatggctgctgcaccgcacatgttcctcaatgcatacaagaatgt 890
           ||  |||| |||||||| ||||||||| | ||||| |||||||||||
Sbjct: 203 actctggcagctgcaccacacatgttcgttaatgcctacaagaatgt 249



to top

>dbj|AK239428.1| Sus scrofa mRNA, clone:THY010103A05, expressed in thymus
          Length = 1171

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 238 gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactccatc 297
           |||||||| |||||||||||| | ||| ||||||||| |  |||||||||  |  || | 
Sbjct: 170 gacaatgtgggctccaagcagatgcagcagatccgcatgtctctccgcgggaaagccgtg 229

                                     
Query: 298 gtgctcatgggcaagaacaccctgat 323
           ||||| ||||||||||||||| ||||
Sbjct: 230 gtgctgatgggcaagaacaccatgat 255



to top

>dbj|AK231505.1| Sus scrofa mRNA, clone:ITT010083C10, expressed in intestine
          Length = 1119

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 238 gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactccatc 297
           |||||||| |||||||||||| | ||| ||||||||| |  |||||||||  |  || | 
Sbjct: 174 gacaatgtgggctccaagcagatgcagcagatccgcatgtctctccgcgggaaagccgtg 233

                                     
Query: 298 gtgctcatgggcaagaacaccctgat 323
           ||||| ||||||||||||||| ||||
Sbjct: 234 gtgctgatgggcaagaacaccatgat 259



to top

>dbj|AK234557.1| Sus scrofa mRNA, clone:OVR010084G10, expressed in ovary
          Length = 1120

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 238 gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactccatc 297
           |||||||| |||||||||||| | ||| ||||||||| |  |||||||||  |  || | 
Sbjct: 170 gacaatgtgggctccaagcagatgcagcagatccgcatgtctctccgcgggaaagccgtg 229

                                     
Query: 298 gtgctcatgggcaagaacaccctgat 323
           ||||| ||||||||||||||| ||||
Sbjct: 230 gtgctgatgggcaagaacaccatgat 255



to top

>dbj|AK234485.1| Sus scrofa mRNA, clone:OVR010070H08, expressed in ovary
          Length = 1228

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 71/86 (82%)
 Strand = Plus / Plus

                                                                       
Query: 238 gacaatgtcggctccaagcagctccaggagatccgcaagggtctccgcggtgactccatc 297
           |||||||| |||||||||||| | ||| ||||||||| |  |||||||||  |  || | 
Sbjct: 274 gacaatgtgggctccaagcagatgcagcagatccgcatgtctctccgcgggaaagccgtg 333

                                     
Query: 298 gtgctcatgggcaagaacaccctgat 323
           ||||| ||||||||||||||| ||||
Sbjct: 334 gtgctgatgggcaagaacaccatgat 359



to top

>gb|DQ235177.1| Solanum tuberosum clone 157H11 acidic ribosomal protein P1a-like
            mRNA, complete cds
          Length = 567

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 53/62 (85%)
 Strand = Plus / Plus

                                                                        
Query: 1033 gaggagaagaaggaagaacccgaggaggaatcagatggcgagatgggattcagtctgttt 1092
            ||||| ||||||||||| ||| |||| |||   |||| ||| ||||||||||||||||||
Sbjct: 332  gaggaaaagaaggaagagcccaaggaagaaagtgatgacgatatgggattcagtctgttt 391

              
Query: 1093 ga 1094
            ||
Sbjct: 392  ga 393



to top

>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence
          Length = 1130447

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                    
Query: 545    cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
              ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 578573 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 578626



 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                    
Query: 545    cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
              ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 580972 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 581025



to top

>gb|AY702006.1| Leishmania donovani strain MHOM/IN/1983/AG83 60S ribosomal protein
           mRNA, partial cds
          Length = 1147

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 545 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 397 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 450



to top

>emb|X72714.1|LILIPOA L. infantum LiPO-A and LiPO-B gene
          Length = 3790

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 545 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 663 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 716



 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                  
Query: 545  cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
            ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 3032 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 3085



to top

>gb|AY180912.1| Leishmania donovani ribosomal protein P0-like mRNA, complete
           sequence
          Length = 1664

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 545 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 452 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 505



to top

>ref|XM_843004.1| Leishmania major strain Friedlin 60S acidic ribosomal subunit
           protein (LMJ_0400) partial mRNA
          Length = 972

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 545 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 419 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 472



to top

>ref|XM_843003.1| Leishmania major strain Friedlin 60S acidic ribosomal subunit
           protein (LMJ_0399) partial mRNA
          Length = 972

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 545 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 419 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 472



to top

>gb|L29300.1|LEIRIBPP Leishmania chagasi (clone C1) ribosomal protein P0 gene, complete
           cds
          Length = 1373

 Score = 52.0 bits (26), Expect = 0.005
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 545 cccagacgtccttcttccaggtgcttaacattcccaccaagattaacaagggta 598
           ||||||||||||||||||||| ||| |||||| | || ||||||  ||||||||
Sbjct: 496 cccagacgtccttcttccaggcgctgaacattgcgacgaagattgccaagggta 549



to top

>ref|XM_001211754.1| Aspergillus terreus NIH2624 60S acidic ribosomal protein P0
           (ATEG_02576) mRNA, complete cds
          Length = 939

 Score = 50.1 bits (25), Expect = 0.020
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                
Query: 400 aacgttggcctcatcttcaccaagggtgacctcaagg 436
           ||||||||  ||||||||||||| |||||||||||||
Sbjct: 247 aacgttggtttcatcttcaccaacggtgacctcaagg 283



to top

>ref|XM_001104158.1| PREDICTED: Macaca mulatta hypothetical protein LOC714418 (LOC714418),
            mRNA
          Length = 324

 Score = 50.1 bits (25), Expect = 0.020
 Identities = 25/25 (100%)
 Strand = Plus / Plus

                                     
Query: 1026 caaggaggaggagaagaaggaagaa 1050
            |||||||||||||||||||||||||
Sbjct: 33   caaggaggaggagaagaaggaagaa 57



to top

>gb|AF401551.1| Ictalurus punctatus ribosomal protein P0 mRNA, complete cds
          Length = 1081

 Score = 50.1 bits (25), Expect = 0.020
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 295 atcgtgctcatgggcaagaacaccctgat 323
           |||||||||||||||||||||||| ||||
Sbjct: 227 atcgtgctcatgggcaagaacaccatgat 255



to top

>emb|AJ783861.1| Carabus granulatus partial mRNA for acidic p0 ribosomal protein
           (rpp0 gene)
          Length = 608

 Score = 50.1 bits (25), Expect = 0.020
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 295 atcgtgctcatgggcaagaacaccctgat 323
           |||||||||||||||||||||||| ||||
Sbjct: 154 atcgtgctcatgggcaagaacaccatgat 182



to top

>dbj|AB113109.1| Aotus trivirgatus Aotr-B1 gene for MHC class I antigen, partial cds
            and promoter region
          Length = 3861

 Score = 50.1 bits (25), Expect = 0.020
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                 
Query: 238  gacaatgtcggctccaagcagctccaggagatccgca 274
            |||||||| |||||||||||| | |||||||||||||
Sbjct: 1649 gacaatgtgggctccaagcagatgcaggagatccgca 1685



to top

>ref|XM_795562.2| PREDICTED: Strongylocentrotus purpuratus hypothetical LOC591398
            (LOC591398), mRNA
          Length = 3217

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 1027 aaggaggaggagaagaaggaagaa 1050
            ||||||||||||||||||||||||
Sbjct: 824  aaggaggaggagaagaaggaagaa 847



to top

>ref|XM_001200349.1| PREDICTED: Strongylocentrotus purpuratus hypothetical LOC591398
            (LOC591398), mRNA
          Length = 3217

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 1027 aaggaggaggagaagaaggaagaa 1050
            ||||||||||||||||||||||||
Sbjct: 824  aaggaggaggagaagaaggaagaa 847



to top

>gb|AE014296.4| Drosophila melanogaster chromosome 3L, complete sequence
          Length = 24543557

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                                
Query: 940      atcaaggagtacctcaaggacccgagcaagtt 971
                |||||||||||| |||||||||| ||||||||
Sbjct: 22070254 atcaaggagtacatcaaggaccccagcaagtt 22070285



to top

>gb|BT027040.1| Gasterosteus aculeatus clone CFW157-A07 mRNA sequence
          Length = 1224

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 556 ttcttccaggtgcttaacattcccaccaagattaacaagggtac 599
           ||||||||||  || ||||| ||||||||||||| |||||||||
Sbjct: 484 ttcttccaggccctcaacatccccaccaagattaccaagggtac 527



to top

>gb|AC135667.5| Mus musculus BAC clone RP24-536G18 from chromosome 13, complete
             sequence
          Length = 166185

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 1027  aaggaggaggagaagaaggaagaa 1050
             ||||||||||||||||||||||||
Sbjct: 82808 aaggaggaggagaagaaggaagaa 82831



to top

>gb|AC122117.10| Mus musculus chromosome 18, clone RP23-61O22, complete sequence
          Length = 207024

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 1027   aaggaggaggagaagaaggaagaa 1050
              ||||||||||||||||||||||||
Sbjct: 120163 aaggaggaggagaagaaggaagaa 120186



to top

>gb|AC164402.3| Mus musculus chromosome 15, clone RP23-463G20, complete sequence
          Length = 196916

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 27/28 (96%)
 Strand = Plus / Minus

                                         
Query: 781   atggacaagtttgcttctggtgtttcca 808
             ||||||||| ||||||||||||||||||
Sbjct: 96023 atggacaagcttgcttctggtgtttcca 95996



to top

>gb|BC042186.1| Homo sapiens cDNA clone IMAGE:5393404, partial cds
          Length = 814

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 1027 aaggaggaggagaagaaggaagaa 1050
            ||||||||||||||||||||||||
Sbjct: 502  aaggaggaggagaagaaggaagaa 525



 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 1027 aaggaggaggagaagaaggaagaa 1050
            ||||||||||||||||||||||||
Sbjct: 670  aaggaggaggagaagaaggaagaa 693



to top

>ref|NM_079487.2| Drosophila melanogaster Ribosomal protein LP0 CG7490-RA (RpLP0),
           mRNA
          Length = 1262

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 940 atcaaggagtacctcaaggacccgagcaagtt 971
           |||||||||||| |||||||||| ||||||||
Sbjct: 928 atcaaggagtacatcaaggaccccagcaagtt 959



to top

>dbj|AK021773.1| Homo sapiens cDNA FLJ11711 fis, clone HEMBA1005152
          Length = 1839

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                    
Query: 1027 aaggaggaggagaagaaggaagaa 1050
            ||||||||||||||||||||||||
Sbjct: 1269 aaggaggaggagaagaaggaagaa 1292



to top

>gb|AC010009.7| Drosophila melanogaster 3L BAC RP98-23D16 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 195757

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                              
Query: 940    atcaaggagtacctcaaggacccgagcaagtt 971
              |||||||||||| |||||||||| ||||||||
Sbjct: 186098 atcaaggagtacatcaaggaccccagcaagtt 186067



to top

>gb|AC010011.5| Drosophila melanogaster 3L BAC RP98-17D14 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 167026

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                              
Query: 940    atcaaggagtacctcaaggacccgagcaagtt 971
              |||||||||||| |||||||||| ||||||||
Sbjct: 140084 atcaaggagtacatcaaggaccccagcaagtt 140115



to top

>gb|AC069368.14| Homo sapiens chromosome 15, clone CTD-2017F17, complete sequence
          Length = 132080

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 1027  aaggaggaggagaagaaggaagaa 1050
             ||||||||||||||||||||||||
Sbjct: 15493 aaggaggaggagaagaaggaagaa 15516



to top

>gb|AY075528.1| Drosophila melanogaster RE74511 full length cDNA
          Length = 1277

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 940 atcaaggagtacctcaaggacccgagcaagtt 971
           |||||||||||| |||||||||| ||||||||
Sbjct: 928 atcaaggagtacatcaaggaccccagcaagtt 959



to top

>gb|AC019084.9| Homo sapiens BAC clone RP11-354O2 from 7, complete sequence
          Length = 201215

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                     
Query: 1027  aaggaggaggagaagaaggaagaa 1050
             ||||||||||||||||||||||||
Sbjct: 84945 aaggaggaggagaagaaggaagaa 84922



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1028  aggaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||||
Sbjct: 84792 aggaggaggagaagaaggaagaa 84770



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1028  aggaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||||
Sbjct: 85194 aggaggaggagaagaaggaagaa 85172



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1030  gaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||
Sbjct: 84657 gaggaggagaagaaggaagaa 84637



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1030  gaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||
Sbjct: 85081 gaggaggagaagaaggaagaa 85061



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1030  gaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||
Sbjct: 85118 gaggaggagaagaaggaagaa 85098



to top

>emb|Z84486.1|HS528L19 Human DNA sequence from clone RP3-528L19 on chromosome 6q23 Contains
             part of the SGK gene for serum/glucocorticoid regulated
             kinase, complete sequence
          Length = 87013

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 1027  aaggaggaggagaagaaggaagaa 1050
             ||||||||||||||||||||||||
Sbjct: 9990  aaggaggaggagaagaaggaagaa 10013



to top

>dbj|AB178287.1| Neospora caninum NcRP1 mRNA for ribosomal protein P1, complete cds
          Length = 555

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 1031 aggaggagaagaaggaagaacccgaggaggaa 1062
            ||||||||||||||||||| || |||||||||
Sbjct: 313  aggaggagaagaaggaagagcctgaggaggaa 344



to top

>emb|BX032675.1|CNS08XDJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 280 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX019003.1|CNS08MTR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28DD12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 33/36 (91%)
 Strand = Plus / Plus

                                               
Query: 293 ccatcgtgctcatgggcaagaacaccctgatccgcc 328
           |||||||||| ||||||||||||||| |||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgatgcgcc 271



to top

>emb|BX018793.1|CNS08MNX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA28CB10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 941

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 280 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 208 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX013777.1|CNS08ISL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA20CH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 598

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 280 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 211 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX006032.1|CNS08CTG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10BB08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 909

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 280 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 200 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 243



to top

>emb|BX005998.1|CNS08CSI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA10AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 994

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 39/44 (88%)
 Strand = Plus / Plus

                                                       
Query: 280 ctccgcggtgactccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||  | |||||||||| ||||||||||||||| ||||
Sbjct: 214 ctccgcggttccgccatcgtgctgatgggcaagaacaccatgat 257



to top

>gb|AC153881.4| Mus musculus 10 BAC RP23-257B9 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 208992

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 1027  aaggaggaggagaagaaggaagaa 1050
             ||||||||||||||||||||||||
Sbjct: 90348 aaggaggaggagaagaaggaagaa 90371



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 91097 aaggaggaggagaagaaggaaga 91119



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 91146 aaggaggaggagaagaaggaaga 91168



to top

>gb|BT021447.1| Drosophila melanogaster GH01513 full insert cDNA
          Length = 1674

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 940  atcaaggagtacctcaaggacccgagcaagtt 971
            |||||||||||| |||||||||| ||||||||
Sbjct: 1314 atcaaggagtacatcaaggaccccagcaagtt 1345



to top

>emb|AL928893.10| Mouse DNA sequence from clone RP23-55I14 on chromosome 2, complete
              sequence
          Length = 235241

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                      
Query: 1027   aaggaggaggagaagaaggaagaa 1050
              ||||||||||||||||||||||||
Sbjct: 181521 aaggaggaggagaagaaggaagaa 181544



to top

>gb|AC106843.11| Mus musculus chromosome 15, clone RP24-151M4, complete sequence
          Length = 179117

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                          
Query: 781    atggacaagtttgcttctggtgtttcca 808
              ||||||||| ||||||||||||||||||
Sbjct: 142519 atggacaagcttgcttctggtgtttcca 142546



to top

>gb|M25772.1|DROAP3A Drosophila melanogaster DNA repair protein (AP3) mRNA, complete cds
          Length = 1193

 Score = 48.1 bits (24), Expect = 0.078
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 940 atcaaggagtacctcaaggacccgagcaagtt 971
           |||||||||||| |||||||||| ||||||||
Sbjct: 860 atcaaggagtacatcaaggaccccagcaagtt 891



to top

>emb|CT830605.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA111L10, full
            insert sequence
          Length = 1206

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1033 gaggagaagaaggaagaacccgaggag 1059
            |||||||||||||||||| ||||||||
Sbjct: 653  gaggagaagaaggaagaagccgaggag 679



to top

>ref|NM_001054614.1| Oryza sativa (japonica cultivar-group) Os02g0741200 (Os02g0741200)
            mRNA, complete cds
          Length = 1725

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 942  caaggagtacctcaaggacccga 964
            |||||||||||||||||||||||
Sbjct: 1126 caaggagtacctcaaggacccga 1148



to top

>ref|NM_001053107.1| Oryza sativa (japonica cultivar-group) Os02g0285300 (Os02g0285300)
            mRNA, complete cds
          Length = 1080

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 1033 gaggagaagaaggaagaacccgaggag 1059
            |||||||||||||||||| ||||||||
Sbjct: 617  gaggagaagaaggaagaagccgaggag 643



to top

>tpe|BN000560.1| TPA_inf: Oryza sativa (japonica cultivar-group) prx31 gene for class
            III peroxidase 31 precursor, exon 1
          Length = 1353

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 942  caaggagtacctcaaggacccga 964
            |||||||||||||||||||||||
Sbjct: 1050 caaggagtacctcaaggacccga 1072



to top

>gb|DQ440047.1| Aedes aegypti clone AE-294 60S acidic ribosomal protein P1 mRNA,
            complete cds
          Length = 339

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 55/65 (84%), Gaps = 3/65 (4%)
 Strand = Plus / Plus

                                                                        
Query: 1027 aaggaggaggagaagaaggaagaacccgaggaggaatcagatggcgagatgggattcagt 1086
            ||||| ||| ||||| |||||||||||||||||   || |||| ||| ||||||||| ||
Sbjct: 271  aaggaagagaagaaggaggaagaacccgaggag---tccgatgacgatatgggattcggt 327

                 
Query: 1087 ctgtt 1091
            |||||
Sbjct: 328  ctgtt 332



to top

>gb|AC114644.10| Mus musculus chromosome 1, clone RP24-128L10, complete sequence
          Length = 137391

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 11086 aaggaggaggagaagaaggaaga 11064



to top

>gb|AC132899.11| Mus musculus chromosome 15, clone RP24-367P22, complete sequence
          Length = 152183

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1028  aggaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||||
Sbjct: 57424 aggaggaggagaagaaggaagaa 57446



to top

>gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, complete sequence
          Length = 176001

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 1028   aggaggaggagaagaaggaagaa 1050
              |||||||||||||||||||||||
Sbjct: 172939 aggaggaggagaagaaggaagaa 172961



to top

>gb|AC115846.7| Mus musculus chromosome 1, clone RP24-245O4, complete sequence
          Length = 170731

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 1027   aaggaggaggagaagaaggaaga 1049
              |||||||||||||||||||||||
Sbjct: 142741 aaggaggaggagaagaaggaaga 142719



to top

>gb|BT018010.1| Zea mays clone EL01N0528A08.c mRNA sequence
          Length = 654

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                       
Query: 1033 gaggagaagaaggaagaacccgaggaggaatcagatggcgagatgggattcagtctgtt 1091
            |||||||||||||||||  || ||||||| || |||| ||| ||||| ||||| |||||
Sbjct: 325  gaggagaagaaggaagaggccaaggaggagtctgatgacgacatgggcttcagcctgtt 383



to top

>gb|AC106169.5| Rattus norvegicus x BAC CH230-105D14 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 227592

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 1028   aggaggaggagaagaaggaagaa 1050
              |||||||||||||||||||||||
Sbjct: 169328 aggaggaggagaagaaggaagaa 169350



to top

>gb|AY674236.1| Ixodes pacificus clone IP_7_60_92_569_CLU ribosomal protein, large P2
            mRNA, complete cds
          Length = 345

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 1025 ccaaggaggaggagaagaaggaagaacccgaggag 1059
            ||||| |||||||||||||||||||  ||||||||
Sbjct: 275  ccaagaaggaggagaagaaggaagagtccgaggag 309



to top

>ref|XM_656186.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3674.2), mRNA
          Length = 1671

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1027 aaggaggaggagaagaaggaaga 1049
            |||||||||||||||||||||||
Sbjct: 1045 aaggaggaggagaagaaggaaga 1067



to top

>ref|XM_655246.1| Aspergillus nidulans FGSC A4 60S acidic ribosomal protein P0
           (AN2734.2), mRNA
          Length = 939

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                  
Query: 400 aacgttggcctcatcttcaccaagggtgacctcaaggag 438
           ||||||||  ||||||||||||| || ||||||||||||
Sbjct: 247 aacgttggtttcatcttcaccaacggcgacctcaaggag 285



to top

>gb|AF039040.1| Caenorhabditis elegans cosmid T22B11, complete sequence
          Length = 35564

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1028  aggaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||||
Sbjct: 10342 aggaggaggagaagaaggaagaa 10364



to top

>gb|AC157650.2| Mus musculus BAC clone RP24-573N21 from chromosome 14, complete
             sequence
          Length = 186859

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 27933 aaggaggaggagaagaaggaaga 27911



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 28035 aaggaggaggagaagaaggaaga 28013



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 28455 aaggaggaggagaagaaggaaga 28433



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 28563 aaggaggaggagaagaaggaaga 28541



to top

>gb|AC121604.3| Mus musculus BAC clone RP23-312E2 from chromosome 8, complete sequence
          Length = 209383

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1028  aggaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||||
Sbjct: 25260 aggaggaggagaagaaggaagaa 25238



to top

>gb|AC131785.3| Mus musculus BAC clone RP24-397D13 from chromosome 17, complete
             sequence
          Length = 147557

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1028  aggaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||||
Sbjct: 86334 aggaggaggagaagaaggaagaa 86312



to top

>gb|AC126670.4| Mus musculus BAC clone RP24-469G14 from chromosome 1, complete sequence
          Length = 200595

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 1028   aggaggaggagaagaaggaagaa 1050
              |||||||||||||||||||||||
Sbjct: 150230 aggaggaggagaagaaggaagaa 150252



to top

>gb|AC127374.4| Mus musculus BAC clone RP23-46G11 from chromosome 8, complete sequence
          Length = 180143

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 1027   aaggaggaggagaagaaggaaga 1049
              |||||||||||||||||||||||
Sbjct: 138054 aaggaggaggagaagaaggaaga 138076



to top

>gb|AC123558.5| Mus musculus BAC clone RP23-336N16 from chromosome 5, complete sequence
          Length = 211763

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 1028   aggaggaggagaagaaggaagaa 1050
              |||||||||||||||||||||||
Sbjct: 167168 aggaggaggagaagaaggaagaa 167146



to top

>gb|AC121862.3| Mus musculus BAC clone RP24-110E10 from chromosome 14, complete
             sequence
          Length = 178501

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 15556 aaggaggaggagaagaaggaaga 15578



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 15664 aaggaggaggagaagaaggaaga 15686



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 16084 aaggaggaggagaagaaggaaga 16106



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 16207 aaggaggaggagaagaaggaaga 16229



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 16309 aaggaggaggagaagaaggaaga 16331



to top

>gb|AC122246.5| Mus musculus BAC clone RP23-152K13 from 1, complete sequence
          Length = 203739

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1028  aggaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||||
Sbjct: 16600 aggaggaggagaagaaggaagaa 16622



to top

>gb|AC125344.2| Mus musculus BAC clone RP24-332H21 from 12, complete sequence
          Length = 179908

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 1028   aggaggaggagaagaaggaagaa 1050
              |||||||||||||||||||||||
Sbjct: 166636 aggaggaggagaagaaggaagaa 166658



to top

>gb|AY239227.1| Eimeria maxima TFP250 mRNA, complete cds
          Length = 7990

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1028 aggaggaggagaagaaggaagaa 1050
            |||||||||||||||||||||||
Sbjct: 7045 aggaggaggagaagaaggaagaa 7067



to top

>gb|AC163649.3| Mus musculus BAC clone RP24-372B10 from chromosome 3, complete sequence
          Length = 154740

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1028  aggaggaggagaagaaggaagaa 1050
             |||||||||||||||||||||||
Sbjct: 50603 aggaggaggagaagaaggaagaa 50581



to top

>ref|NM_001028223.2| Caenorhabditis elegans T22B11.4b (T22B11.4) mRNA, complete cds
          Length = 1935

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1028 aggaggaggagaagaaggaagaa 1050
            |||||||||||||||||||||||
Sbjct: 1035 aggaggaggagaagaaggaagaa 1057



to top

>ref|NM_001028222.2| Caenorhabditis elegans T22B11.4a (T22B11.4) mRNA, complete cds
          Length = 1958

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1028 aggaggaggagaagaaggaagaa 1050
            |||||||||||||||||||||||
Sbjct: 1035 aggaggaggagaagaaggaagaa 1057



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2
          Length = 35954743

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                           
Query: 1033     gaggagaagaaggaagaacccgaggag 1059
                |||||||||||||||||| ||||||||
Sbjct: 10714634 gaggagaagaaggaagaagccgaggag 10714608



 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 942      caaggagtacctcaaggacccga 964
                |||||||||||||||||||||||
Sbjct: 31019529 caaggagtacctcaaggacccga 31019551



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 1028    aggaggaggagaagaaggaag 1048
               |||||||||||||||||||||
Sbjct: 4617592 aggaggaggagaagaaggaag 4617572



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 1025     ccaaggaggaggagaagaaggaaga 1049
                ||||| |||||||||||||||||||
Sbjct: 22578591 ccaagaaggaggagaagaaggaaga 22578567



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1
          Length = 43261740

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                      
Query: 1024    cccaaggaggaggagaagaagga 1046
               |||||||||||||||||||||||
Sbjct: 8232557 cccaaggaggaggagaagaagga 8232579



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                     
Query: 802      gtttccatggttgcctcactg 822
                |||||||||||||||||||||
Sbjct: 42649624 gtttccatggttgcctcactg 42649604



to top

>emb|CR637846.2|CNS0ER4S Tetraodon nigroviridis full-length cDNA
          Length = 516

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1027 aaggaggaggagaagaaggaaga 1049
            |||||||||||||||||||||||
Sbjct: 406  aaggaggaggagaagaaggaaga 428



to top

>emb|AL596188.6| Human DNA sequence from clone CTA-31J9 on chromosome 6 Contains the 5'
             part of a novel gene, a novel gene and a CpG island,
             complete sequence
          Length = 69676

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 1027  aaggaggaggagaagaaggaaga 1049
             |||||||||||||||||||||||
Sbjct: 16815 aaggaggaggagaagaaggaaga 16837



to top

>emb|AL157388.12| Human DNA sequence from clone RP11-215A21 on chromosome 10 Contains the
              5' end of a novel gene (MGC33215), a ribosomal protein L17
              (rpL23) (RPL17) pseudogene and three CpG islands, complete
              sequence
          Length = 183382

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 1028   aggaggaggagaagaaggaagaa 1050
              |||||||||||||||||||||||
Sbjct: 173606 aggaggaggagaagaaggaagaa 173628



to top

>gb|AC110377.5| Mus musculus BAC clone RP23-460A13 from chromosome 12, complete sequence
          Length = 196540

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 1028   aggaggaggagaagaaggaagaa 1050
              |||||||||||||||||||||||
Sbjct: 146109 aggaggaggagaagaaggaagaa 146087



to top

>emb|BX028182.1|CNS08TWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 210 ccatcgtgctgatgggcaagaacaccatgat 240



to top

>emb|BX028181.1|CNS08TWP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA42AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 755

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 703 ccatcgtgctgatgggcaagaacaccatgat 673



to top

>emb|BX028180.1|CNS08TWO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AE10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 639

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX028178.1|CNS08TWM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA42AE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 549

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX072148.1|CNS09RU0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 812

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX072146.1|CNS09RTY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DH05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 236 ccatcgtgctgatgggcaagaacaccatgat 266



to top

>emb|BX072055.1|CNS09RRF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DD04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 910

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX072031.1|CNS09RQR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 784

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX071993.1|CNS09RPP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 959

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 246 ccatcgtgctgatgggcaagaacaccatgat 276



to top

>emb|BX071847.1|CNS09RLN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9CB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1068

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX071747.1|CNS09RIV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9BF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 950

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX071599.1|CNS09RER Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC9AG12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 322

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 941 tcaaggagtacctcaaggacccgagcaagtt 971
           ||||||||| | |||||||||||||||||||
Sbjct: 131 tcaaggagttcatcaaggacccgagcaagtt 101



to top

>emb|BX071518.1|CNS09RCI Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AD05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 290

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 91  ccatcgtgctgatgggcaagaacaccatgat 121



to top

>emb|BX071445.1|CNS09RAH Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC9AA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1033

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 237 ccatcgtgctgatgggcaagaacaccatgat 267



to top

>emb|BX071386.1|CNS09R8U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 809

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX071318.1|CNS09R6Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 864

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071251.1|CNS09R53 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 515

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX071226.1|CNS09R4E Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CF12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 899

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX071175.1|CNS09R2Z Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8CD08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 955

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 211 ccatcgtgctgatgggcaagaacaccatgat 241



to top

>emb|BX070622.1|CNS09QNM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 966

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



 Score = 42.1 bits (21), Expect = 4.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                            
Query: 939 gatcaaggagtacctcaaggacccgagcaagtt 971
           ||||||||||| | ||||||| |||||||||||
Sbjct: 863 gatcaaggagttcatcaaggatccgagcaagtt 895



to top

>emb|BX070589.1|CNS09QMP Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 215 ccatcgtgctgatgggcaagaacaccatgat 245



to top

>emb|BX070541.1|CNS09QLD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 898

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX071039.1|CNS09QZ7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BF09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX070973.1|CNS09QXD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 960

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX070930.1|CNS09QW6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8BB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX070900.1|CNS09QVC Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX070894.1|CNS09QV6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 538

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 55  ccatcgtgctgatgggcaagaacaccatgat 85



to top

>emb|BX070751.1|CNS09QR7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX070745.1|CNS09QR1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC8AA03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 837

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 102 ccatcgtgctgatgggcaagaacaccatgat 132



to top

>emb|BX070099.1|CNS09Q93 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC7AB04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069823.1|CNS09Q1F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 916

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX069791.1|CNS09Q0J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 775

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX069588.1|CNS09PUW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6BC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 834

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX069403.1|CNS09PPR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC6AC03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 977

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX069336.1|CNS09PNW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DH03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 965

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 219 ccatcgtgctgatgggcaagaacaccatgat 249



to top

>emb|BX069235.1|CNS09PL3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53DC06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 668

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 241 ccatcgtgctgatgggcaagaacaccatgat 271



to top

>emb|BX069142.1|CNS09PII Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CG03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 979

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 229 ccatcgtgctgatgggcaagaacaccatgat 259



to top

>emb|BX069126.1|CNS09PI2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 455

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX068988.1|CNS09PE8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BH07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX068833.1|CNS09P9X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1037

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 253 ccatcgtgctgatgggcaagaacaccatgat 283



to top

>emb|BX068229.1|CNS09OT5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52BD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 882

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX068815.1|CNS09P9F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AH12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 925

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX068760.1|CNS09P7W Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC53AF06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 245 ccatcgtgctgatgggcaagaacaccatgat 275



to top

>emb|BX068607.1|CNS09P3N Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DG09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 767

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX068471.1|CNS09OZV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52DA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX067564.1|CNS09OAO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 340

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 149 ccatcgtgctgatgggcaagaacaccatgat 179



to top

>emb|BX067487.1|CNS09O8J Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AG10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 722

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX067429.1|CNS09O6X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51AE03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 642

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX068019.1|CNS09ONB Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC52AB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 969

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX067891.1|CNS09OJR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51DB02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 374

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 52  ccatcgtgctgatgggcaagaacaccatgat 82



to top

>emb|BX067841.1|CNS09OID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CG08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 690

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX067819.1|CNS09OHR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 335

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX067775.1|CNS09OGJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1021

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX067752.1|CNS09OFW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 986

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX067707.1|CNS09OEN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC51CA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1014

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 233 ccatcgtgctgatgggcaagaacaccatgat 263



to top

>emb|BX067216.1|CNS09O10 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DC02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX067179.1|CNS09NZZ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50DA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1008

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066992.1|CNS09NUS Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50CA04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 847

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 204 ccatcgtgctgatgggcaagaacaccatgat 234



to top

>emb|BX066854.1|CNS09NQY Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50BC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1054

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 240 ccatcgtgctgatgggcaagaacaccatgat 270



to top

>emb|BX066645.1|CNS09NL5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 349

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 203 ccatcgtgctgatgggcaagaacaccatgat 233



to top

>emb|BX066623.1|CNS09NKJ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC50AA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 731

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 222 ccatcgtgctgatgggcaagaacaccatgat 252



to top

>emb|BX066597.1|CNS09NJT Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 998

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 238 ccatcgtgctgatgggcaagaacaccatgat 268



to top

>emb|BX066426.1|CNS09NF2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 999

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 206 ccatcgtgctgatgggcaagaacaccatgat 236



to top

>emb|BX066412.1|CNS09NEO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 814

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX066390.1|CNS09NE2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 540

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX066329.1|CNS09NCD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC5CD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 851

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 207 ccatcgtgctgatgggcaagaacaccatgat 237



to top

>emb|BX065816.1|CNS09MY4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49DD11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX065714.1|CNS09MVA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 884

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 850 ccatcgtgctgatgggcaagaacaccatgat 820



to top

>emb|BX065713.1|CNS09MV9 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49CH04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 843

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX065465.1|CNS09MOD Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49BE06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 201 ccatcgtgctgatgggcaagaacaccatgat 231



to top

>emb|BX065359.1|CNS09MLF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AH10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 500

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX065269.1|CNS09MIX Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AD02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 693

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 171 ccatcgtgctgatgggcaagaacaccatgat 201



to top

>emb|BX065249.1|CNS09MID Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC49AC04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 944

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX065042.1|CNS09MCM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48DA11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 740

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 104 ccatcgtgctgatgggcaagaacaccatgat 134



to top

>emb|BX065015.1|CNS09MBV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1057

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX065006.1|CNS09MBM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1009

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 771 ccatcgtgctgatgggcaagaacaccatgat 741



to top

>emb|BX065005.1|CNS09MBL Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1002

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 311 ccatcgtgctgatgggcaagaacaccatgat 341



to top

>emb|BX064952.1|CNS09MA4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48CE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1073

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX064796.1|CNS09M5S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 304

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064760.1|CNS09M4S Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BC10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1031

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064725.1|CNS09M3T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC48BA09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 943

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX064530.1|CNS09LYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46DD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 467

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX064423.1|CNS09LVF Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CG07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 380

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX064284.1|CNS09LRK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46CA06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 987

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 231 ccatcgtgctgatgggcaagaacaccatgat 261



to top

>emb|BX064164.1|CNS09LO8 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BD03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1042

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX064121.1|CNS09LN1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 971

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 790 ccatcgtgctgatgggcaagaacaccatgat 760



to top

>emb|BX064120.1|CNS09LN0 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46BB03 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 989

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX064068.1|CNS09LLK Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC46AG11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1029

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX063872.1|CNS09LG4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1059

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX063577.1|CNS09L7X Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45CA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 439

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 92  ccatcgtgctgatgggcaagaacaccatgat 122



to top

>emb|BX063467.1|CNS09L4V Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 920

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 884 ccatcgtgctgatgggcaagaacaccatgat 854



to top

>emb|BX063466.1|CNS09L4U Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45BB05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 856

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063434.1|CNS09L3Y Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 198

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 86  ccatcgtgctgatgggcaagaacaccatgat 116



to top

>emb|BX063420.1|CNS09L3K Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC45AH01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 881

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265



to top

>emb|BX063227.1|CNS09KY7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 980

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 234 ccatcgtgctgatgggcaagaacaccatgat 264



to top

>emb|BX062552.1|CNS09KFG Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1039

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 216 ccatcgtgctgatgggcaagaacaccatgat 246



to top

>emb|BX062546.1|CNS09KFA Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43DE09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 764

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 103 ccatcgtgctgatgggcaagaacaccatgat 133



to top

>emb|BX062791.1|CNS09KM3 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC44BA05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 976

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 199 ccatcgtgctgatgggcaagaacaccatgat 229



to top

>emb|BX062387.1|CNS09KAV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CF08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 945

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 174 ccatcgtgctgatgggcaagaacaccatgat 204



to top

>emb|BX062299.1|CNS09K8F Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 982

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 176 ccatcgtgctgatgggcaagaacaccatgat 206



to top

>emb|BX062297.1|CNS09K8D Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43CB06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 223 ccatcgtgctgatgggcaagaacaccatgat 253



to top

>emb|BX062183.1|CNS09K57 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BD07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1052

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 225 ccatcgtgctgatgggcaagaacaccatgat 255



to top

>emb|BX062169.1|CNS09K4T Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43BC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 689

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 214 ccatcgtgctgatgggcaagaacaccatgat 244



to top

>emb|BX062048.1|CNS09K1G Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC43AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1012

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 205 ccatcgtgctgatgggcaagaacaccatgat 235



to top

>emb|BX061878.1|CNS09JWQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC42DF01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 958

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 209 ccatcgtgctgatgggcaagaacaccatgat 239



to top

>emb|BX061190.1|CNS09JDM Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DE02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 993

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 224 ccatcgtgctgatgggcaagaacaccatgat 254



to top

>emb|BX061164.1|CNS09JCW Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 858

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 785 ccatcgtgctgatgggcaagaacaccatgat 755



to top

>emb|BX061163.1|CNS09JCV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DC12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 930

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 227 ccatcgtgctgatgggcaagaacaccatgat 257



to top

>emb|BX061137.1|CNS09JC5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 974

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 226 ccatcgtgctgatgggcaagaacaccatgat 256



to top

>emb|BX061133.1|CNS09JC1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DB09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 985

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 221 ccatcgtgctgatgggcaagaacaccatgat 251



to top

>emb|BX061098.1|CNS09JB2 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41DA01 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 951

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 220 ccatcgtgctgatgggcaagaacaccatgat 250



to top

>emb|BX061090.1|CNS09JAU Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CH09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 933

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 230 ccatcgtgctgatgggcaagaacaccatgat 260



to top

>emb|BX061061.1|CNS09JA1 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1063

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 247 ccatcgtgctgatgggcaagaacaccatgat 277



to top

>emb|BX061042.1|CNS09J9I Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41CF07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 377

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 228 ccatcgtgctgatgggcaagaacaccatgat 258



to top

>emb|BX060642.1|CNS09IYE Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC41AD10 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 947

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 172 ccatcgtgctgatgggcaagaacaccatgat 202



to top

>emb|BX060527.1|CNS09IV7 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DG05 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 997

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 218 ccatcgtgctgatgggcaagaacaccatgat 248



to top

>emb|BX060489.1|CNS09IU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1036

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 786 ccatcgtgctgatgggcaagaacaccatgat 756



to top

>emb|BX060488.1|CNS09IU4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DE08 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1032

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 326 ccatcgtgctgatgggcaagaacaccatgat 356



to top

>emb|BX060443.1|CNS09ISV Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC40DC07 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1047

 Score = 46.1 bits (23), Expect = 0.31
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 293 ccatcgtgctcatgggcaagaacaccctgat 323
           |||||||||| ||||||||||||||| ||||
Sbjct: 235 ccatcgtgctgatgggcaagaacaccatgat 265


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 202,341,015
Number of extensions: 11329882
Number of successful extensions: 299141
Number of sequences better than 10.0: 1206
Number of HSP's gapped: 299080
Number of HSP's successfully gapped: 1338
Length of query: 1275
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1252
Effective length of database: 18,503,978,556
Effective search space: 23166981152112
Effective search space used: 23166981152112
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)
to top