ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf94j01 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AK242870.1| Oryza sativa (japonica cultivar-group) cDNA, clone: J090076L04, full insert sequence Length = 3158 Score = 672 bits (339), Expect = 0.0 Identities = 765/907 (84%) Strand = Plus / Plus Query: 2079 gccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccc 2138 |||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 2046 gccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggccc 2105 Query: 2139 tccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggt 2198 || ||||| ||||| || || ||||| ||| | | || |||||||||||||||||||| Sbjct: 2106 gccaccgccgccaccaccccctggttccctacctaggaatcttgctggtggtgacaaggt 2165 Query: 2199 acaccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaa 2258 |||||||||||| ||||| || ||||| ||||| ||||||||||| |||||||||||||| Sbjct: 2166 acaccgtgctccagaggttgtagagttttatcaaagtctcatgaagcgtgaagccaagaa 2225 Query: 2259 ggacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgat 2318 |||||| || ||| ||||||||| |||||| | || | |||| |||||||||||||| Sbjct: 2226 ggacacaacttctctgggatcaacaacatcaagtgcctttgatgtgagaagcaacatgat 2285 Query: 2319 tggagagattgagaacagatcaacattcctattagctgtcaaagctgatgtggagacaca 2378 ||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||| Sbjct: 2286 tggagagattgagaatagatcaacattcctcttagctgtcaaagcggatgtggagacaca 2345 Query: 2379 aggagaatttgtcgagtccctagcgggtgaggtccgagcagcaagattcgcgaatatcga 2438 |||||| ||||||||||| ||||| |||||||||||||||||| || | |||||||| Sbjct: 2346 aggagactttgtcgagtctctagcaaatgaggtccgagcagcaagttttgtaaatatcga 2405 Query: 2439 tgatgttgttgcatttgtacattggctggatgaagagttgtcattcttggttgatgagag 2498 |||||||||||||||||| ||||||| ||||| || | || |||||||| |||||| | Sbjct: 2406 cgatgttgttgcatttgtaaattggcttgatgaggaactatccttcttggtcgatgagcg 2465 Query: 2499 agcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaagagaggccgc 2558 ||||| |||||||| || ||||||||||||||||||||||||||| |||||||||| || Sbjct: 2466 ggcagtactaaagcactttgattggccagagagcaaaactgatgcactaagagaggcagc 2525 Query: 2559 ctttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtcgatgatcc 2618 |||||||||||| |||||| | ||| |||| | |||| | | || ||| |||||||| Sbjct: 2526 ctttgagtatcaagacctgctaaaattagaacataaggtttcgtcgtttactgatgatcc 2585 Query: 2619 aaaacttccatgtgaagaagctttgaagaggatgtattcgttgcttgagaaagtggagca 2678 ||| ||| |||||||||||||| | |||| ||||||||| |||||||| ||||||||||| Sbjct: 2586 aaagcttgcatgtgaagaagctctcaagaagatgtattccttgcttgaaaaagtggagca 2645 Query: 2679 gagtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaaggagtatgg 2738 ||||||||| || || |||||||| ||||||||| ||| |||| |||| |||||| || Sbjct: 2646 gagtgtttatgcgctacttcgtactagagacatggccatatcacgctacagggagtacgg 2705 Query: 2739 aataccagttgattggttatctgattctggaaaagttggcaagatcaaactcgcgtcagt 2798 | |||| || |||||| | |||| ||| || |||||||||||||||| | || || || Sbjct: 2706 actaccggtggattggctgtctggttccggggtagttggcaagatcaaattggcatctgt 2765 Query: 2799 tcagctggcaaggaagtacatggagagggtcacgtcggagctcgacgcgttgcaaggcac 2858 ||||||||| | |||||| ||| ||||||| | | ||||| || || ||||||||||| Sbjct: 2766 tcagctggcgaagaagtatatgaagagggttgccacagagcttgatgccttgcaaggcac 2825 Query: 2859 ggacaaagagcccaacagggagttcttgcttctccagggcgtcagatttgccttccgtgt 2918 || |||||||||||||| |||||||||||||| ||||| || |||||||| ||||| || Sbjct: 2826 cgagaaagagcccaacagagagttcttgcttcttcagggtgtgagatttgctttccgagt 2885 Query: 2919 tcatcagtttgctggaggcttcgacgcagacagcatgaaagtcttcgaggagctgagaag 2978 |||||||||||| ||||| ||||| | || |||||||| | || || ||||| ||||| Sbjct: 2886 tcatcagtttgccggagggttcgatgaggaaagcatgaaggcatttgaagagctaagaag 2945 Query: 2979 caagatg 2985 ||||||| Sbjct: 2946 caagatg 2952 Score = 624 bits (315), Expect = e-175 Identities = 806/969 (83%), Gaps = 3/969 (0%) Strand = Plus / Plus Query: 530 ccgagatggagcggctgcgcggcctggtgagggagctggaggagcgggaggtgaagctcg 589 ||||| ||||| ||||||| || || ||| | ||||||||||| |||| |||||||| | Sbjct: 506 ccgagctggagaggctgcgtggacttgtgcgtgagctggaggacagggaagtgaagcttg 565 Query: 590 agggcgagctgctcgagtactacggcctcaaggagcaggagaccgacgtgtccgagctgc 649 |||| |||||||| |||||||| ||||||||||| |||||||| || || ||||| | Sbjct: 566 agggagagctgctggagtactatggcctcaaggaacaggagactgatgttgtagagctac 625 Query: 650 agaagcagctcaagatcaagacggtggaggtcgacatgctcaacatcaccatcagctcgc 709 | | |||||||||||||||| ||||||| ||||||||||||| || ||||||| ||||| Sbjct: 626 acagacagctcaagatcaagatggtggagatcgacatgctcaaaatgaccatcaactcgc 685 Query: 710 tgcaggccgagagaaagaagctgcaggaggatgttgcccgtggcgctgccgccaagaagg 769 |||| | ||||| |||||||| ||||| || || ||||||||| | | ||||||| || Sbjct: 686 tgcaagaggagaggaagaagcttcaggatgacgtcgcccgtggcacaggagccaagaggg 745 Query: 770 agctcgacgcgtccaggagcaggatcaaggagctgcagcgccagatacagatggaggcta 829 |||| || || | |||| || |||||||||||||||||| ||||||||||||||||| | Sbjct: 746 agctggaggctgcgaggaacaagatcaaggagctgcagcgacagatacagatggaggcga 805 Query: 830 accagaccaaaggccagctgatgctgctcaagcaacaggtgatggggctcagggccaagg 889 ||||||| ||||| ||||||||||| || ||| | |||||||| | ||| | | |||||| Sbjct: 806 accagacgaaagggcagctgatgcttctaaagaaccaggtgattgcgctgaagtccaagg 865 Query: 890 aggaggaggtggccaagaaggacgccgagatcgaacagaagctcaagaagctcaagaacc 949 ||||||||| |||| |||||||| ||| | | |||||| |||||||||||| | | Sbjct: 866 aggaggaggcagccatcaaggacgcagaggtgcagaggaagctgaagaagctcaaggagc 925 Query: 950 tggaggtggaggtgcttgagctgaggaggaagaacaaggagctgctgtatgagaagaggg 1009 |||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 926 tggaagtggaggtagttgagctgaggaggaagaacaaggagctcttgtatgagaaaaggg 985 Query: 1010 acctcatggtgaagctggatgcagcacaaggaaaaataacagagagtgatgtagttgccc 1069 | ||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 986 atctcatcgttaagctggatgcagcacaaggaaaaataacagagagtgatgtagtttccc 1045 Query: 1070 atgcaagagaggagatcaataacctgagacatacaaatgaggacctcacaaagcaagtgg 1129 ||||||||||||||||||| || ||||| ||| |||||| ||||| || |||||||| | Sbjct: 1046 atgcaagagaggagatcaacaagctgaggcatgtaaatgaagaccttaccaagcaagtag 1105 Query: 1130 aaggcctacagatgaacagattcagtgaagtagaggagctggtgtacctgcgttgggtca 1189 |||||||||| ||||||||||||||||||||||| ||| |||| |||||||||||||| | Sbjct: 1106 aaggcctacaaatgaacagattcagtgaagtagaagagttggtttacctgcgttgggtta 1165 Query: 1190 acgcctgtctgcgattcgagctccgcaactaccagacaccatcgggcaaaatctctgccc 1249 | || |||||| ||| |||||||||||||||||| ||||||| | ||||| ||||| | Sbjct: 1166 atgcttgtctgagatatgagctccgcaactaccaggcaccatctgagaaaatttctgctc 1225 Query: 1250 gcgacctcagcacgaagctcagcccaaagtctcaggagagggccaaacagatgatgctcg 1309 | |||| | || || || |||||||| || | ||||||||||||| | ||||| | Sbjct: 1226 gttaccttaacaagaccctgagcccaaaatcgcgtgagagggccaaacttctaatgctgg 1285 Query: 1310 aattt---gggtctgagcgaggccagggcgacactgaccttgacagtgtctcctcggcac 1366 ||| | || || || ||||| |||||||||||||||||||| | || || || |||| Sbjct: 1286 aatatgcaggatcagaacgaggacagggcgacactgaccttgaaactgcttcttctgcac 1345 Query: 1367 cttcttcccccagaagcgaagacttcgacaccgcttcgatcgacagctcttccggcagat 1426 ||||||| ||||||||||||||||| |||| | ||| | ||||| ||||| |||||| Sbjct: 1346 cttcttcacccagaagcgaagacttggacaatgtttcagttgacagttcttctagcagat 1405 Query: 1427 acagcttcctaagcaagaggccgaacctgatgcagaaactcaagaagtggggaaggagca 1486 |||||||| | |||| ||||| || |||||||| || |||||||||||||||||| ||| Sbjct: 1406 acagcttctttggcaaaaggcccaatctgatgcaaaagctcaagaagtggggaaggggca 1465 Query: 1487 aggatgatg 1495 ||||||||| Sbjct: 1466 aggatgatg 1474 Score = 234 bits (118), Expect = 2e-57 Identities = 374/458 (81%), Gaps = 6/458 (1%) Strand = Plus / Plus Query: 1552 agccagaaaccaaagggccccctggaatctctcatgatcagaaatgcaggagatggtatg 1611 ||||||||||||||||| ||||| || |||||||| |||||||||||||||||||| || Sbjct: 1531 agccagaaaccaaaggggcccctagaggctctcatgctcagaaatgcaggagatggtgtg 1590 Query: 1612 tccattacaacatttggaaaaagggatcaagaatccggtga---catagatgatgcaaat 1668 ||||||||| |||||||| ||||| || || || |||| ||| ||||| |||||| Sbjct: 1591 ggcattacaacctttggaaagagggaacaggatcccagtgatatcatggatgaggcaaat 1650 Query: 1669 gttgcatcttcattccagttgatgtcgaagaatgttgaaggcttcgctgatgaaaagtat 1728 ||||||||||||||||| |||||||| |||| ||| |||| || |||||||| |||||| Sbjct: 1651 gttgcatcttcattccatttgatgtcaaagactgtacaaggttttgctgatgacaagtat 1710 Query: 1729 cccgcttacaaagaccggcataagcttgcgacggaacgggagaaggcgataaaagagaag 1788 |||||||||||||| ||||||| ||||| || ||||||||||||| ||||||||||| Sbjct: 1711 cccgcttacaaagataggcataaacttgccacagaacgggagaaggtaataaaagagaaa 1770 Query: 1789 gccgagcaagccagagcacaaaggtttggtggtggctatagttcagctctagctccttcc 1848 |||||| |||| || | |||||| | ||| |||| | | ||||||| | | | || || Sbjct: 1771 gccgagaaagctagggtacaaagatatggcggtgtcaacagttcaggtattgtgccatct 1830 Query: 1849 ccgagagctgcacttccccccaaactcgctcaaataaaggagaagaaggcccctgcagtc 1908 || ||| ||||||| || || ||||| ||||||||||||| | ||||| ||| ||| Sbjct: 1831 ccaagatctgcactccctccaaaacttgctcaaataaagg---aaaaggctcctacagct 1887 Query: 1909 aatgctgaatccggcgagcaatctagtgatatcccgaacaaccccctggctgtcacccag 1968 |||||||||||| | || ||| ||||||||| || ||||||||| || | ||| || || Sbjct: 1888 aatgctgaatccagtgaccaacctagtgataaccagaacaaccctctagttgtgacacaa 1947 Query: 1969 ttgaagcttgcccaaattgagaagagagctccaagagt 2006 |||| ||||| | ||||||||||||||||||||||| Sbjct: 1948 ctgaaacttgcaaatattgagaagagagctccaagagt 1985 Score = 73.8 bits (37), Expect = 4e-09 Identities = 52/57 (91%) Strand = Plus / Plus Query: 334 acatggggagaaagaagaggaggaggaagaggtcaagacgatcagcggcataatcaa 390 |||||||||||||||||| ||| |||||||||| || || ||||||||||||||||| Sbjct: 321 acatggggagaaagaagaagagaaggaagaggttaaaacaatcagcggcataatcaa 377 Score = 56.0 bits (28), Expect = 8e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 413 gatgaggacgacatgttctcggagatcgagagcctcctgggcggggagatcgacatcccg 472 ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||| Sbjct: 391 gatgatgacgacatgctctccgagatcgagagcctcctatcaggggagattgacatcccc 450 Query: 473 ataccgggcgacaggtttga 492 |||| | ||||||||||| Sbjct: 451 ctaccaagtgacaggtttga 470
>ref|NM_001072463.1| Oryza sativa (japonica cultivar-group) Os12g0105300 (Os12g0105300) mRNA, complete cds Length = 3183 Score = 670 bits (338), Expect = 0.0 Identities = 764/906 (84%) Strand = Plus / Plus Query: 2080 ccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccct 2139 ||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 2054 ccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggcccg 2113 Query: 2140 ccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggta 2199 || ||||| ||||| | || ||||| ||| | | || ||||||||||||||||||||| Sbjct: 2114 ccaccgccgccaccacgccctggttccctacctaggaatcttgctggtggtgacaaggta 2173 Query: 2200 caccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaag 2259 ||||||||||| ||||| || ||||||||||| ||||||||||| ||||||||||||||| Sbjct: 2174 caccgtgctccagaggttgtagagttctatcaaagtctcatgaagcgtgaagccaagaag 2233 Query: 2260 gacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgatt 2319 ||||| || ||| ||||||||| |||||| | ||| |||||| ||||||||||||||| Sbjct: 2234 gacacaacttctctgggatcaacaacatcaagtgtctctgatgtgagaagcaacatgatt 2293 Query: 2320 ggagagattgagaacagatcaacattcctattagctgtcaaagctgatgtggagacacaa 2379 |||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| Sbjct: 2294 ggagagattgagaatagatcaacattcctcttagctgtcaaagtggatgtggagacacaa 2353 Query: 2380 ggagaatttgtcgagtccctagcgggtgaggtccgagcagcaagattcgcgaatatcgat 2439 ||||| ||||| ||||| ||||| ||||||||||||||| || || | |||||||| Sbjct: 2354 ggagactttgttgagtctctagcaaatgaggtccgagcagctagttttgtaaatatcgac 2413 Query: 2440 gatgttgttgcatttgtacattggctggatgaagagttgtcattcttggttgatgagaga 2499 || ||||||||||||||| | ||||| ||||| || | || |||||||| |||||| | Sbjct: 2414 gacgttgttgcatttgtaaactggcttgatgaggaactatccttcttggtcgatgagcgg 2473 Query: 2500 gcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaagagaggccgcc 2559 ||||| |||||||| || ||||||||||||||||||||||||||| |||||||||| ||| Sbjct: 2474 gcagtactaaagcactttgattggccagagagcaaaactgatgcactaagagaggcagcc 2533 Query: 2560 tttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtcgatgatcca 2619 ||||||||||| |||||| | ||| |||| |||||| | | || ||| ||||||||| Sbjct: 2534 tttgagtatcaagacctgctaaaattagaacacaaggtttcgtcgtttactgatgatcca 2593 Query: 2620 aaacttccatgtgaagaagctttgaagaggatgtattcgttgcttgagaaagtggagcag 2679 || ||| |||||||||||||| | |||| ||||||||| |||||||| | |||||||||| Sbjct: 2594 aagcttgcatgtgaagaagctctcaagaagatgtattccttgcttgaaacagtggagcag 2653 Query: 2680 agtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaaggagtatgga 2739 |||||||| || || |||||||| ||||||||| ||| |||| |||| |||||||||| Sbjct: 2654 agtgtttatgcgctacttcgtactagagacatggccatatcacgctacagggagtatgga 2713 Query: 2740 ataccagttgattggttatctgattctggaaaagttggcaagatcaaactcgcgtcagtt 2799 ||||| || |||||| | |||||||| || |||||||||||||||| | || || ||| Sbjct: 2714 ataccggtggattggctgtctgattccggggtagttggcaagatcaaattggcatctgtt 2773 Query: 2800 cagctggcaaggaagtacatggagagggtcacgtcggagctcgacgcgttgcaaggcacg 2859 |||||||| | |||||| ||| | ||||| | | ||||| || || ||||||||||| Sbjct: 2774 cagctggcgaagaagtatatgaatagggttgccacagagctagatgccttgcaaggcacc 2833 Query: 2860 gacaaagagcccaacagggagttcttgcttctccagggcgtcagatttgccttccgtgtt 2919 || |||||||||||||| |||||||||||||| ||||| || |||||||| ||||| ||| Sbjct: 2834 gagaaagagcccaacagagagttcttgcttcttcagggtgtgagatttgctttccgagtt 2893 Query: 2920 catcagtttgctggaggcttcgacgcagacagcatgaaagtcttcgaggagctgagaagc 2979 ||||||||||| |||||||| |||| || |||||||| | || || ||||| |||||| Sbjct: 2894 catcagtttgccggaggctttgacgaggaaagcatgaaggcgtttgaagagctaagaagc 2953 Query: 2980 aagatg 2985 |||||| Sbjct: 2954 aagatg 2959 Score = 652 bits (329), Expect = 0.0 Identities = 808/967 (83%), Gaps = 3/967 (0%) Strand = Plus / Plus Query: 530 ccgagatggagcggctgcgcggcctggtgagggagctggaggagcgggaggtgaagctcg 589 ||||| ||||| ||||||| || || ||| | |||||||||||| |||| |||||||| | Sbjct: 513 ccgagctggagaggctgcgtggacttgtgcgtgagctggaggagagggaagtgaagcttg 572 Query: 590 agggcgagctgctcgagtactacggcctcaaggagcaggagaccgacgtgtccgagctgc 649 |||| |||||||| |||||||| ||||||||||| |||||||| || || ||||| | Sbjct: 573 agggagagctgctagagtactatggcctcaaggaacaggagactgatgttgtagagctac 632 Query: 650 agaagcagctcaagatcaagacggtggaggtcgacatgctcaacatcaccatcagctcgc 709 | | |||||||||||||||| ||||||| ||||||||||||| || ||||||| ||||| Sbjct: 633 acagacagctcaagatcaagatggtggagatcgacatgctcaaaatgaccatcaactcgc 692 Query: 710 tgcaggccgagagaaagaagctgcaggaggatgttgcccgtggcgctgccgccaagaagg 769 |||| | ||||| |||||||||||||| || || ||||||||| | | ||||||| || Sbjct: 693 tgcaagaggagaggaagaagctgcaggatgacgtcgcccgtggcacaggagccaagaggg 752 Query: 770 agctcgacgcgtccaggagcaggatcaaggagctgcagcgccagatacagatggaggcta 829 |||| || || | |||| || |||||||||||||||||| ||||||||||||||||| | Sbjct: 753 agctggaggctgcgaggaacaagatcaaggagctgcagcgacagatacagatggaggcga 812 Query: 830 accagaccaaaggccagctgatgctgctcaagcaacaggtgatggggctcagggccaagg 889 ||||||| ||||| |||||| |||| || ||| | |||||||| | ||| | | |||||| Sbjct: 813 accagacaaaagggcagctgttgcttctaaagaaccaggtgattgcgctgaagtccaagg 872 Query: 890 aggaggaggtggccaagaaggacgccgagatcgaacagaagctcaagaagctcaagaacc 949 ||||||||| |||| |||||||| ||| | | |||||| |||||||||||| | | Sbjct: 873 aggaggaggcagccatcaaggacgcagaggtgcagaggaagctgaagaagctcaaggagc 932 Query: 950 tggaggtggaggtgcttgagctgaggaggaagaacaaggagctgctgtatgagaagaggg 1009 |||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 933 tggaagtggaggtagttgagctgaggaggaagaacaaggagcttttgtatgagaaaaggg 992 Query: 1010 acctcatggtgaagctggatgcagcacaaggaaaaataacagagagtgatgtagttgccc 1069 | ||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 993 atctcatcgtaaagctggatgcagcacaaggaaaaataacagagagtgatgtagtttccc 1052 Query: 1070 atgcaagagaggagatcaataacctgagacatacaaatgaggacctcacaaagcaagtgg 1129 ||||||||||||||||||| || ||||| ||| ||||||| ||||| || |||||||| | Sbjct: 1053 atgcaagagaggagatcaacaagctgaggcatgcaaatgaagaccttaccaagcaagtag 1112 Query: 1130 aaggcctacagatgaacagattcagtgaagtagaggagctggtgtacctgcgttgggtca 1189 |||||||||| ||||||||||||||||||||||| ||| |||| |||||||||||||| | Sbjct: 1113 aaggcctacaaatgaacagattcagtgaagtagaagagttggtttacctgcgttgggtta 1172 Query: 1190 acgcctgtctgcgattcgagctccgcaactaccagacaccatcgggcaaaatctctgccc 1249 | || |||||| ||| |||||||||||||||||| |||| || | ||||| ||||| | Sbjct: 1173 atgcttgtctgagatatgagctccgcaactaccaggcaccgtctgagaaaatttctgctc 1232 Query: 1250 gcgacctcagcacgaagctcagcccaaagtctcaggagagggccaaacagatgatgctcg 1309 | ||||| | || || || |||||||| || | ||||||||||||| | ||||| | Sbjct: 1233 gtgaccttaacaagaccctgagcccaaaatcgcgtgagagggccaaacttctaatgctgg 1292 Query: 1310 aattt---gggtctgagcgaggccagggcgacactgaccttgacagtgtctcctcggcac 1366 ||| | || || || ||||| |||||||||||||||||||| | || || || |||| Sbjct: 1293 aatatgcaggatcagaacgaggacagggcgacactgaccttgaaactgcttcttctgcac 1352 Query: 1367 cttcttcccccagaagcgaagacttcgacaccgcttcgatcgacagctcttccggcagat 1426 ||||||| |||||||||||||||||||||| || ||| | ||||| ||||| |||||| Sbjct: 1353 cttcttcacccagaagcgaagacttcgacaacgtttcagttgacagttcttctagcagat 1412 Query: 1427 acagcttcctaagcaagaggccgaacctgatgcagaaactcaagaagtggggaaggagca 1486 |||||||| | |||| ||||| || |||||||| || |||||||||||||||||| ||| Sbjct: 1413 acagcttctttggcaaaaggcccaatctgatgcaaaagctcaagaagtggggaaggggca 1472 Query: 1487 aggatga 1493 ||||||| Sbjct: 1473 aggatga 1479 Score = 242 bits (122), Expect = 7e-60 Identities = 375/458 (81%), Gaps = 6/458 (1%) Strand = Plus / Plus Query: 1552 agccagaaaccaaagggccccctggaatctctcatgatcagaaatgcaggagatggtatg 1611 ||||||||||||||||| ||||| || |||||||| ||||||| ||||||||||||||| Sbjct: 1538 agccagaaaccaaaggggcccctagaggctctcatgctcagaaacgcaggagatggtatg 1597 Query: 1612 tccattacaacatttggaaaaagggatcaagaatccggtga---catagatgatgcaaat 1668 ||||||||| |||||||| ||||| ||||| || |||| ||| ||||| |||||| Sbjct: 1598 ggcattacaacctttggaaagagggaacaagatcccagtgatatcatggatgaggcaaat 1657 Query: 1669 gttgcatcttcattccagttgatgtcgaagaatgttgaaggcttcgctgatgaaaagtat 1728 |||||||||||||| || |||||||| |||| ||| |||| || |||||||| |||||| Sbjct: 1658 gttgcatcttcatttcatttgatgtcaaagactgtacaaggttttgctgatgacaagtat 1717 Query: 1729 cccgcttacaaagaccggcataagcttgcgacggaacgggagaaggcgataaaagagaag 1788 |||||||||||||| ||||||| || || || |||||||||||||| |||||||||||| Sbjct: 1718 cccgcttacaaagataggcataaactcgccacagaacgggagaaggcaataaaagagaag 1777 Query: 1789 gccgagcaagccagagcacaaaggtttggtggtggctatagttcagctctagctccttcc 1848 |||||| |||| || | |||||| | ||| |||| | | ||||||| | | | || || Sbjct: 1778 gccgagaaagctagggtacaaagatatggcggtgtcaacagttcaggtattgtgccatct 1837 Query: 1849 ccgagagctgcacttccccccaaactcgctcaaataaaggagaagaaggcccctgcagtc 1908 || ||| ||||||| || || ||||| ||||||||||||| | ||||| ||| ||| Sbjct: 1838 ccaagatctgcactccctccaaaacttgctcaaataaagg---aaaaggctcctacagct 1894 Query: 1909 aatgctgaatccggcgagcaatctagtgatatcccgaacaaccccctggctgtcacccag 1968 |||||||||||| | || ||| ||||||||| || ||||||||| || | ||| || || Sbjct: 1895 aatgctgaatccagtgaccaacctagtgataaccagaacaaccctctagttgtgacacaa 1954 Query: 1969 ttgaagcttgcccaaattgagaagagagctccaagagt 2006 |||| ||||| | ||||||||||||||||||||||| Sbjct: 1955 ctgaaacttgcaaatattgagaagagagctccaagagt 1992 Score = 73.8 bits (37), Expect = 4e-09 Identities = 52/57 (91%) Strand = Plus / Plus Query: 334 acatggggagaaagaagaggaggaggaagaggtcaagacgatcagcggcataatcaa 390 |||||||||||||||||| ||| |||||||||| || || ||||||||||||||||| Sbjct: 328 acatggggagaaagaagaagagaaggaagaggttaaaacaatcagcggcataatcaa 384 Score = 54.0 bits (27), Expect = 0.003 Identities = 51/59 (86%) Strand = Plus / Plus Query: 413 gatgaggacgacatgttctcggagatcgagagcctcctgggcggggagatcgacatccc 471 ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||| Sbjct: 398 gatgatgacgacatgctctccgagatcgagagcctcctatcaggggagattgacatccc 456
>dbj|AK099132.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023051M04, full insert sequence Length = 3065 Score = 670 bits (338), Expect = 0.0 Identities = 764/906 (84%) Strand = Plus / Plus Query: 2080 ccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccct 2139 ||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 1940 ccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggcccg 1999 Query: 2140 ccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggta 2199 || ||||| ||||| | || ||||| ||| | | || ||||||||||||||||||||| Sbjct: 2000 ccaccgccgccaccacgccctggttccctacctaggaatcttgctggtggtgacaaggta 2059 Query: 2200 caccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaag 2259 ||||||||||| ||||| || ||||||||||| ||||||||||| ||||||||||||||| Sbjct: 2060 caccgtgctccagaggttgtagagttctatcaaagtctcatgaagcgtgaagccaagaag 2119 Query: 2260 gacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgatt 2319 ||||| || ||| ||||||||| |||||| | ||| |||||| ||||||||||||||| Sbjct: 2120 gacacaacttctctgggatcaacaacatcaagtgtctctgatgtgagaagcaacatgatt 2179 Query: 2320 ggagagattgagaacagatcaacattcctattagctgtcaaagctgatgtggagacacaa 2379 |||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| Sbjct: 2180 ggagagattgagaatagatcaacattcctcttagctgtcaaagtggatgtggagacacaa 2239 Query: 2380 ggagaatttgtcgagtccctagcgggtgaggtccgagcagcaagattcgcgaatatcgat 2439 ||||| ||||| ||||| ||||| ||||||||||||||| || || | |||||||| Sbjct: 2240 ggagactttgttgagtctctagcaaatgaggtccgagcagctagttttgtaaatatcgac 2299 Query: 2440 gatgttgttgcatttgtacattggctggatgaagagttgtcattcttggttgatgagaga 2499 || ||||||||||||||| | ||||| ||||| || | || |||||||| |||||| | Sbjct: 2300 gacgttgttgcatttgtaaactggcttgatgaggaactatccttcttggtcgatgagcgg 2359 Query: 2500 gcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaagagaggccgcc 2559 ||||| |||||||| || ||||||||||||||||||||||||||| |||||||||| ||| Sbjct: 2360 gcagtactaaagcactttgattggccagagagcaaaactgatgcactaagagaggcagcc 2419 Query: 2560 tttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtcgatgatcca 2619 ||||||||||| |||||| | ||| |||| |||||| | | || ||| ||||||||| Sbjct: 2420 tttgagtatcaagacctgctaaaattagaacacaaggtttcgtcgtttactgatgatcca 2479 Query: 2620 aaacttccatgtgaagaagctttgaagaggatgtattcgttgcttgagaaagtggagcag 2679 || ||| |||||||||||||| | |||| ||||||||| |||||||| | |||||||||| Sbjct: 2480 aagcttgcatgtgaagaagctctcaagaagatgtattccttgcttgaaacagtggagcag 2539 Query: 2680 agtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaaggagtatgga 2739 |||||||| || || |||||||| ||||||||| ||| |||| |||| |||||||||| Sbjct: 2540 agtgtttatgcgctacttcgtactagagacatggccatatcacgctacagggagtatgga 2599 Query: 2740 ataccagttgattggttatctgattctggaaaagttggcaagatcaaactcgcgtcagtt 2799 ||||| || |||||| | |||||||| || |||||||||||||||| | || || ||| Sbjct: 2600 ataccggtggattggctgtctgattccggggtagttggcaagatcaaattggcatctgtt 2659 Query: 2800 cagctggcaaggaagtacatggagagggtcacgtcggagctcgacgcgttgcaaggcacg 2859 |||||||| | |||||| ||| | ||||| | | ||||| || || ||||||||||| Sbjct: 2660 cagctggcgaagaagtatatgaatagggttgccacagagctagatgccttgcaaggcacc 2719 Query: 2860 gacaaagagcccaacagggagttcttgcttctccagggcgtcagatttgccttccgtgtt 2919 || |||||||||||||| |||||||||||||| ||||| || |||||||| ||||| ||| Sbjct: 2720 gagaaagagcccaacagagagttcttgcttcttcagggtgtgagatttgctttccgagtt 2779 Query: 2920 catcagtttgctggaggcttcgacgcagacagcatgaaagtcttcgaggagctgagaagc 2979 ||||||||||| |||||||| |||| || |||||||| | || || ||||| |||||| Sbjct: 2780 catcagtttgccggaggctttgacgaggaaagcatgaaggcgtttgaagagctaagaagc 2839 Query: 2980 aagatg 2985 |||||| Sbjct: 2840 aagatg 2845 Score = 644 bits (325), Expect = 0.0 Identities = 807/967 (83%), Gaps = 3/967 (0%) Strand = Plus / Plus Query: 530 ccgagatggagcggctgcgcggcctggtgagggagctggaggagcgggaggtgaagctcg 589 ||||| ||||| ||||||| || || ||| | |||||||||||| |||| |||||||| | Sbjct: 399 ccgagctggagaggctgcgtggacttgtgcgtgagctggaggagagggaagtgaagcttg 458 Query: 590 agggcgagctgctcgagtactacggcctcaaggagcaggagaccgacgtgtccgagctgc 649 |||| |||||||| |||||||| ||||||||||| |||||||| || || ||||| | Sbjct: 459 agggagagctgctagagtactatggcctcaaggaacaggagactgatgttgtagagctac 518 Query: 650 agaagcagctcaagatcaagacggtggaggtcgacatgctcaacatcaccatcagctcgc 709 | | |||||||||||||||| ||||||| ||||||||||||| || ||||||| ||||| Sbjct: 519 acagacagctcaagatcaagatggtggagatcgacatgctcaaaatgaccatcaactcgc 578 Query: 710 tgcaggccgagagaaagaagctgcaggaggatgttgcccgtggcgctgccgccaagaagg 769 |||| | ||||| |||||||||||||| || || ||||||||| | | ||||||| || Sbjct: 579 tgcaagaggagaggaagaagctgcaggatgacgtcgcccgtggcacaggagccaagaggg 638 Query: 770 agctcgacgcgtccaggagcaggatcaaggagctgcagcgccagatacagatggaggcta 829 |||| || || | |||| || |||||||||||||||||| ||||||||||||||||| | Sbjct: 639 agctggaggctgcgaggaacaagatcaaggagctgcagcgacagatacagatggaggcga 698 Query: 830 accagaccaaaggccagctgatgctgctcaagcaacaggtgatggggctcagggccaagg 889 ||||||| ||||| |||||| |||| || ||| | |||||||| | ||| | | |||||| Sbjct: 699 accagacaaaagggcagctgttgcttctaaagaaccaggtgattgcgctgaagtccaagg 758 Query: 890 aggaggaggtggccaagaaggacgccgagatcgaacagaagctcaagaagctcaagaacc 949 ||||||||| |||| |||||||| ||| | | |||||| |||||||||||| | | Sbjct: 759 aggaggaggcagccatcaaggacgcagaggtgcagaggaagctgaagaagctcaaggagc 818 Query: 950 tggaggtggaggtgcttgagctgaggaggaagaacaaggagctgctgtatgagaagaggg 1009 |||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 819 tggaagtggaggtagttgagctgaggaggaagaacaaggagcttttgtatgagaaaaggg 878 Query: 1010 acctcatggtgaagctggatgcagcacaaggaaaaataacagagagtgatgtagttgccc 1069 | ||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 879 atctcatcgtaaagctggatgcagcacaaggaaaaataacagagagtgatgtagtttccc 938 Query: 1070 atgcaagagaggagatcaataacctgagacatacaaatgaggacctcacaaagcaagtgg 1129 ||||||||||||||||||| || ||||| ||| ||||||| ||||| || |||||||| | Sbjct: 939 atgcaagagaggagatcaacaagctgaggcatgcaaatgaagaccttaccaagcaagtag 998 Query: 1130 aaggcctacagatgaacagattcagtgaagtagaggagctggtgtacctgcgttgggtca 1189 |||||||||| ||||||||||||||||||||||| ||| |||| |||||||||||||| | Sbjct: 999 aaggcctacaaatgaacagattcagtgaagtagaagagttggtttacctgcgttgggtta 1058 Query: 1190 acgcctgtctgcgattcgagctccgcaactaccagacaccatcgggcaaaatctctgccc 1249 | || |||||| ||| |||||||||||||||||| |||| || | || || ||||| | Sbjct: 1059 atgcttgtctgagatatgagctccgcaactaccaggcaccgtctgagaagatttctgctc 1118 Query: 1250 gcgacctcagcacgaagctcagcccaaagtctcaggagagggccaaacagatgatgctcg 1309 | ||||| | || || || |||||||| || | ||||||||||||| | ||||| | Sbjct: 1119 gtgaccttaacaagaccctgagcccaaaatcgcgtgagagggccaaacttctaatgctgg 1178 Query: 1310 aattt---gggtctgagcgaggccagggcgacactgaccttgacagtgtctcctcggcac 1366 ||| | || || || ||||| |||||||||||||||||||| | || || || |||| Sbjct: 1179 aatatgcaggatcagaacgaggacagggcgacactgaccttgaaactgcttcttctgcac 1238 Query: 1367 cttcttcccccagaagcgaagacttcgacaccgcttcgatcgacagctcttccggcagat 1426 ||||||| |||||||||||||||||||||| || ||| | ||||| ||||| |||||| Sbjct: 1239 cttcttcacccagaagcgaagacttcgacaacgtttcagttgacagttcttctagcagat 1298 Query: 1427 acagcttcctaagcaagaggccgaacctgatgcagaaactcaagaagtggggaaggagca 1486 |||||||| | |||| ||||| || |||||||| || |||||||||||||||||| ||| Sbjct: 1299 acagcttctttggcaaaaggcccaatctgatgcaaaagctcaagaagtggggaaggggca 1358 Query: 1487 aggatga 1493 ||||||| Sbjct: 1359 aggatga 1365 Score = 242 bits (122), Expect = 7e-60 Identities = 375/458 (81%), Gaps = 6/458 (1%) Strand = Plus / Plus Query: 1552 agccagaaaccaaagggccccctggaatctctcatgatcagaaatgcaggagatggtatg 1611 ||||||||||||||||| ||||| || |||||||| ||||||| ||||||||||||||| Sbjct: 1424 agccagaaaccaaaggggcccctagaggctctcatgctcagaaacgcaggagatggtatg 1483 Query: 1612 tccattacaacatttggaaaaagggatcaagaatccggtga---catagatgatgcaaat 1668 ||||||||| |||||||| ||||| ||||| || |||| ||| ||||| |||||| Sbjct: 1484 ggcattacaacctttggaaagagggaacaagatcccagtgatatcatggatgaggcaaat 1543 Query: 1669 gttgcatcttcattccagttgatgtcgaagaatgttgaaggcttcgctgatgaaaagtat 1728 |||||||||||||| || |||||||| |||| ||| |||| || |||||||| |||||| Sbjct: 1544 gttgcatcttcatttcatttgatgtcaaagactgtacaaggttttgctgatgacaagtat 1603 Query: 1729 cccgcttacaaagaccggcataagcttgcgacggaacgggagaaggcgataaaagagaag 1788 |||||||||||||| ||||||| || || || |||||||||||||| |||||||||||| Sbjct: 1604 cccgcttacaaagataggcataaactcgccacagaacgggagaaggcaataaaagagaag 1663 Query: 1789 gccgagcaagccagagcacaaaggtttggtggtggctatagttcagctctagctccttcc 1848 |||||| |||| || | |||||| | ||| |||| | | ||||||| | | | || || Sbjct: 1664 gccgagaaagctagggtacaaagatatggcggtgtcaacagttcaggtattgtgccatct 1723 Query: 1849 ccgagagctgcacttccccccaaactcgctcaaataaaggagaagaaggcccctgcagtc 1908 || ||| ||||||| || || ||||| ||||||||||||| | ||||| ||| ||| Sbjct: 1724 ccaagatctgcactccctccaaaacttgctcaaataaagg---aaaaggctcctacagct 1780 Query: 1909 aatgctgaatccggcgagcaatctagtgatatcccgaacaaccccctggctgtcacccag 1968 |||||||||||| | || ||| ||||||||| || ||||||||| || | ||| || || Sbjct: 1781 aatgctgaatccagtgaccaacctagtgataaccagaacaaccctctagttgtgacacaa 1840 Query: 1969 ttgaagcttgcccaaattgagaagagagctccaagagt 2006 |||| ||||| | ||||||||||||||||||||||| Sbjct: 1841 ctgaaacttgcaaatattgagaagagagctccaagagt 1878 Score = 73.8 bits (37), Expect = 4e-09 Identities = 52/57 (91%) Strand = Plus / Plus Query: 334 acatggggagaaagaagaggaggaggaagaggtcaagacgatcagcggcataatcaa 390 |||||||||||||||||| ||| |||||||||| || || ||||||||||||||||| Sbjct: 214 acatggggagaaagaagaagagaaggaagaggttaaaacaatcagcggcataatcaa 270 Score = 54.0 bits (27), Expect = 0.003 Identities = 51/59 (86%) Strand = Plus / Plus Query: 413 gatgaggacgacatgttctcggagatcgagagcctcctgggcggggagatcgacatccc 471 ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||| Sbjct: 284 gatgatgacgacatgctctccgagatcgagagcctcctatcaggggagattgacatccc 342
>dbj|AK072914.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023150I16, full insert sequence Length = 3183 Score = 670 bits (338), Expect = 0.0 Identities = 764/906 (84%) Strand = Plus / Plus Query: 2080 ccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccct 2139 ||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 2055 ccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggcccg 2114 Query: 2140 ccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggta 2199 || ||||| ||||| | || ||||| ||| | | || ||||||||||||||||||||| Sbjct: 2115 ccaccgccgccaccacgccctggttccctacctaggaatcttgctggtggtgacaaggta 2174 Query: 2200 caccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaag 2259 ||||||||||| ||||| || ||||||||||| ||||||||||| ||||||||||||||| Sbjct: 2175 caccgtgctccagaggttgtagagttctatcaaagtctcatgaagcgtgaagccaagaag 2234 Query: 2260 gacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgatt 2319 ||||| || ||| ||||||||| |||||| | ||| |||||| ||||||||||||||| Sbjct: 2235 gacacaacttctctgggatcaacaacatcaagtgtctctgatgtgagaagcaacatgatt 2294 Query: 2320 ggagagattgagaacagatcaacattcctattagctgtcaaagctgatgtggagacacaa 2379 |||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| Sbjct: 2295 ggagagattgagaatagatcaacattcctcttagctgtcaaagtggatgtggagacacaa 2354 Query: 2380 ggagaatttgtcgagtccctagcgggtgaggtccgagcagcaagattcgcgaatatcgat 2439 ||||| ||||| ||||| ||||| ||||||||||||||| || || | |||||||| Sbjct: 2355 ggagactttgttgagtctctagcaaatgaggtccgagcagctagttttgtaaatatcgac 2414 Query: 2440 gatgttgttgcatttgtacattggctggatgaagagttgtcattcttggttgatgagaga 2499 || ||||||||||||||| | ||||| ||||| || | || |||||||| |||||| | Sbjct: 2415 gacgttgttgcatttgtaaactggcttgatgaggaactatccttcttggtcgatgagcgg 2474 Query: 2500 gcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaagagaggccgcc 2559 ||||| |||||||| || ||||||||||||||||||||||||||| |||||||||| ||| Sbjct: 2475 gcagtactaaagcactttgattggccagagagcaaaactgatgcactaagagaggcagcc 2534 Query: 2560 tttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtcgatgatcca 2619 ||||||||||| |||||| | ||| |||| |||||| | | || ||| ||||||||| Sbjct: 2535 tttgagtatcaagacctgctaaaattagaacacaaggtttcgtcgtttactgatgatcca 2594 Query: 2620 aaacttccatgtgaagaagctttgaagaggatgtattcgttgcttgagaaagtggagcag 2679 || ||| |||||||||||||| | |||| ||||||||| |||||||| | |||||||||| Sbjct: 2595 aagcttgcatgtgaagaagctctcaagaagatgtattccttgcttgaaacagtggagcag 2654 Query: 2680 agtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaaggagtatgga 2739 |||||||| || || |||||||| ||||||||| ||| |||| |||| |||||||||| Sbjct: 2655 agtgtttatgcgctacttcgtactagagacatggccatatcacgctacagggagtatgga 2714 Query: 2740 ataccagttgattggttatctgattctggaaaagttggcaagatcaaactcgcgtcagtt 2799 ||||| || |||||| | |||||||| || |||||||||||||||| | || || ||| Sbjct: 2715 ataccggtggattggctgtctgattccggggtagttggcaagatcaaattggcatctgtt 2774 Query: 2800 cagctggcaaggaagtacatggagagggtcacgtcggagctcgacgcgttgcaaggcacg 2859 |||||||| | |||||| ||| | ||||| | | ||||| || || ||||||||||| Sbjct: 2775 cagctggcgaagaagtatatgaatagggttgccacagagctagatgccttgcaaggcacc 2834 Query: 2860 gacaaagagcccaacagggagttcttgcttctccagggcgtcagatttgccttccgtgtt 2919 || |||||||||||||| |||||||||||||| ||||| || |||||||| ||||| ||| Sbjct: 2835 gagaaagagcccaacagagagttcttgcttcttcagggtgtgagatttgctttccgagtt 2894 Query: 2920 catcagtttgctggaggcttcgacgcagacagcatgaaagtcttcgaggagctgagaagc 2979 ||||||||||| |||||||| |||| || |||||||| | || || ||||| |||||| Sbjct: 2895 catcagtttgccggaggctttgacgaggaaagcatgaaggcgtttgaagagctaagaagc 2954 Query: 2980 aagatg 2985 |||||| Sbjct: 2955 aagatg 2960 Score = 644 bits (325), Expect = 0.0 Identities = 807/967 (83%), Gaps = 3/967 (0%) Strand = Plus / Plus Query: 530 ccgagatggagcggctgcgcggcctggtgagggagctggaggagcgggaggtgaagctcg 589 ||||| ||||| ||||||| || || ||| | |||||||||||| |||| |||||||| | Sbjct: 514 ccgagctggagaggctgcgtggacttgtgcgtgagctggaggagagggaagtgaagcttg 573 Query: 590 agggcgagctgctcgagtactacggcctcaaggagcaggagaccgacgtgtccgagctgc 649 |||| |||||||| |||||||| ||||||||||| |||||||| || || ||||| | Sbjct: 574 agggagagctgctagagtactatggcctcaaggaacaggagactgatgttgtagagctac 633 Query: 650 agaagcagctcaagatcaagacggtggaggtcgacatgctcaacatcaccatcagctcgc 709 | | |||||||||||||||| ||||||| ||||||||||||| || ||||||| ||||| Sbjct: 634 acagacagctcaagatcaagatggtggagatcgacatgctcaaaatgaccatcaactcgc 693 Query: 710 tgcaggccgagagaaagaagctgcaggaggatgttgcccgtggcgctgccgccaagaagg 769 |||| | ||||| |||||||||||||| || || ||||||||| | | ||||||| || Sbjct: 694 tgcaagaggagaggaagaagctgcaggatgacgtcgcccgtggcacaggagccaagaggg 753 Query: 770 agctcgacgcgtccaggagcaggatcaaggagctgcagcgccagatacagatggaggcta 829 |||| || || | |||| || |||||||||||||||||| ||||||||||||||||| | Sbjct: 754 agctggaggctgcgaggaacaagatcaaggagctgcagcgacagatacagatggaggcga 813 Query: 830 accagaccaaaggccagctgatgctgctcaagcaacaggtgatggggctcagggccaagg 889 ||||||| ||||| |||||| |||| || ||| | |||||||| | ||| | |||||| Sbjct: 814 accagacaaaagggcagctgttgcttctaaagaaccaggtgattgcgctggagtccaagg 873 Query: 890 aggaggaggtggccaagaaggacgccgagatcgaacagaagctcaagaagctcaagaacc 949 ||||||||| |||| |||||||| ||| | | |||||| |||||||||||| | | Sbjct: 874 aggaggaggcagccatcaaggacgcagaggtgcagaggaagctgaagaagctcaaggagc 933 Query: 950 tggaggtggaggtgcttgagctgaggaggaagaacaaggagctgctgtatgagaagaggg 1009 |||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 934 tggaagtggaggtagttgagctgaggaggaagaacaaggagcttttgtatgagaaaaggg 993 Query: 1010 acctcatggtgaagctggatgcagcacaaggaaaaataacagagagtgatgtagttgccc 1069 | ||||| || ||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 994 atctcatcgtaaagctggatgcagcacaaggaaaaataacagagagtgatgtagtttccc 1053 Query: 1070 atgcaagagaggagatcaataacctgagacatacaaatgaggacctcacaaagcaagtgg 1129 ||||||||||||||||||| || ||||| ||| ||||||| ||||| || |||||||| | Sbjct: 1054 atgcaagagaggagatcaacaagctgaggcatgcaaatgaagaccttaccaagcaagtag 1113 Query: 1130 aaggcctacagatgaacagattcagtgaagtagaggagctggtgtacctgcgttgggtca 1189 |||||||||| ||||||||||||||||||||||| ||| |||| |||||||||||||| | Sbjct: 1114 aaggcctacaaatgaacagattcagtgaagtagaagagttggtttacctgcgttgggtta 1173 Query: 1190 acgcctgtctgcgattcgagctccgcaactaccagacaccatcgggcaaaatctctgccc 1249 | || |||||| ||| |||||||||||||||||| |||| || | ||||| ||||| | Sbjct: 1174 atgcttgtctgagatatgagctccgcaactaccaggcaccgtctgagaaaatttctgctc 1233 Query: 1250 gcgacctcagcacgaagctcagcccaaagtctcaggagagggccaaacagatgatgctcg 1309 | ||||| | || || || |||||||| || | ||||||||||||| | ||||| | Sbjct: 1234 gtgaccttaacaagaccctgagcccaaaatcgcgtgagagggccaaacttctaatgctgg 1293 Query: 1310 aattt---gggtctgagcgaggccagggcgacactgaccttgacagtgtctcctcggcac 1366 ||| | || || || ||||| |||||||||||||||||||| | || || || |||| Sbjct: 1294 aatatgcaggatcagaacgaggacagggcgacactgaccttgaaactgcttcttctgcac 1353 Query: 1367 cttcttcccccagaagcgaagacttcgacaccgcttcgatcgacagctcttccggcagat 1426 ||||||| |||||||||||||||||||||| || ||| | ||||| ||||| |||||| Sbjct: 1354 cttcttcacccagaagcgaagacttcgacaacgtttcagttgacagttcttctagcagat 1413 Query: 1427 acagcttcctaagcaagaggccgaacctgatgcagaaactcaagaagtggggaaggagca 1486 |||||||| | |||| ||||| || |||||||| || |||||||||||||||||| ||| Sbjct: 1414 acagcttctttggcaaaaggcccaatctgatgcaaaagctcaagaagtggggaaggggca 1473 Query: 1487 aggatga 1493 ||||||| Sbjct: 1474 aggatga 1480 Score = 242 bits (122), Expect = 7e-60 Identities = 375/458 (81%), Gaps = 6/458 (1%) Strand = Plus / Plus Query: 1552 agccagaaaccaaagggccccctggaatctctcatgatcagaaatgcaggagatggtatg 1611 ||||||||||||||||| ||||| || |||||||| ||||||| ||||||||||||||| Sbjct: 1539 agccagaaaccaaaggggcccctagaggctctcatgctcagaaacgcaggagatggtatg 1598 Query: 1612 tccattacaacatttggaaaaagggatcaagaatccggtga---catagatgatgcaaat 1668 ||||||||| |||||||| ||||| ||||| || |||| ||| ||||| |||||| Sbjct: 1599 ggcattacaacctttggaaagagggaacaagatcccagtgatatcatggatgaggcaaat 1658 Query: 1669 gttgcatcttcattccagttgatgtcgaagaatgttgaaggcttcgctgatgaaaagtat 1728 |||||||||||||| || |||||||| |||| ||| |||| || |||||||| |||||| Sbjct: 1659 gttgcatcttcatttcatttgatgtcaaagactgtacaaggttttgctgatgacaagtat 1718 Query: 1729 cccgcttacaaagaccggcataagcttgcgacggaacgggagaaggcgataaaagagaag 1788 |||||||||||||| ||||||| || || || |||||||||||||| |||||||||||| Sbjct: 1719 cccgcttacaaagataggcataaactcgccacagaacgggagaaggcaataaaagagaag 1778 Query: 1789 gccgagcaagccagagcacaaaggtttggtggtggctatagttcagctctagctccttcc 1848 |||||| |||| || | |||||| | ||| |||| | | ||||||| | | | || || Sbjct: 1779 gccgagaaagctagggtacaaagatatggcggtgtcaacagttcaggtattgtgccatct 1838 Query: 1849 ccgagagctgcacttccccccaaactcgctcaaataaaggagaagaaggcccctgcagtc 1908 || ||| ||||||| || || ||||| ||||||||||||| | ||||| ||| ||| Sbjct: 1839 ccaagatctgcactccctccaaaacttgctcaaataaagg---aaaaggctcctacagct 1895 Query: 1909 aatgctgaatccggcgagcaatctagtgatatcccgaacaaccccctggctgtcacccag 1968 |||||||||||| | || ||| ||||||||| || ||||||||| || | ||| || || Sbjct: 1896 aatgctgaatccagtgaccaacctagtgataaccagaacaaccctctagttgtgacacaa 1955 Query: 1969 ttgaagcttgcccaaattgagaagagagctccaagagt 2006 |||| ||||| | ||||||||||||||||||||||| Sbjct: 1956 ctgaaacttgcaaatattgagaagagagctccaagagt 1993 Score = 73.8 bits (37), Expect = 4e-09 Identities = 52/57 (91%) Strand = Plus / Plus Query: 334 acatggggagaaagaagaggaggaggaagaggtcaagacgatcagcggcataatcaa 390 |||||||||||||||||| ||| |||||||||| || || ||||||||||||||||| Sbjct: 329 acatggggagaaagaagaagagaaggaagaggttaaaacaatcagcggcataatcaa 385 Score = 54.0 bits (27), Expect = 0.003 Identities = 51/59 (86%) Strand = Plus / Plus Query: 413 gatgaggacgacatgttctcggagatcgagagcctcctgggcggggagatcgacatccc 471 ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||| Sbjct: 399 gatgatgacgacatgctctccgagatcgagagcctcctatcaggggagattgacatccc 457
>dbj|AK062121.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-045-D01, full insert sequence Length = 1478 Score = 670 bits (338), Expect = 0.0 Identities = 764/906 (84%) Strand = Plus / Plus Query: 2080 ccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccct 2139 ||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 353 ccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggcccg 412 Query: 2140 ccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggta 2199 || ||||| ||||| | || ||||| ||| | | || ||||||||||||||||||||| Sbjct: 413 ccaccgccgccaccacgccctggttccctacctaggaatcttgctggtggtgacaaggta 472 Query: 2200 caccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaag 2259 ||||||||||| ||||| || ||||||||||| ||||||||||| ||||||||||||||| Sbjct: 473 caccgtgctccagaggttgtagagttctatcaaagtctcatgaagcgtgaagccaagaag 532 Query: 2260 gacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgatt 2319 ||||| || ||| ||||||||| |||||| | ||| |||||| ||||||||||||||| Sbjct: 533 gacacaacttctctgggatcaacaacatcaagtgtctctgatgtgagaagcaacatgatt 592 Query: 2320 ggagagattgagaacagatcaacattcctattagctgtcaaagctgatgtggagacacaa 2379 |||||||||||||| |||||||||||||| ||||||||||||| ||||||||||||||| Sbjct: 593 ggagagattgagaatagatcaacattcctcttagctgtcaaagtggatgtggagacacaa 652 Query: 2380 ggagaatttgtcgagtccctagcgggtgaggtccgagcagcaagattcgcgaatatcgat 2439 ||||| ||||| ||||| ||||| ||||||||||||||| || || | |||||||| Sbjct: 653 ggagactttgttgagtctctagcaaatgaggtccgagcagctagttttgtaaatatcgac 712 Query: 2440 gatgttgttgcatttgtacattggctggatgaagagttgtcattcttggttgatgagaga 2499 || ||||||||||||||| | ||||| ||||| || | || |||||||| |||||| | Sbjct: 713 gacgttgttgcatttgtaaactggcttgatgaggaactatccttcttggtcgatgagcgg 772 Query: 2500 gcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaagagaggccgcc 2559 ||||| |||||||| || ||||||||||||||||||||||||||| |||||||||| ||| Sbjct: 773 gcagtactaaagcactttgattggccagagagcaaaactgatgcactaagagaggcagcc 832 Query: 2560 tttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtcgatgatcca 2619 ||||||||||| |||||| | ||| |||| |||||| | | || ||| ||||||||| Sbjct: 833 tttgagtatcaagacctgctaaaattagaacacaaggtttcgtcgtttactgatgatcca 892 Query: 2620 aaacttccatgtgaagaagctttgaagaggatgtattcgttgcttgagaaagtggagcag 2679 || ||| |||||||||||||| | |||| ||||||||| |||||||| | |||||||||| Sbjct: 893 aagcttgcatgtgaagaagctctcaagaagatgtattccttgcttgaaacagtggagcag 952 Query: 2680 agtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaaggagtatgga 2739 |||||||| || || |||||||| ||||||||| ||| |||| |||| |||||||||| Sbjct: 953 agtgtttatgcgctacttcgtactagagacatggccatatcacgctacagggagtatgga 1012 Query: 2740 ataccagttgattggttatctgattctggaaaagttggcaagatcaaactcgcgtcagtt 2799 ||||| || |||||| | |||||||| || |||||||||||||||| | || || ||| Sbjct: 1013 ataccggtggattggctgtctgattccggggtagttggcaagatcaaattggcatctgtt 1072 Query: 2800 cagctggcaaggaagtacatggagagggtcacgtcggagctcgacgcgttgcaaggcacg 2859 |||||||| | |||||| ||| | ||||| | | ||||| || || ||||||||||| Sbjct: 1073 cagctggcgaagaagtatatgaatagggttgccacagagctagatgccttgcaaggcacc 1132 Query: 2860 gacaaagagcccaacagggagttcttgcttctccagggcgtcagatttgccttccgtgtt 2919 || |||||||||||||| |||||||||||||| ||||| || |||||||| ||||| ||| Sbjct: 1133 gagaaagagcccaacagagagttcttgcttcttcagggtgtgagatttgctttccgagtt 1192 Query: 2920 catcagtttgctggaggcttcgacgcagacagcatgaaagtcttcgaggagctgagaagc 2979 ||||||||||| |||||||| |||| || |||||||| | || || ||||| |||||| Sbjct: 1193 catcagtttgccggaggctttgacgaggaaagcatgaaggcgtttgaagagctaagaagc 1252 Query: 2980 aagatg 2985 |||||| Sbjct: 1253 aagatg 1258 Score = 133 bits (67), Expect = 4e-27 Identities = 237/293 (80%), Gaps = 3/293 (1%) Strand = Plus / Plus Query: 1714 gctgatgaaaagtatcccgcttacaaagaccggcataagcttgcgacggaacgggagaag 1773 |||||||| |||||||||||||||||||| ||||||| || || || |||||||||||| Sbjct: 2 gctgatgacaagtatcccgcttacaaagataggcataaactcgccacagaacgggagaag 61 Query: 1774 gcgataaaagagaaggccgagcaagccagagcacaaaggtttggtggtggctatagttca 1833 || |||||||||||||||||| |||| || | |||||| | ||| |||| | | |||||| Sbjct: 62 gcaataaaagagaaggccgagaaagctagggtacaaagatatggcggtgtcaacagttca 121 Query: 1834 gctctagctccttccccgagagctgcacttccccccaaactcgctcaaataaaggagaag 1893 | | | | || || || ||| ||||||| || || ||||| ||||||||||||| | Sbjct: 122 ggtattgtgccatctccaagatctgcactccctccaaaacttgctcaaataaagg---aa 178 Query: 1894 aaggcccctgcagtcaatgctgaatccggcgagcaatctagtgatatcccgaacaacccc 1953 ||||| ||| ||| |||||||||||| | || ||| ||||||||| || ||||||||| Sbjct: 179 aaggctcctacagctaatgctgaatccagtgaccaacctagtgataaccagaacaaccct 238 Query: 1954 ctggctgtcacccagttgaagcttgcccaaattgagaagagagctccaagagt 2006 || | ||| || || |||| ||||| | ||||||||||||||||||||||| Sbjct: 239 ctagttgtgacacaactgaaacttgcaaatattgagaagagagctccaagagt 291
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12 Length = 27566993 Score = 365 bits (184), Expect = 7e-97 Identities = 439/524 (83%) Strand = Plus / Minus Query: 530 ccgagatggagcggctgcgcggcctggtgagggagctggaggagcgggaggtgaagctcg 589 ||||| ||||| ||||||| || || ||| | |||||||||||| |||| |||||||| | Sbjct: 280364 ccgagctggagaggctgcgtggacttgtgcgtgagctggaggagagggaagtgaagcttg 280305 Query: 590 agggcgagctgctcgagtactacggcctcaaggagcaggagaccgacgtgtccgagctgc 649 |||| |||||||| |||||||| ||||||||||| |||||||| || || ||||| | Sbjct: 280304 agggagagctgctagagtactatggcctcaaggaacaggagactgatgttgtagagctac 280245 Query: 650 agaagcagctcaagatcaagacggtggaggtcgacatgctcaacatcaccatcagctcgc 709 | | |||||||||||||||| ||||||| ||||||||||||| || ||||||| ||||| Sbjct: 280244 acagacagctcaagatcaagatggtggagatcgacatgctcaaaatgaccatcaactcgc 280185 Query: 710 tgcaggccgagagaaagaagctgcaggaggatgttgcccgtggcgctgccgccaagaagg 769 |||| | ||||| |||||||||||||| || || ||||||||| | | ||||||| || Sbjct: 280184 tgcaagaggagaggaagaagctgcaggatgacgtcgcccgtggcacaggagccaagaggg 280125 Query: 770 agctcgacgcgtccaggagcaggatcaaggagctgcagcgccagatacagatggaggcta 829 |||| || || | |||| || |||||||||||||||||| ||||||||||||||||| | Sbjct: 280124 agctggaggctgcgaggaacaagatcaaggagctgcagcgacagatacagatggaggcga 280065 Query: 830 accagaccaaaggccagctgatgctgctcaagcaacaggtgatggggctcagggccaagg 889 ||||||| ||||| |||||| |||| || ||| | |||||||| | ||| | | |||||| Sbjct: 280064 accagacaaaagggcagctgttgcttctaaagaaccaggtgattgcgctgaagtccaagg 280005 Query: 890 aggaggaggtggccaagaaggacgccgagatcgaacagaagctcaagaagctcaagaacc 949 ||||||||| |||| |||||||| ||| | | |||||| |||||||||||| | | Sbjct: 280004 aggaggaggcagccatcaaggacgcagaggtgcagaggaagctgaagaagctcaaggagc 279945 Query: 950 tggaggtggaggtgcttgagctgaggaggaagaacaaggagctgctgtatgagaagaggg 1009 |||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 279944 tggaagtggaggtagttgagctgaggaggaagaacaaggagcttttgtatgagaaaaggg 279885 Query: 1010 acctcatggtgaagctggatgcagcacaaggaaaaataacagag 1053 | ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 279884 atctcatcgtaaagctggatgcagcacaaggaaaaataacagag 279841 Score = 291 bits (147), Expect = 8e-75 Identities = 371/445 (83%), Gaps = 3/445 (0%) Strand = Plus / Minus Query: 1052 agagtgatgtagttgcccatgcaagagaggagatcaataacctgagacatacaaatgagg 1111 |||||||||||||| |||||||||||||||||||||| || ||||| ||| ||||||| | Sbjct: 276332 agagtgatgtagtttcccatgcaagagaggagatcaacaagctgaggcatgcaaatgaag 276273 Query: 1112 acctcacaaagcaagtggaaggcctacagatgaacagattcagtgaagtagaggagctgg 1171 |||| || |||||||| ||||||||||| ||||||||||||||||||||||| ||| ||| Sbjct: 276272 accttaccaagcaagtagaaggcctacaaatgaacagattcagtgaagtagaagagttgg 276213 Query: 1172 tgtacctgcgttgggtcaacgcctgtctgcgattcgagctccgcaactaccagacaccat 1231 | |||||||||||||| || || |||||| ||| |||||||||||||||||| |||| | Sbjct: 276212 tttacctgcgttgggttaatgcttgtctgagatatgagctccgcaactaccaggcaccgt 276153 Query: 1232 cgggcaaaatctctgcccgcgacctcagcacgaagctcagcccaaagtctcaggagaggg 1291 | | ||||| ||||| || ||||| | || || || |||||||| || | ||||||| Sbjct: 276152 ctgagaaaatttctgctcgtgaccttaacaagaccctgagcccaaaatcgcgtgagaggg 276093 Query: 1292 ccaaacagatgatgctcgaattt---gggtctgagcgaggccagggcgacactgaccttg 1348 |||||| | ||||| |||| | || || || ||||| ||||||||||||||||||| Sbjct: 276092 ccaaacttctaatgctggaatatgcaggatcagaacgaggacagggcgacactgaccttg 276033 Query: 1349 acagtgtctcctcggcaccttcttcccccagaagcgaagacttcgacaccgcttcgatcg 1408 | | || || || ||||||||||| |||||||||||||||||||||| || ||| | | Sbjct: 276032 aaactgcttcttctgcaccttcttcacccagaagcgaagacttcgacaacgtttcagttg 275973 Query: 1409 acagctcttccggcagatacagcttcctaagcaagaggccgaacctgatgcagaaactca 1468 |||| ||||| |||||||||||||| | |||| ||||| || |||||||| || |||| Sbjct: 275972 acagttcttctagcagatacagcttctttggcaaaaggcccaatctgatgcaaaagctca 275913 Query: 1469 agaagtggggaaggagcaaggatga 1493 |||||||||||||| |||||||||| Sbjct: 275912 agaagtggggaaggggcaaggatga 275888 Score = 266 bits (134), Expect = 5e-67 Identities = 242/278 (87%) Strand = Plus / Minus Query: 2080 ccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccct 2139 ||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 275313 ccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggcccg 275254 Query: 2140 ccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggta 2199 || ||||| ||||| | || ||||| ||| | | || ||||||||||||||||||||| Sbjct: 275253 ccaccgccgccaccacgccctggttccctacctaggaatcttgctggtggtgacaaggta 275194 Query: 2200 caccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaag 2259 ||||||||||| ||||| || ||||||||||| ||||||||||| ||||||||||||||| Sbjct: 275193 caccgtgctccagaggttgtagagttctatcaaagtctcatgaagcgtgaagccaagaag 275134 Query: 2260 gacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgatt 2319 ||||| || ||| ||||||||| |||||| | ||| |||||| ||||||||||||||| Sbjct: 275133 gacacaacttctctgggatcaacaacatcaagtgtctctgatgtgagaagcaacatgatt 275074 Query: 2320 ggagagattgagaacagatcaacattcctattagctgt 2357 |||||||||||||| |||||||||||||| |||||||| Sbjct: 275073 ggagagattgagaatagatcaacattcctcttagctgt 275036 Score = 242 bits (122), Expect = 7e-60 Identities = 375/458 (81%), Gaps = 6/458 (1%) Strand = Plus / Minus Query: 1552 agccagaaaccaaagggccccctggaatctctcatgatcagaaatgcaggagatggtatg 1611 ||||||||||||||||| ||||| || |||||||| ||||||| ||||||||||||||| Sbjct: 275829 agccagaaaccaaaggggcccctagaggctctcatgctcagaaacgcaggagatggtatg 275770 Query: 1612 tccattacaacatttggaaaaagggatcaagaatccggtga---catagatgatgcaaat 1668 ||||||||| |||||||| ||||| ||||| || |||| ||| ||||| |||||| Sbjct: 275769 ggcattacaacctttggaaagagggaacaagatcccagtgatatcatggatgaggcaaat 275710 Query: 1669 gttgcatcttcattccagttgatgtcgaagaatgttgaaggcttcgctgatgaaaagtat 1728 |||||||||||||| || |||||||| |||| ||| |||| || |||||||| |||||| Sbjct: 275709 gttgcatcttcatttcatttgatgtcaaagactgtacaaggttttgctgatgacaagtat 275650 Query: 1729 cccgcttacaaagaccggcataagcttgcgacggaacgggagaaggcgataaaagagaag 1788 |||||||||||||| ||||||| || || || |||||||||||||| |||||||||||| Sbjct: 275649 cccgcttacaaagataggcataaactcgccacagaacgggagaaggcaataaaagagaag 275590 Query: 1789 gccgagcaagccagagcacaaaggtttggtggtggctatagttcagctctagctccttcc 1848 |||||| |||| || | |||||| | ||| |||| | | ||||||| | | | || || Sbjct: 275589 gccgagaaagctagggtacaaagatatggcggtgtcaacagttcaggtattgtgccatct 275530 Query: 1849 ccgagagctgcacttccccccaaactcgctcaaataaaggagaagaaggcccctgcagtc 1908 || ||| ||||||| || || ||||| ||||||||||||| | ||||| ||| ||| Sbjct: 275529 ccaagatctgcactccctccaaaacttgctcaaataaagg---aaaaggctcctacagct 275473 Query: 1909 aatgctgaatccggcgagcaatctagtgatatcccgaacaaccccctggctgtcacccag 1968 |||||||||||| | || ||| ||||||||| || ||||||||| || | ||| || || Sbjct: 275472 aatgctgaatccagtgaccaacctagtgataaccagaacaaccctctagttgtgacacaa 275413 Query: 1969 ttgaagcttgcccaaattgagaagagagctccaagagt 2006 |||| ||||| | ||||||||||||||||||||||| Sbjct: 275412 ctgaaacttgcaaatattgagaagagagctccaagagt 275375 Score = 143 bits (72), Expect = 5e-30 Identities = 150/176 (85%) Strand = Plus / Minus Query: 2491 gatgagagagcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaaga 2550 |||||| | ||||| |||||||| || ||||||||||||||||||||||||||| ||||| Sbjct: 274699 gatgagcgggcagtactaaagcactttgattggccagagagcaaaactgatgcactaaga 274640 Query: 2551 gaggccgcctttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtc 2610 ||||| |||||||||||||| |||||| | ||| |||| |||||| | | || ||| Sbjct: 274639 gaggcagcctttgagtatcaagacctgctaaaattagaacacaaggtttcgtcgtttact 274580 Query: 2611 gatgatccaaaacttccatgtgaagaagctttgaagaggatgtattcgttgcttga 2666 ||||||||||| ||| |||||||||||||| | |||| ||||||||| |||||||| Sbjct: 274579 gatgatccaaagcttgcatgtgaagaagctctcaagaagatgtattccttgcttga 274524 Score = 91.7 bits (46), Expect = 2e-14 Identities = 70/78 (89%) Strand = Plus / Minus Query: 2848 ttgcaaggcacggacaaagagcccaacagggagttcttgcttctccagggcgtcagattt 2907 ||||||||||| || |||||||||||||| |||||||||||||| ||||| || |||||| Sbjct: 274103 ttgcaaggcaccgagaaagagcccaacagagagttcttgcttcttcagggtgtgagattt 274044 Query: 2908 gccttccgtgttcatcag 2925 || ||||| ||||||||| Sbjct: 274043 gctttccgagttcatcag 274026 Score = 87.7 bits (44), Expect = 2e-13 Identities = 98/116 (84%) Strand = Plus / Minus Query: 2356 gtcaaagctgatgtggagacacaaggagaatttgtcgagtccctagcgggtgaggtccga 2415 ||||||| |||||||||||||||||||| ||||| ||||| ||||| |||||||||| Sbjct: 274912 gtcaaagtggatgtggagacacaaggagactttgttgagtctctagcaaatgaggtccga 274853 Query: 2416 gcagcaagattcgcgaatatcgatgatgttgttgcatttgtacattggctggatga 2471 ||||| || || | |||||||| || ||||||||||||||| | ||||| ||||| Sbjct: 274852 gcagctagttttgtaaatatcgacgacgttgttgcatttgtaaactggcttgatga 274797 Score = 79.8 bits (40), Expect = 6e-11 Identities = 82/96 (85%) Strand = Plus / Minus Query: 2670 agtggagcagagtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaa 2729 |||||||||||||||||| || || |||||||| ||||||||| ||| |||| |||| Sbjct: 274375 agtggagcagagtgtttatgcgctacttcgtactagagacatggccatatcacgctacag 274316 Query: 2730 ggagtatggaataccagttgattggttatctgattc 2765 ||||||||||||||| || |||||| | |||||||| Sbjct: 274315 ggagtatggaataccggtggattggctgtctgattc 274280 Score = 65.9 bits (33), Expect = 9e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagaggtcaagacgatcagcggcataatcaa 390 |||||||||||||| ||| |||||||||| || || ||||||||||||||||| Sbjct: 280545 ggggagaaagaagaagagaaggaagaggttaaaacaatcagcggcataatcaa 280493 Score = 54.0 bits (27), Expect = 0.003 Identities = 51/59 (86%) Strand = Plus / Minus Query: 413 gatgaggacgacatgttctcggagatcgagagcctcctgggcggggagatcgacatccc 471 ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||| Sbjct: 280479 gatgatgacgacatgctctccgagatcgagagcctcctatcaggggagattgacatccc 280421
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11 Length = 28386948 Score = 365 bits (184), Expect = 7e-97 Identities = 439/524 (83%) Strand = Plus / Minus Query: 530 ccgagatggagcggctgcgcggcctggtgagggagctggaggagcgggaggtgaagctcg 589 ||||| ||||| ||||||| || || ||| | |||||||||||| |||| |||||||| | Sbjct: 259656 ccgagctggagaggctgcgtggacttgtgcgtgagctggaggagagggaagtgaagcttg 259597 Query: 590 agggcgagctgctcgagtactacggcctcaaggagcaggagaccgacgtgtccgagctgc 649 |||| |||||||| |||||||| ||||||||||| |||||||| || || ||||| | Sbjct: 259596 agggagagctgctggagtactatggcctcaaggaacaggagactgatgttgtagagctac 259537 Query: 650 agaagcagctcaagatcaagacggtggaggtcgacatgctcaacatcaccatcagctcgc 709 | | |||||||||||||||| ||||||| ||||||||||||| || ||||||| ||||| Sbjct: 259536 acagacagctcaagatcaagatggtggagatcgacatgctcaaaatgaccatcaactcgc 259477 Query: 710 tgcaggccgagagaaagaagctgcaggaggatgttgcccgtggcgctgccgccaagaagg 769 |||| | ||||| |||||||| ||||| || || ||||||||| | | ||||||| || Sbjct: 259476 tgcaagaggagaggaagaagcttcaggatgacgtcgcccgtggcacaggagccaagaggg 259417 Query: 770 agctcgacgcgtccaggagcaggatcaaggagctgcagcgccagatacagatggaggcta 829 |||| || || | |||| || |||||||||||||||||| ||||||||||||||||| | Sbjct: 259416 agctggaggctgcgaggaacaagatcaaggagctgcagcgacagatacagatggaggcga 259357 Query: 830 accagaccaaaggccagctgatgctgctcaagcaacaggtgatggggctcagggccaagg 889 ||||||| ||||| ||||||||||| || ||| | |||||||| | ||| | | |||||| Sbjct: 259356 accagacgaaagggcagctgatgcttctaaagaaccaggtgattgcgctgaagtccaagg 259297 Query: 890 aggaggaggtggccaagaaggacgccgagatcgaacagaagctcaagaagctcaagaacc 949 ||||||||| |||| |||||||| ||| | | |||||| |||||||||||| | | Sbjct: 259296 aggaggaggcagccatcaaggacgcagaggtgcagaggaagctgaagaagctcaaggagc 259237 Query: 950 tggaggtggaggtgcttgagctgaggaggaagaacaaggagctgctgtatgagaagaggg 1009 |||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 259236 tggaagtggaggtagttgagctgaggaggaagaacaaggagctcttgtatgagaaaaggg 259177 Query: 1010 acctcatggtgaagctggatgcagcacaaggaaaaataacagag 1053 | ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 259176 atctcatcgttaagctggatgcagcacaaggaaaaataacagag 259133 Score = 272 bits (137), Expect = 8e-69 Identities = 370/447 (82%), Gaps = 3/447 (0%) Strand = Plus / Minus Query: 1052 agagtgatgtagttgcccatgcaagagaggagatcaataacctgagacatacaaatgagg 1111 |||||||||||||| |||||||||||||||||||||| || ||||| ||| |||||| | Sbjct: 258591 agagtgatgtagtttcccatgcaagagaggagatcaacaagctgaggcatgtaaatgaag 258532 Query: 1112 acctcacaaagcaagtggaaggcctacagatgaacagattcagtgaagtagaggagctgg 1171 |||| || |||||||| ||||||||||| ||||||||||||||||||||||| ||| ||| Sbjct: 258531 accttaccaagcaagtagaaggcctacaaatgaacagattcagtgaagtagaagagttgg 258472 Query: 1172 tgtacctgcgttgggtcaacgcctgtctgcgattcgagctccgcaactaccagacaccat 1231 | |||||||||||||| || || |||||| ||| |||||||||||||||||| |||||| Sbjct: 258471 tttacctgcgttgggttaatgcttgtctgagatatgagctccgcaactaccaggcaccat 258412 Query: 1232 cgggcaaaatctctgcccgcgacctcagcacgaagctcagcccaaagtctcaggagaggg 1291 | | ||||| ||||| || |||| | || || || |||||||| || | ||||||| Sbjct: 258411 ctgagaaaatttctgctcgttaccttaacaagaccctgagcccaaaatcgcgtgagaggg 258352 Query: 1292 ccaaacagatgatgctcgaattt---gggtctgagcgaggccagggcgacactgaccttg 1348 |||||| | ||||| |||| | || || || ||||| ||||||||||||||||||| Sbjct: 258351 ccaaacttctaatgctggaatatgcaggatcagaacgaggacagggcgacactgaccttg 258292 Query: 1349 acagtgtctcctcggcaccttcttcccccagaagcgaagacttcgacaccgcttcgatcg 1408 | | || || || ||||||||||| ||||||||||||||||| |||| | ||| | | Sbjct: 258291 aaactgcttcttctgcaccttcttcacccagaagcgaagacttggacaatgtttcagttg 258232 Query: 1409 acagctcttccggcagatacagcttcctaagcaagaggccgaacctgatgcagaaactca 1468 |||| ||||| |||||||||||||| | |||| ||||| || |||||||| || |||| Sbjct: 258231 acagttcttctagcagatacagcttctttggcaaaaggcccaatctgatgcaaaagctca 258172 Query: 1469 agaagtggggaaggagcaaggatgatg 1495 |||||||||||||| |||||||||||| Sbjct: 258171 agaagtggggaaggggcaaggatgatg 258145 Score = 252 bits (127), Expect = 7e-63 Identities = 241/279 (86%) Strand = Plus / Minus Query: 2079 gccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccc 2138 |||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 257573 gccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggccc 257514 Query: 2139 tccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggt 2198 || ||||| ||||| || || ||||| ||| | | || |||||||||||||||||||| Sbjct: 257513 gccaccgccgccaccaccccctggttccctacctaggaatcttgctggtggtgacaaggt 257454 Query: 2199 acaccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaa 2258 |||||||||||| ||||| || ||||| ||||| ||||||||||| |||||||||||||| Sbjct: 257453 acaccgtgctccagaggttgtagagttttatcaaagtctcatgaagcgtgaagccaagaa 257394 Query: 2259 ggacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgat 2318 |||||| || ||| ||||||||| |||||| | || | |||| |||||||||||||| Sbjct: 257393 ggacacaacttctctgggatcaacaacatcaagtgcctttgatgtgagaagcaacatgat 257334 Query: 2319 tggagagattgagaacagatcaacattcctattagctgt 2357 ||||||||||||||| |||||||||||||| |||||||| Sbjct: 257333 tggagagattgagaatagatcaacattcctcttagctgt 257295 Score = 234 bits (118), Expect = 2e-57 Identities = 374/458 (81%), Gaps = 6/458 (1%) Strand = Plus / Minus Query: 1552 agccagaaaccaaagggccccctggaatctctcatgatcagaaatgcaggagatggtatg 1611 ||||||||||||||||| ||||| || |||||||| |||||||||||||||||||| || Sbjct: 258088 agccagaaaccaaaggggcccctagaggctctcatgctcagaaatgcaggagatggtgtg 258029 Query: 1612 tccattacaacatttggaaaaagggatcaagaatccggtga---catagatgatgcaaat 1668 ||||||||| |||||||| ||||| || || || |||| ||| ||||| |||||| Sbjct: 258028 ggcattacaacctttggaaagagggaacaggatcccagtgatatcatggatgaggcaaat 257969 Query: 1669 gttgcatcttcattccagttgatgtcgaagaatgttgaaggcttcgctgatgaaaagtat 1728 ||||||||||||||||| |||||||| |||| ||| |||| || |||||||| |||||| Sbjct: 257968 gttgcatcttcattccatttgatgtcaaagactgtacaaggttttgctgatgacaagtat 257909 Query: 1729 cccgcttacaaagaccggcataagcttgcgacggaacgggagaaggcgataaaagagaag 1788 |||||||||||||| ||||||| ||||| || ||||||||||||| ||||||||||| Sbjct: 257908 cccgcttacaaagataggcataaacttgccacagaacgggagaaggtaataaaagagaaa 257849 Query: 1789 gccgagcaagccagagcacaaaggtttggtggtggctatagttcagctctagctccttcc 1848 |||||| |||| || | |||||| | ||| |||| | | ||||||| | | | || || Sbjct: 257848 gccgagaaagctagggtacaaagatatggcggtgtcaacagttcaggtattgtgccatct 257789 Query: 1849 ccgagagctgcacttccccccaaactcgctcaaataaaggagaagaaggcccctgcagtc 1908 || ||| ||||||| || || ||||| ||||||||||||| | ||||| ||| ||| Sbjct: 257788 ccaagatctgcactccctccaaaacttgctcaaataaagg---aaaaggctcctacagct 257732 Query: 1909 aatgctgaatccggcgagcaatctagtgatatcccgaacaaccccctggctgtcacccag 1968 |||||||||||| | || ||| ||||||||| || ||||||||| || | ||| || || Sbjct: 257731 aatgctgaatccagtgaccaacctagtgataaccagaacaaccctctagttgtgacacaa 257672 Query: 1969 ttgaagcttgcccaaattgagaagagagctccaagagt 2006 |||| ||||| | ||||||||||||||||||||||| Sbjct: 257671 ctgaaacttgcaaatattgagaagagagctccaagagt 257634 Score = 135 bits (68), Expect = 1e-27 Identities = 149/176 (84%) Strand = Plus / Minus Query: 2491 gatgagagagcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaaga 2550 |||||| | ||||| |||||||| || ||||||||||||||||||||||||||| ||||| Sbjct: 256955 gatgagcgggcagtactaaagcactttgattggccagagagcaaaactgatgcactaaga 256896 Query: 2551 gaggccgcctttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtc 2610 ||||| |||||||||||||| |||||| | ||| |||| | |||| | | || ||| Sbjct: 256895 gaggcagcctttgagtatcaagacctgctaaaattagaacataaggtttcgtcgtttact 256836 Query: 2611 gatgatccaaaacttccatgtgaagaagctttgaagaggatgtattcgttgcttga 2666 ||||||||||| ||| |||||||||||||| | |||| ||||||||| |||||||| Sbjct: 256835 gatgatccaaagcttgcatgtgaagaagctctcaagaagatgtattccttgcttga 256780 Score = 127 bits (64), Expect = 3e-25 Identities = 103/116 (88%) Strand = Plus / Minus Query: 2356 gtcaaagctgatgtggagacacaaggagaatttgtcgagtccctagcgggtgaggtccga 2415 |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||| Sbjct: 257169 gtcaaagcggatgtggagacacaaggagactttgtcgagtctctagcaaatgaggtccga 257110 Query: 2416 gcagcaagattcgcgaatatcgatgatgttgttgcatttgtacattggctggatga 2471 |||||||| || | |||||||| |||||||||||||||||| ||||||| ||||| Sbjct: 257109 gcagcaagttttgtaaatatcgacgatgttgttgcatttgtaaattggcttgatga 257054 Score = 99.6 bits (50), Expect = 6e-17 Identities = 122/146 (83%) Strand = Plus / Minus Query: 2780 agatcaaactcgcgtcagttcagctggcaaggaagtacatggagagggtcacgtcggagc 2839 |||||||| | || || ||||||||||| | |||||| ||| ||||||| | | |||| Sbjct: 256432 agatcaaattggcatctgttcagctggcgaagaagtatatgaagagggttgccacagagc 256373 Query: 2840 tcgacgcgttgcaaggcacggacaaagagcccaacagggagttcttgcttctccagggcg 2899 | || || ||||||||||| || |||||||||||||| |||||||||||||| ||||| | Sbjct: 256372 ttgatgccttgcaaggcaccgagaaagagcccaacagagagttcttgcttcttcagggtg 256313 Query: 2900 tcagatttgccttccgtgttcatcag 2925 | |||||||| ||||| ||||||||| Sbjct: 256312 tgagatttgctttccgagttcatcag 256287 Score = 65.9 bits (33), Expect = 9e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagaggtcaagacgatcagcggcataatcaa 390 |||||||||||||| ||| |||||||||| || || ||||||||||||||||| Sbjct: 259837 ggggagaaagaagaagagaaggaagaggttaaaacaatcagcggcataatcaa 259785 Score = 58.0 bits (29), Expect = 2e-04 Identities = 71/85 (83%) Strand = Plus / Minus Query: 2670 agtggagcagagtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaa 2729 |||||||||||||||||| || || |||||||| ||||||||| ||| |||| |||| Sbjct: 256632 agtggagcagagtgtttatgcgctacttcgtactagagacatggccatatcacgctacag 256573 Query: 2730 ggagtatggaataccagttgattgg 2754 |||||| ||| |||| || |||||| Sbjct: 256572 ggagtacggactaccggtggattgg 256548 Score = 56.0 bits (28), Expect = 8e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 413 gatgaggacgacatgttctcggagatcgagagcctcctgggcggggagatcgacatcccg 472 ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||| Sbjct: 259771 gatgatgacgacatgctctccgagatcgagagcctcctatcaggggagattgacatcccc 259712 Query: 473 ataccgggcgacaggtttga 492 |||| | ||||||||||| Sbjct: 259711 ctaccaagtgacaggtttga 259692 Score = 44.1 bits (22), Expect = 3.2 Identities = 22/22 (100%) Strand = Plus / Minus Query: 403 ggtggacgacgatgaggacgac 424 |||||||||||||||||||||| Sbjct: 10273602 ggtggacgacgatgaggacgac 10273581
>emb|BX000501.4|CNS08CDR Oryza sativa chromosome 11, . BAC OSJNBa0032J07 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 160673 Score = 365 bits (184), Expect = 7e-97 Identities = 439/524 (83%) Strand = Plus / Plus Query: 530 ccgagatggagcggctgcgcggcctggtgagggagctggaggagcgggaggtgaagctcg 589 ||||| ||||| ||||||| || || ||| | |||||||||||| |||| |||||||| | Sbjct: 45337 ccgagctggagaggctgcgtggacttgtgcgtgagctggaggagagggaagtgaagcttg 45396 Query: 590 agggcgagctgctcgagtactacggcctcaaggagcaggagaccgacgtgtccgagctgc 649 |||| |||||||| |||||||| ||||||||||| |||||||| || || ||||| | Sbjct: 45397 agggagagctgctggagtactatggcctcaaggaacaggagactgatgttgtagagctac 45456 Query: 650 agaagcagctcaagatcaagacggtggaggtcgacatgctcaacatcaccatcagctcgc 709 | | |||||||||||||||| ||||||| ||||||||||||| || ||||||| ||||| Sbjct: 45457 acagacagctcaagatcaagatggtggagatcgacatgctcaaaatgaccatcaactcgc 45516 Query: 710 tgcaggccgagagaaagaagctgcaggaggatgttgcccgtggcgctgccgccaagaagg 769 |||| | ||||| |||||||| ||||| || || ||||||||| | | ||||||| || Sbjct: 45517 tgcaagaggagaggaagaagcttcaggatgacgtcgcccgtggcacaggagccaagaggg 45576 Query: 770 agctcgacgcgtccaggagcaggatcaaggagctgcagcgccagatacagatggaggcta 829 |||| || || | |||| || |||||||||||||||||| ||||||||||||||||| | Sbjct: 45577 agctggaggctgcgaggaacaagatcaaggagctgcagcgacagatacagatggaggcga 45636 Query: 830 accagaccaaaggccagctgatgctgctcaagcaacaggtgatggggctcagggccaagg 889 ||||||| ||||| ||||||||||| || ||| | |||||||| | ||| | | |||||| Sbjct: 45637 accagacgaaagggcagctgatgcttctaaagaaccaggtgattgcgctgaagtccaagg 45696 Query: 890 aggaggaggtggccaagaaggacgccgagatcgaacagaagctcaagaagctcaagaacc 949 ||||||||| |||| |||||||| ||| | | |||||| |||||||||||| | | Sbjct: 45697 aggaggaggcagccatcaaggacgcagaggtgcagaggaagctgaagaagctcaaggagc 45756 Query: 950 tggaggtggaggtgcttgagctgaggaggaagaacaaggagctgctgtatgagaagaggg 1009 |||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 45757 tggaagtggaggtagttgagctgaggaggaagaacaaggagctcttgtatgagaaaaggg 45816 Query: 1010 acctcatggtgaagctggatgcagcacaaggaaaaataacagag 1053 | ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 45817 atctcatcgttaagctggatgcagcacaaggaaaaataacagag 45860 Score = 272 bits (137), Expect = 8e-69 Identities = 370/447 (82%), Gaps = 3/447 (0%) Strand = Plus / Plus Query: 1052 agagtgatgtagttgcccatgcaagagaggagatcaataacctgagacatacaaatgagg 1111 |||||||||||||| |||||||||||||||||||||| || ||||| ||| |||||| | Sbjct: 46402 agagtgatgtagtttcccatgcaagagaggagatcaacaagctgaggcatgtaaatgaag 46461 Query: 1112 acctcacaaagcaagtggaaggcctacagatgaacagattcagtgaagtagaggagctgg 1171 |||| || |||||||| ||||||||||| ||||||||||||||||||||||| ||| ||| Sbjct: 46462 accttaccaagcaagtagaaggcctacaaatgaacagattcagtgaagtagaagagttgg 46521 Query: 1172 tgtacctgcgttgggtcaacgcctgtctgcgattcgagctccgcaactaccagacaccat 1231 | |||||||||||||| || || |||||| ||| |||||||||||||||||| |||||| Sbjct: 46522 tttacctgcgttgggttaatgcttgtctgagatatgagctccgcaactaccaggcaccat 46581 Query: 1232 cgggcaaaatctctgcccgcgacctcagcacgaagctcagcccaaagtctcaggagaggg 1291 | | ||||| ||||| || |||| | || || || |||||||| || | ||||||| Sbjct: 46582 ctgagaaaatttctgctcgttaccttaacaagaccctgagcccaaaatcgcgtgagaggg 46641 Query: 1292 ccaaacagatgatgctcgaattt---gggtctgagcgaggccagggcgacactgaccttg 1348 |||||| | ||||| |||| | || || || ||||| ||||||||||||||||||| Sbjct: 46642 ccaaacttctaatgctggaatatgcaggatcagaacgaggacagggcgacactgaccttg 46701 Query: 1349 acagtgtctcctcggcaccttcttcccccagaagcgaagacttcgacaccgcttcgatcg 1408 | | || || || ||||||||||| ||||||||||||||||| |||| | ||| | | Sbjct: 46702 aaactgcttcttctgcaccttcttcacccagaagcgaagacttggacaatgtttcagttg 46761 Query: 1409 acagctcttccggcagatacagcttcctaagcaagaggccgaacctgatgcagaaactca 1468 |||| ||||| |||||||||||||| | |||| ||||| || |||||||| || |||| Sbjct: 46762 acagttcttctagcagatacagcttctttggcaaaaggcccaatctgatgcaaaagctca 46821 Query: 1469 agaagtggggaaggagcaaggatgatg 1495 |||||||||||||| |||||||||||| Sbjct: 46822 agaagtggggaaggggcaaggatgatg 46848 Score = 252 bits (127), Expect = 7e-63 Identities = 241/279 (86%) Strand = Plus / Plus Query: 2079 gccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccc 2138 |||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 47420 gccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggccc 47479 Query: 2139 tccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggt 2198 || ||||| ||||| || || ||||| ||| | | || |||||||||||||||||||| Sbjct: 47480 gccaccgccgccaccaccccctggttccctacctaggaatcttgctggtggtgacaaggt 47539 Query: 2199 acaccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaa 2258 |||||||||||| ||||| || ||||| ||||| ||||||||||| |||||||||||||| Sbjct: 47540 acaccgtgctccagaggttgtagagttttatcaaagtctcatgaagcgtgaagccaagaa 47599 Query: 2259 ggacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgat 2318 |||||| || ||| ||||||||| |||||| | || | |||| |||||||||||||| Sbjct: 47600 ggacacaacttctctgggatcaacaacatcaagtgcctttgatgtgagaagcaacatgat 47659 Query: 2319 tggagagattgagaacagatcaacattcctattagctgt 2357 ||||||||||||||| |||||||||||||| |||||||| Sbjct: 47660 tggagagattgagaatagatcaacattcctcttagctgt 47698 Score = 234 bits (118), Expect = 2e-57 Identities = 374/458 (81%), Gaps = 6/458 (1%) Strand = Plus / Plus Query: 1552 agccagaaaccaaagggccccctggaatctctcatgatcagaaatgcaggagatggtatg 1611 ||||||||||||||||| ||||| || |||||||| |||||||||||||||||||| || Sbjct: 46905 agccagaaaccaaaggggcccctagaggctctcatgctcagaaatgcaggagatggtgtg 46964 Query: 1612 tccattacaacatttggaaaaagggatcaagaatccggtga---catagatgatgcaaat 1668 ||||||||| |||||||| ||||| || || || |||| ||| ||||| |||||| Sbjct: 46965 ggcattacaacctttggaaagagggaacaggatcccagtgatatcatggatgaggcaaat 47024 Query: 1669 gttgcatcttcattccagttgatgtcgaagaatgttgaaggcttcgctgatgaaaagtat 1728 ||||||||||||||||| |||||||| |||| ||| |||| || |||||||| |||||| Sbjct: 47025 gttgcatcttcattccatttgatgtcaaagactgtacaaggttttgctgatgacaagtat 47084 Query: 1729 cccgcttacaaagaccggcataagcttgcgacggaacgggagaaggcgataaaagagaag 1788 |||||||||||||| ||||||| ||||| || ||||||||||||| ||||||||||| Sbjct: 47085 cccgcttacaaagataggcataaacttgccacagaacgggagaaggtaataaaagagaaa 47144 Query: 1789 gccgagcaagccagagcacaaaggtttggtggtggctatagttcagctctagctccttcc 1848 |||||| |||| || | |||||| | ||| |||| | | ||||||| | | | || || Sbjct: 47145 gccgagaaagctagggtacaaagatatggcggtgtcaacagttcaggtattgtgccatct 47204 Query: 1849 ccgagagctgcacttccccccaaactcgctcaaataaaggagaagaaggcccctgcagtc 1908 || ||| ||||||| || || ||||| ||||||||||||| | ||||| ||| ||| Sbjct: 47205 ccaagatctgcactccctccaaaacttgctcaaataaagg---aaaaggctcctacagct 47261 Query: 1909 aatgctgaatccggcgagcaatctagtgatatcccgaacaaccccctggctgtcacccag 1968 |||||||||||| | || ||| ||||||||| || ||||||||| || | ||| || || Sbjct: 47262 aatgctgaatccagtgaccaacctagtgataaccagaacaaccctctagttgtgacacaa 47321 Query: 1969 ttgaagcttgcccaaattgagaagagagctccaagagt 2006 |||| ||||| | ||||||||||||||||||||||| Sbjct: 47322 ctgaaacttgcaaatattgagaagagagctccaagagt 47359 Score = 135 bits (68), Expect = 1e-27 Identities = 149/176 (84%) Strand = Plus / Plus Query: 2491 gatgagagagcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaaga 2550 |||||| | ||||| |||||||| || ||||||||||||||||||||||||||| ||||| Sbjct: 48038 gatgagcgggcagtactaaagcactttgattggccagagagcaaaactgatgcactaaga 48097 Query: 2551 gaggccgcctttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtc 2610 ||||| |||||||||||||| |||||| | ||| |||| | |||| | | || ||| Sbjct: 48098 gaggcagcctttgagtatcaagacctgctaaaattagaacataaggtttcgtcgtttact 48157 Query: 2611 gatgatccaaaacttccatgtgaagaagctttgaagaggatgtattcgttgcttga 2666 ||||||||||| ||| |||||||||||||| | |||| ||||||||| |||||||| Sbjct: 48158 gatgatccaaagcttgcatgtgaagaagctctcaagaagatgtattccttgcttga 48213 Score = 127 bits (64), Expect = 3e-25 Identities = 103/116 (88%) Strand = Plus / Plus Query: 2356 gtcaaagctgatgtggagacacaaggagaatttgtcgagtccctagcgggtgaggtccga 2415 |||||||| |||||||||||||||||||| ||||||||||| ||||| |||||||||| Sbjct: 47824 gtcaaagcggatgtggagacacaaggagactttgtcgagtctctagcaaatgaggtccga 47883 Query: 2416 gcagcaagattcgcgaatatcgatgatgttgttgcatttgtacattggctggatga 2471 |||||||| || | |||||||| |||||||||||||||||| ||||||| ||||| Sbjct: 47884 gcagcaagttttgtaaatatcgacgatgttgttgcatttgtaaattggcttgatga 47939 Score = 99.6 bits (50), Expect = 6e-17 Identities = 122/146 (83%) Strand = Plus / Plus Query: 2780 agatcaaactcgcgtcagttcagctggcaaggaagtacatggagagggtcacgtcggagc 2839 |||||||| | || || ||||||||||| | |||||| ||| ||||||| | | |||| Sbjct: 48561 agatcaaattggcatctgttcagctggcgaagaagtatatgaagagggttgccacagagc 48620 Query: 2840 tcgacgcgttgcaaggcacggacaaagagcccaacagggagttcttgcttctccagggcg 2899 | || || ||||||||||| || |||||||||||||| |||||||||||||| ||||| | Sbjct: 48621 ttgatgccttgcaaggcaccgagaaagagcccaacagagagttcttgcttcttcagggtg 48680 Query: 2900 tcagatttgccttccgtgttcatcag 2925 | |||||||| ||||| ||||||||| Sbjct: 48681 tgagatttgctttccgagttcatcag 48706 Score = 65.9 bits (33), Expect = 9e-07 Identities = 48/53 (90%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagaggtcaagacgatcagcggcataatcaa 390 |||||||||||||| ||| |||||||||| || || ||||||||||||||||| Sbjct: 45156 ggggagaaagaagaagagaaggaagaggttaaaacaatcagcggcataatcaa 45208 Score = 58.0 bits (29), Expect = 2e-04 Identities = 71/85 (83%) Strand = Plus / Plus Query: 2670 agtggagcagagtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaa 2729 |||||||||||||||||| || || |||||||| ||||||||| ||| |||| |||| Sbjct: 48361 agtggagcagagtgtttatgcgctacttcgtactagagacatggccatatcacgctacag 48420 Query: 2730 ggagtatggaataccagttgattgg 2754 |||||| ||| |||| || |||||| Sbjct: 48421 ggagtacggactaccggtggattgg 48445 Score = 56.0 bits (28), Expect = 8e-04 Identities = 67/80 (83%) Strand = Plus / Plus Query: 413 gatgaggacgacatgttctcggagatcgagagcctcctgggcggggagatcgacatcccg 472 ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||| Sbjct: 45222 gatgatgacgacatgctctccgagatcgagagcctcctatcaggggagattgacatcccc 45281 Query: 473 ataccgggcgacaggtttga 492 |||| | ||||||||||| Sbjct: 45282 ctaccaagtgacaggtttga 45301
>emb|BX000494.2|CNS08CDK Oryza sativa chromosome 12, . BAC OSJNBa0052H10 of library OSJNBa from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 152222 Score = 365 bits (184), Expect = 7e-97 Identities = 439/524 (83%) Strand = Plus / Minus Query: 530 ccgagatggagcggctgcgcggcctggtgagggagctggaggagcgggaggtgaagctcg 589 ||||| ||||| ||||||| || || ||| | |||||||||||| |||| |||||||| | Sbjct: 13415 ccgagctggagaggctgcgtggacttgtgcgtgagctggaggagagggaagtgaagcttg 13356 Query: 590 agggcgagctgctcgagtactacggcctcaaggagcaggagaccgacgtgtccgagctgc 649 |||| |||||||| |||||||| ||||||||||| |||||||| || || ||||| | Sbjct: 13355 agggagagctgctagagtactatggcctcaaggaacaggagactgatgttgtagagctac 13296 Query: 650 agaagcagctcaagatcaagacggtggaggtcgacatgctcaacatcaccatcagctcgc 709 | | |||||||||||||||| ||||||| ||||||||||||| || ||||||| ||||| Sbjct: 13295 acagacagctcaagatcaagatggtggagatcgacatgctcaaaatgaccatcaactcgc 13236 Query: 710 tgcaggccgagagaaagaagctgcaggaggatgttgcccgtggcgctgccgccaagaagg 769 |||| | ||||| |||||||||||||| || || ||||||||| | | ||||||| || Sbjct: 13235 tgcaagaggagaggaagaagctgcaggatgacgtcgcccgtggcacaggagccaagaggg 13176 Query: 770 agctcgacgcgtccaggagcaggatcaaggagctgcagcgccagatacagatggaggcta 829 |||| || || | |||| || |||||||||||||||||| ||||||||||||||||| | Sbjct: 13175 agctggaggctgcgaggaacaagatcaaggagctgcagcgacagatacagatggaggcga 13116 Query: 830 accagaccaaaggccagctgatgctgctcaagcaacaggtgatggggctcagggccaagg 889 ||||||| ||||| |||||| |||| || ||| | |||||||| | ||| | | |||||| Sbjct: 13115 accagacaaaagggcagctgttgcttctaaagaaccaggtgattgcgctgaagtccaagg 13056 Query: 890 aggaggaggtggccaagaaggacgccgagatcgaacagaagctcaagaagctcaagaacc 949 ||||||||| |||| |||||||| ||| | | |||||| |||||||||||| | | Sbjct: 13055 aggaggaggcagccatcaaggacgcagaggtgcagaggaagctgaagaagctcaaggagc 12996 Query: 950 tggaggtggaggtgcttgagctgaggaggaagaacaaggagctgctgtatgagaagaggg 1009 |||| |||||||| |||||||||||||||||||||||||||| |||||||||| |||| Sbjct: 12995 tggaagtggaggtagttgagctgaggaggaagaacaaggagcttttgtatgagaaaaggg 12936 Query: 1010 acctcatggtgaagctggatgcagcacaaggaaaaataacagag 1053 | ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 12935 atctcatcgtaaagctggatgcagcacaaggaaaaataacagag 12892 Score = 291 bits (147), Expect = 8e-75 Identities = 371/445 (83%), Gaps = 3/445 (0%) Strand = Plus / Minus Query: 1052 agagtgatgtagttgcccatgcaagagaggagatcaataacctgagacatacaaatgagg 1111 |||||||||||||| |||||||||||||||||||||| || ||||| ||| ||||||| | Sbjct: 9383 agagtgatgtagtttcccatgcaagagaggagatcaacaagctgaggcatgcaaatgaag 9324 Query: 1112 acctcacaaagcaagtggaaggcctacagatgaacagattcagtgaagtagaggagctgg 1171 |||| || |||||||| ||||||||||| ||||||||||||||||||||||| ||| ||| Sbjct: 9323 accttaccaagcaagtagaaggcctacaaatgaacagattcagtgaagtagaagagttgg 9264 Query: 1172 tgtacctgcgttgggtcaacgcctgtctgcgattcgagctccgcaactaccagacaccat 1231 | |||||||||||||| || || |||||| ||| |||||||||||||||||| |||| | Sbjct: 9263 tttacctgcgttgggttaatgcttgtctgagatatgagctccgcaactaccaggcaccgt 9204 Query: 1232 cgggcaaaatctctgcccgcgacctcagcacgaagctcagcccaaagtctcaggagaggg 1291 | | ||||| ||||| || ||||| | || || || |||||||| || | ||||||| Sbjct: 9203 ctgagaaaatttctgctcgtgaccttaacaagaccctgagcccaaaatcgcgtgagaggg 9144 Query: 1292 ccaaacagatgatgctcgaattt---gggtctgagcgaggccagggcgacactgaccttg 1348 |||||| | ||||| |||| | || || || ||||| ||||||||||||||||||| Sbjct: 9143 ccaaacttctaatgctggaatatgcaggatcagaacgaggacagggcgacactgaccttg 9084 Query: 1349 acagtgtctcctcggcaccttcttcccccagaagcgaagacttcgacaccgcttcgatcg 1408 | | || || || ||||||||||| |||||||||||||||||||||| || ||| | | Sbjct: 9083 aaactgcttcttctgcaccttcttcacccagaagcgaagacttcgacaacgtttcagttg 9024 Query: 1409 acagctcttccggcagatacagcttcctaagcaagaggccgaacctgatgcagaaactca 1468 |||| ||||| |||||||||||||| | |||| ||||| || |||||||| || |||| Sbjct: 9023 acagttcttctagcagatacagcttctttggcaaaaggcccaatctgatgcaaaagctca 8964 Query: 1469 agaagtggggaaggagcaaggatga 1493 |||||||||||||| |||||||||| Sbjct: 8963 agaagtggggaaggggcaaggatga 8939 Score = 266 bits (134), Expect = 5e-67 Identities = 242/278 (87%) Strand = Plus / Minus Query: 2080 ccgccacgcccaccaggtgcacctcctccaccaccacctccagggagacccggtggccct 2139 ||||||||||| ||||||||||||||||||||||| ||||| || | ||| |||||||| Sbjct: 8364 ccgccacgcccgccaggtgcacctcctccaccaccgcctcctggcaaacctggtggcccg 8305 Query: 2140 ccgccgccaccaccgcctcccggttctctatccaagagccttgctggtggtgacaaggta 2199 || ||||| ||||| | || ||||| ||| | | || ||||||||||||||||||||| Sbjct: 8304 ccaccgccgccaccacgccctggttccctacctaggaatcttgctggtggtgacaaggta 8245 Query: 2200 caccgtgctccggaggtcgtggagttctatcagagtctcatgaaacgtgaagccaagaag 2259 ||||||||||| ||||| || ||||||||||| ||||||||||| ||||||||||||||| Sbjct: 8244 caccgtgctccagaggttgtagagttctatcaaagtctcatgaagcgtgaagccaagaag 8185 Query: 2260 gacaccacctctttgggatcaaaaacatcgaatgtttctgataacagaagcaacatgatt 2319 ||||| || ||| ||||||||| |||||| | ||| |||||| ||||||||||||||| Sbjct: 8184 gacacaacttctctgggatcaacaacatcaagtgtctctgatgtgagaagcaacatgatt 8125 Query: 2320 ggagagattgagaacagatcaacattcctattagctgt 2357 |||||||||||||| |||||||||||||| |||||||| Sbjct: 8124 ggagagattgagaatagatcaacattcctcttagctgt 8087 Score = 242 bits (122), Expect = 7e-60 Identities = 375/458 (81%), Gaps = 6/458 (1%) Strand = Plus / Minus Query: 1552 agccagaaaccaaagggccccctggaatctctcatgatcagaaatgcaggagatggtatg 1611 ||||||||||||||||| ||||| || |||||||| ||||||| ||||||||||||||| Sbjct: 8880 agccagaaaccaaaggggcccctagaggctctcatgctcagaaacgcaggagatggtatg 8821 Query: 1612 tccattacaacatttggaaaaagggatcaagaatccggtga---catagatgatgcaaat 1668 ||||||||| |||||||| ||||| ||||| || |||| ||| ||||| |||||| Sbjct: 8820 ggcattacaacctttggaaagagggaacaagatcccagtgatatcatggatgaggcaaat 8761 Query: 1669 gttgcatcttcattccagttgatgtcgaagaatgttgaaggcttcgctgatgaaaagtat 1728 |||||||||||||| || |||||||| |||| ||| |||| || |||||||| |||||| Sbjct: 8760 gttgcatcttcatttcatttgatgtcaaagactgtacaaggttttgctgatgacaagtat 8701 Query: 1729 cccgcttacaaagaccggcataagcttgcgacggaacgggagaaggcgataaaagagaag 1788 |||||||||||||| ||||||| || || || |||||||||||||| |||||||||||| Sbjct: 8700 cccgcttacaaagataggcataaactcgccacagaacgggagaaggcaataaaagagaag 8641 Query: 1789 gccgagcaagccagagcacaaaggtttggtggtggctatagttcagctctagctccttcc 1848 |||||| |||| || | |||||| | ||| |||| | | ||||||| | | | || || Sbjct: 8640 gccgagaaagctagggtacaaagatatggcggtgtcaacagttcaggtattgtgccatct 8581 Query: 1849 ccgagagctgcacttccccccaaactcgctcaaataaaggagaagaaggcccctgcagtc 1908 || ||| ||||||| || || ||||| ||||||||||||| | ||||| ||| ||| Sbjct: 8580 ccaagatctgcactccctccaaaacttgctcaaataaagg---aaaaggctcctacagct 8524 Query: 1909 aatgctgaatccggcgagcaatctagtgatatcccgaacaaccccctggctgtcacccag 1968 |||||||||||| | || ||| ||||||||| || ||||||||| || | ||| || || Sbjct: 8523 aatgctgaatccagtgaccaacctagtgataaccagaacaaccctctagttgtgacacaa 8464 Query: 1969 ttgaagcttgcccaaattgagaagagagctccaagagt 2006 |||| ||||| | ||||||||||||||||||||||| Sbjct: 8463 ctgaaacttgcaaatattgagaagagagctccaagagt 8426 Score = 143 bits (72), Expect = 5e-30 Identities = 150/176 (85%) Strand = Plus / Minus Query: 2491 gatgagagagcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaaga 2550 |||||| | ||||| |||||||| || ||||||||||||||||||||||||||| ||||| Sbjct: 7750 gatgagcgggcagtactaaagcactttgattggccagagagcaaaactgatgcactaaga 7691 Query: 2551 gaggccgcctttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtc 2610 ||||| |||||||||||||| |||||| | ||| |||| |||||| | | || ||| Sbjct: 7690 gaggcagcctttgagtatcaagacctgctaaaattagaacacaaggtttcgtcgtttact 7631 Query: 2611 gatgatccaaaacttccatgtgaagaagctttgaagaggatgtattcgttgcttga 2666 ||||||||||| ||| |||||||||||||| | |||| ||||||||| |||||||| Sbjct: 7630 gatgatccaaagcttgcatgtgaagaagctctcaagaagatgtattccttgcttga 7575 Score = 91.7 bits (46), Expect = 2e-14 Identities = 70/78 (89%) Strand = Plus / Minus Query: 2848 ttgcaaggcacggacaaagagcccaacagggagttcttgcttctccagggcgtcagattt 2907 ||||||||||| || |||||||||||||| |||||||||||||| ||||| || |||||| Sbjct: 7154 ttgcaaggcaccgagaaagagcccaacagagagttcttgcttcttcagggtgtgagattt 7095 Query: 2908 gccttccgtgttcatcag 2925 || ||||| ||||||||| Sbjct: 7094 gctttccgagttcatcag 7077 Score = 87.7 bits (44), Expect = 2e-13 Identities = 98/116 (84%) Strand = Plus / Minus Query: 2356 gtcaaagctgatgtggagacacaaggagaatttgtcgagtccctagcgggtgaggtccga 2415 ||||||| |||||||||||||||||||| ||||| ||||| ||||| |||||||||| Sbjct: 7963 gtcaaagtggatgtggagacacaaggagactttgttgagtctctagcaaatgaggtccga 7904 Query: 2416 gcagcaagattcgcgaatatcgatgatgttgttgcatttgtacattggctggatga 2471 ||||| || || | |||||||| || ||||||||||||||| | ||||| ||||| Sbjct: 7903 gcagctagttttgtaaatatcgacgacgttgttgcatttgtaaactggcttgatga 7848 Score = 79.8 bits (40), Expect = 6e-11 Identities = 82/96 (85%) Strand = Plus / Minus Query: 2670 agtggagcagagtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaa 2729 |||||||||||||||||| || || |||||||| ||||||||| ||| |||| |||| Sbjct: 7426 agtggagcagagtgtttatgcgctacttcgtactagagacatggccatatcacgctacag 7367 Query: 2730 ggagtatggaataccagttgattggttatctgattc 2765 ||||||||||||||| || |||||| | |||||||| Sbjct: 7366 ggagtatggaataccggtggattggctgtctgattc 7331 Score = 65.9 bits (33), Expect = 9e-07 Identities = 48/53 (90%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagaggtcaagacgatcagcggcataatcaa 390 |||||||||||||| ||| |||||||||| || || ||||||||||||||||| Sbjct: 13596 ggggagaaagaagaagagaaggaagaggttaaaacaatcagcggcataatcaa 13544 Score = 54.0 bits (27), Expect = 0.003 Identities = 51/59 (86%) Strand = Plus / Minus Query: 413 gatgaggacgacatgttctcggagatcgagagcctcctgggcggggagatcgacatccc 471 ||||| ||||||||| |||| ||||||||||||||||| |||||||| |||||||| Sbjct: 13530 gatgatgacgacatgctctccgagatcgagagcctcctatcaggggagattgacatccc 13472
>emb|BX000491.1|CNS08CDH Oryza sativa chromosome 12, . BAC OSJNBb0068K19 of library OSJNBb from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 96667 Score = 143 bits (72), Expect = 5e-30 Identities = 150/176 (85%) Strand = Plus / Plus Query: 2491 gatgagagagcagtgctaaagcatttcgattggccagagagcaaaactgatgcattaaga 2550 |||||| | ||||| |||||||| || ||||||||||||||||||||||||||| ||||| Sbjct: 557 gatgagcgggcagtactaaagcactttgattggccagagagcaaaactgatgcactaaga 616 Query: 2551 gaggccgcctttgagtatcaggacctggtgaaactagagaacaaggctacatcctttgtc 2610 ||||| |||||||||||||| |||||| | ||| |||| |||||| | | || ||| Sbjct: 617 gaggcagcctttgagtatcaagacctgctaaaattagaacacaaggtttcgtcgtttact 676 Query: 2611 gatgatccaaaacttccatgtgaagaagctttgaagaggatgtattcgttgcttga 2666 ||||||||||| ||| |||||||||||||| | |||| ||||||||| |||||||| Sbjct: 677 gatgatccaaagcttgcatgtgaagaagctctcaagaagatgtattccttgcttga 732 Score = 91.7 bits (46), Expect = 2e-14 Identities = 70/78 (89%) Strand = Plus / Plus Query: 2848 ttgcaaggcacggacaaagagcccaacagggagttcttgcttctccagggcgtcagattt 2907 ||||||||||| || |||||||||||||| |||||||||||||| ||||| || |||||| Sbjct: 1153 ttgcaaggcaccgagaaagagcccaacagagagttcttgcttcttcagggtgtgagattt 1212 Query: 2908 gccttccgtgttcatcag 2925 || ||||| ||||||||| Sbjct: 1213 gctttccgagttcatcag 1230 Score = 87.7 bits (44), Expect = 2e-13 Identities = 98/116 (84%) Strand = Plus / Plus Query: 2356 gtcaaagctgatgtggagacacaaggagaatttgtcgagtccctagcgggtgaggtccga 2415 ||||||| |||||||||||||||||||| ||||| ||||| ||||| |||||||||| Sbjct: 344 gtcaaagtggatgtggagacacaaggagactttgttgagtctctagcaaatgaggtccga 403 Query: 2416 gcagcaagattcgcgaatatcgatgatgttgttgcatttgtacattggctggatga 2471 ||||| || || | |||||||| || ||||||||||||||| | ||||| ||||| Sbjct: 404 gcagctagttttgtaaatatcgacgacgttgttgcatttgtaaactggcttgatga 459 Score = 79.8 bits (40), Expect = 6e-11 Identities = 82/96 (85%) Strand = Plus / Plus Query: 2670 agtggagcagagtgtttacgcacttcttcgtacaagagacatgaccaccgcacggtacaa 2729 |||||||||||||||||| || || |||||||| ||||||||| ||| |||| |||| Sbjct: 881 agtggagcagagtgtttatgcgctacttcgtactagagacatggccatatcacgctacag 940 Query: 2730 ggagtatggaataccagttgattggttatctgattc 2765 ||||||||||||||| || |||||| | |||||||| Sbjct: 941 ggagtatggaataccggtggattggctgtctgattc 976
>emb|CT828672.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSA057D18, full insert sequence Length = 328 Score = 87.7 bits (44), Expect = 2e-13 Identities = 92/108 (85%) Strand = Plus / Plus Query: 2878 gagttcttgcttctccagggcgtcagatttgccttccgtgttcatcagtttgctggaggc 2937 |||||||||||||| ||||| || |||||||| ||||| |||||||||||||| |||||| Sbjct: 1 gagttcttgcttcttcagggtgtgagatttgctttccgagttcatcagtttgccggaggc 60 Query: 2938 ttcgacgcagacagcatgaaagtcttcgaggagctgagaagcaagatg 2985 || |||| || |||||||| | || || ||||| |||||||||||| Sbjct: 61 tttgacgaggaaagcatgaaggcgtttgaagagctaagaagcaagatg 108
>ref|NM_113468.3| Arabidopsis thaliana CHUP1 (CHLOROPLAST UNUSUAL POSITIONING 1) (CHUP1) mRNA, complete cds Length = 3379 Score = 73.8 bits (37), Expect = 4e-09 Identities = 67/77 (87%) Strand = Plus / Plus Query: 2314 atgattggagagattgagaacagatcaacattcctattagctgtcaaagctgatgtggag 2373 |||||||| || || |||||| ||||||||||||| ||||| || ||||| ||||||||| Sbjct: 2497 atgattggggaaatcgagaaccgatcaacattcctcttagcagtaaaagcggatgtggag 2556 Query: 2374 acacaaggagaatttgt 2390 |||||||| || ||||| Sbjct: 2557 acacaaggggactttgt 2573 Score = 56.0 bits (28), Expect = 8e-04 Identities = 196/252 (77%) Strand = Plus / Plus Query: 2461 tggctggatgaagagttgtcattcttggttgatgagagagcagtgctaaagcatttcgat 2520 ||||| ||||||||| | || |||||||||||||| || ||||| || || || || || Sbjct: 2644 tggctagatgaagagctctccttcttggttgatgaaagggcagttcttaaacactttgac 2703 Query: 2521 tggccagagagcaaaactgatgcattaagagaggccgcctttgagtatcaggacctggtg 2580 |||||||| | ||| ||||||| || |||| || || ||||| ||||| || || || Sbjct: 2704 tggccagaaggtaaagctgatgcgctacgagaagcagcttttgaatatcaagatcttatg 2763 Query: 2581 aaactagagaacaaggctacatcctttgtcgatgatccaaaacttccatgtgaagaagct 2640 ||||| ||||| | | ||| |||||||| |||||||| || || | |||||| ||| Sbjct: 2764 aaactggagaagcaagttacgtcctttgttgatgatcctaatctctcttgtgaacctgct 2823 Query: 2641 ttgaagaggatgtattcgttgcttgagaaagtggagcagagtgtttacgcacttcttcgt 2700 ||||||| |||||| |||||| ||||| || || || ||||| ||||| ||| | ||| Sbjct: 2824 ttgaagaagatgtacaagttgctagagaaggttgaacaaagtgtatacgcgcttttacgt 2883 Query: 2701 acaagagacatg 2712 || ||||||||| Sbjct: 2884 acgagagacatg 2895 Score = 52.0 bits (26), Expect = 0.013 Identities = 95/118 (80%) Strand = Plus / Plus Query: 2863 aaagagcccaacagggagttcttgcttctccagggcgtcagatttgccttccgtgttcat 2922 ||||| || ||||| ||||||||||||||||| || || | || || || | || ||| Sbjct: 3046 aaagatccgaacagagagttcttgcttctccaaggtgttcgtttcgcgtttagagtccat 3105 Query: 2923 cagtttgctggaggcttcgacgcagacagcatgaaagtcttcgaggagctgagaagca 2980 |||||||||||||| || || ||||| |||||||||| || ||||| || ||||||| Sbjct: 3106 cagtttgctggagggtttgatgcagagagcatgaaagcatttgaggaacttagaagca 3163 Score = 48.1 bits (24), Expect = 0.20 Identities = 60/72 (83%) Strand = Plus / Plus Query: 1119 aaagcaagtggaaggcctacagatgaacagattcagtgaagtagaggagctggtgtacct 1178 ||||||||||||||| || || ||||| || || |||||||| ||||| |||| || || Sbjct: 1215 aaagcaagtggaagggcttcaaatgaataggtttagtgaagttgaggaattggtttatct 1274 Query: 1179 gcgttgggtcaa 1190 ||||||||||| Sbjct: 1275 acgttgggtcaa 1286
>dbj|AB087408.1| Arabidopsis thaliana CHUP1 mRNA for actin binding protein, complete cds Length = 3320 Score = 73.8 bits (37), Expect = 4e-09 Identities = 67/77 (87%) Strand = Plus / Plus Query: 2314 atgattggagagattgagaacagatcaacattcctattagctgtcaaagctgatgtggag 2373 |||||||| || || |||||| ||||||||||||| ||||| || ||||| ||||||||| Sbjct: 2497 atgattggggaaatcgagaaccgatcaacattcctcttagcagtaaaagcggatgtggag 2556 Query: 2374 acacaaggagaatttgt 2390 |||||||| || ||||| Sbjct: 2557 acacaaggggactttgt 2573 Score = 56.0 bits (28), Expect = 8e-04 Identities = 196/252 (77%) Strand = Plus / Plus Query: 2461 tggctggatgaagagttgtcattcttggttgatgagagagcagtgctaaagcatttcgat 2520 ||||| ||||||||| | || |||||||||||||| || ||||| || || || || || Sbjct: 2644 tggctagatgaagagctctccttcttggttgatgaaagggcagttcttaaacactttgac 2703 Query: 2521 tggccagagagcaaaactgatgcattaagagaggccgcctttgagtatcaggacctggtg 2580 |||||||| | ||| ||||||| || |||| || || ||||| ||||| || || || Sbjct: 2704 tggccagaaggtaaagctgatgcgctacgagaagcagcttttgaatatcaagatcttatg 2763 Query: 2581 aaactagagaacaaggctacatcctttgtcgatgatccaaaacttccatgtgaagaagct 2640 ||||| ||||| | | ||| |||||||| |||||||| || || | |||||| ||| Sbjct: 2764 aaactggagaagcaagttacgtcctttgttgatgatcctaatctctcttgtgaacctgct 2823 Query: 2641 ttgaagaggatgtattcgttgcttgagaaagtggagcagagtgtttacgcacttcttcgt 2700 ||||||| |||||| |||||| ||||| || || || ||||| ||||| ||| | ||| Sbjct: 2824 ttgaagaagatgtacaagttgctagagaaggttgaacaaagtgtatacgcgcttttacgt 2883 Query: 2701 acaagagacatg 2712 || ||||||||| Sbjct: 2884 acgagagacatg 2895 Score = 52.0 bits (26), Expect = 0.013 Identities = 95/118 (80%) Strand = Plus / Plus Query: 2863 aaagagcccaacagggagttcttgcttctccagggcgtcagatttgccttccgtgttcat 2922 ||||| || ||||| ||||||||||||||||| || || | || || || | || ||| Sbjct: 3046 aaagatccgaacagagagttcttgcttctccaaggtgttcgtttcgcgtttagagtccat 3105 Query: 2923 cagtttgctggaggcttcgacgcagacagcatgaaagtcttcgaggagctgagaagca 2980 |||||||||||||| || || ||||| |||||||||| || ||||| || ||||||| Sbjct: 3106 cagtttgctggagggtttgatgcagagagcatgaaagcatttgaggaacttagaagca 3163 Score = 48.1 bits (24), Expect = 0.20 Identities = 60/72 (83%) Strand = Plus / Plus Query: 1119 aaagcaagtggaaggcctacagatgaacagattcagtgaagtagaggagctggtgtacct 1178 ||||||||||||||| || || ||||| || || |||||||| ||||| |||| || || Sbjct: 1215 aaagcaagtggaagggcttcaaatgaataggtttagtgaagttgaggaattggtttatct 1274 Query: 1179 gcgttgggtcaa 1190 ||||||||||| Sbjct: 1275 acgttgggtcaa 1286
>ref|NM_001067451.1| Oryza sativa (japonica cultivar-group) Os08g0129600 (Os08g0129600) mRNA, complete cds Length = 3034 Score = 61.9 bits (31), Expect = 1e-05 Identities = 40/43 (93%) Strand = Plus / Plus Query: 2486 tggttgatgagagagcagtgctaaagcatttcgattggccaga 2528 |||| ||||||||||||||||| |||||||| ||||||||||| Sbjct: 2282 tggtggatgagagagcagtgctgaagcattttgattggccaga 2324
>gb|AY347840.1| Malus x domestica clone 13-3 putative actin-binding protein mRNA, partial cds Length = 387 Score = 61.9 bits (31), Expect = 1e-05 Identities = 43/47 (91%) Strand = Plus / Plus Query: 2911 ttccgtgttcatcagtttgctggaggcttcgacgcagacagcatgaa 2957 ||||| ||||||||||||||||||||||| || ||||| |||||||| Sbjct: 214 ttccgagttcatcagtttgctggaggctttgatgcagagagcatgaa 260
>dbj|AK102166.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033086H09, full insert sequence Length = 3034 Score = 61.9 bits (31), Expect = 1e-05 Identities = 40/43 (93%) Strand = Plus / Plus Query: 2486 tggttgatgagagagcagtgctaaagcatttcgattggccaga 2528 |||| ||||||||||||||||| |||||||| ||||||||||| Sbjct: 2282 tggtggatgagagagcagtgctgaagcattttgattggccaga 2324
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8 Length = 28434780 Score = 60.0 bits (30), Expect = 5e-05 Identities = 36/38 (94%) Strand = Plus / Minus Query: 2491 gatgagagagcagtgctaaagcatttcgattggccaga 2528 ||||||||||||||||| |||||||| ||||||||||| Sbjct: 1648570 gatgagagagcagtgctgaagcattttgattggccaga 1648533 Score = 44.1 bits (22), Expect = 3.2 Identities = 22/22 (100%) Strand = Plus / Plus Query: 345 aagaagaggaggaggaagaggt 366 |||||||||||||||||||||| Sbjct: 21576216 aagaagaggaggaggaagaggt 21576237
>dbj|AP004591.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0582D05 Length = 150483 Score = 60.0 bits (30), Expect = 5e-05 Identities = 36/38 (94%) Strand = Plus / Minus Query: 2491 gatgagagagcagtgctaaagcatttcgattggccaga 2528 ||||||||||||||||| |||||||| ||||||||||| Sbjct: 48070 gatgagagagcagtgctgaagcattttgattggccaga 48033
>gb|AC132111.4| Mus musculus BAC clone RP24-200H19 from 14, complete sequence Length = 174164 Score = 56.0 bits (28), Expect = 8e-04 Identities = 31/32 (96%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagaggtcaaga 371 |||||| ||||||||||||||||||||||||| Sbjct: 99701 ggagaaggaagaggaggaggaagaggtcaaga 99670
>gb|AC146570.6| Medicago truncatula clone mth2-103j7, complete sequence Length = 122623 Score = 54.0 bits (27), Expect = 0.003 Identities = 63/75 (84%) Strand = Plus / Minus Query: 1119 aaagcaagtggaaggcctacagatgaacagattcagtgaagtagaggagctggtgtacct 1178 ||||||||||||||| || |||||||| || ||||||||||| || || || || ||||| Sbjct: 76110 aaagcaagtggaaggactccagatgaataggttcagtgaagttgaagaacttgtatacct 76051 Query: 1179 gcgttgggtcaacgc 1193 || ||||| ||||| Sbjct: 76050 tcgctgggttaacgc 76036
>ref|XM_895552.2| PREDICTED: Mus musculus hypothetical LOC619959 (LOC619959), mRNA Length = 1215 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 696 ggagaaagaagaggaggaggaagagg 721
>gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosome 6, complete sequence Length = 218586 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 102709 ggagaaagaagaggaggaggaagagg 102734
>gb|AC102219.11| Mus musculus chromosome 15, clone RP24-96K14, complete sequence Length = 194425 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 100473 ggagaaagaagaggaggaggaagagg 100448 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 100416 ggagaaagaagaggaggaggaaga 100393
>gb|BC026554.1| Mus musculus chromogranin A, mRNA (cDNA clone MGC:36117 IMAGE:4990941), complete cds Length = 1892 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 848 ggagaaagaagaggaggaggaagagg 873
>gb|AC125461.4| Mus musculus BAC clone RP23-62K10 from chromosome 3, complete sequence Length = 201415 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 144330 ggagaaagaagaggaggaggaagagg 144305
>gb|AC129200.4| Mus musculus BAC clone RP24-221J22 from chromosome 2, complete sequence Length = 168365 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 13753 ggagaaagaagaggaggaggaagagg 13728
>gb|AC122478.3| Mus musculus BAC clone RP24-337D11 from chromosome 6, complete sequence Length = 135772 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 92724 ggagaaagaagaggaggaggaagagg 92749
>gb|AC123034.5| Mus musculus BAC clone RP24-484E17 from chromosome 13, complete sequence Length = 177675 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 172771 ggagaaagaagaggaggaggaagagg 172746
>gb|AC124170.3| Mus musculus BAC clone RP23-155H5 from 8, complete sequence Length = 235023 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 181421 ggagaaagaagaggaggaggaagagg 181396
>gb|AC160106.2| Mus musculus BAC clone RP24-300H23 from chromosome 13, complete sequence Length = 184364 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 7733 ggagaaagaagaggaggaggaagagg 7758 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 7757 ggagaaagaagaggaggaggaagagg 7782
>gb|AC124918.5| Rattus norvegicus 4 BAC CH230-4H1 (Children's Hospital Oakland Research Institute) complete sequence Length = 228052 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 86248 ggagaaagaagaggaggaggaagagg 86273
>dbj|AK144504.1| Mus musculus 16 days neonate male diencephalon cDNA, RIKEN full-length enriched library, clone:G630083O06 product:chromogranin A, full insert sequence Length = 1877 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 858 ggagaaagaagaggaggaggaagagg 883
>gb|AC153837.4| Mus musculus 6 BAC RP23-192D5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 232039 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 81808 ggagaaagaagaggaggaggaagagg 81783
>dbj|AK132717.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4922502C19 product:unclassifiable, full insert sequence Length = 1203 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 696 ggagaaagaagaggaggaggaagagg 721
>gb|AC156033.6| Mus musculus BAC clone RP23-377G8 from chromosome 12, complete sequence Length = 216718 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 120604 ggagaaagaagaggaggaggaagagg 120579
>gb|S80994.1| MLC-2=myosin light chain 2 {promoter} [rats, Wistar-Kyoto, spontaneously hypertensive, Genomic, 1964 nt] Length = 1964 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 1655 ggagaaagaagaggaggaggaagagg 1630
>gb|AC154205.1| Mus musculus BAC clone RP24-88I1 from chromosome 14, complete sequence Length = 219623 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 154897 ggagaaagaagaggaggaggaagagg 154872
>gb|AC154610.3| Mus musculus BAC clone RP23-335A11 from chromosome 13, complete sequence Length = 201893 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 171544 ggagaaagaagaggaggaggaagagg 171569 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 171568 ggagaaagaagaggaggaggaagagg 171593
>gb|AC154462.2| Mus musculus BAC clone RP24-165F12 from chromosome 14, complete sequence Length = 164631 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 55456 ggagaaagaagaggaggaggaagagg 55481
>gb|AC127540.10| Homo sapiens chromosome 17, clone RP1-77H15, complete sequence Length = 149000 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 137967 ggagaaagaagaggaggaggaagagg 137942
>emb|X86100.1|RNDNABSP R.norvegicus BSP gene Length = 5286 Score = 52.0 bits (26), Expect = 0.013 Identities = 29/30 (96%) Strand = Plus / Minus Query: 336 atggggagaaagaagaggaggaggaagagg 365 |||||||| ||||||||||||||||||||| Sbjct: 4414 atggggaggaagaagaggaggaggaagagg 4385 Score = 52.0 bits (26), Expect = 0.013 Identities = 29/30 (96%) Strand = Plus / Minus Query: 336 atggggagaaagaagaggaggaggaagagg 365 |||||||| ||||||||||||||||||||| Sbjct: 4522 atggggaggaagaagaggaggaggaagagg 4493
>emb|CT025544.17| Mouse DNA sequence from clone RP23-204K2 on chromosome 14, complete sequence Length = 199783 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 198583 ggagaaagaagaggaggaggaagagg 198608
>gb|AC005822.1|AC005822 Homo sapiens chromosome 17, clone hRPK.209_J_20, complete sequence Length = 169931 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 2653 ggagaaagaagaggaggaggaagagg 2678
>emb|AL929196.5| Mouse DNA sequence from clone RP23-7D13 on chromosome 2, complete sequence Length = 51115 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 43812 ggagaaagaagaggaggaggaagagg 43837
>gb|AC133188.4| Mus musculus BAC clone RP23-330F6 from 13, complete sequence Length = 201730 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 50895 ggagaaagaagaggaggaggaagagg 50870
>emb|AJ009612.5|HSAJ9612 Homo sapiens chromosome 17 sequence from PAC 77H15 region D17S842-D17S953 map 17p11.2, complete sequence Length = 148978 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 11035 ggagaaagaagaggaggaggaagagg 11060
>gb|U26708.1|RNU26708 Rattus norvegicus cardiac myosin light chain 2 (MLC2) gene, promoter region Length = 1980 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 1655 ggagaaagaagaggaggaggaagagg 1630
>gb|M30298.1|RATMLCB1 Rat cardiac myosin light chain 2 (MLC-2) gene, exon 1 Length = 549 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 171 ggagaaagaagaggaggaggaagagg 146
>ref|NM_007693.1| Mus musculus chromogranin A (Chga), mRNA gb|M64278.1|MUSCRGA Mouse chromogranin A cDNA, complete cds Length = 1892 Score = 52.0 bits (26), Expect = 0.013 Identities = 26/26 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||||| Sbjct: 864 ggagaaagaagaggaggaggaagagg 889
>ref|XM_001058845.1| PREDICTED: Rattus norvegicus hypothetical protein LOC680783 (LOC680783), mRNA Length = 1332 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 604 gagaaagaagaggaggaggaagagg 628 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 661 gagaaagaagaggaggaggaagagg 685 Score = 44.1 bits (22), Expect = 3.2 Identities = 22/22 (100%) Strand = Plus / Plus Query: 344 aaagaagaggaggaggaagagg 365 |||||||||||||||||||||| Sbjct: 499 aaagaagaggaggaggaagagg 520
>ref|XM_001066575.1| PREDICTED: Rattus norvegicus hypothetical protein LOC686111 (LOC686111), mRNA Length = 489 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 172 gagaaagaagaggaggaggaagagg 196
>gb|AC163399.6| Mus musculus chromosome 18, clone RP24-66G13, complete sequence Length = 173868 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagag 364 ||||||||||||||||||||||||| Sbjct: 47049 ggagaaagaagaggaggaggaagag 47073
>ref|XM_633879.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0185634) mRNA, complete cds Length = 2562 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 562 gagaaagaagaggaggaggaagagg 586
>gb|AC120348.9| Mus musculus chromosome 5, clone RP23-55P22, complete sequence Length = 244565 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Minus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 15846 gagaaagaagaggaggaggaagagg 15822 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||| Sbjct: 6768 ggagaaggaagaggaggaggaagagg 6743
>gb|AC147455.3| Atelerix albiventris clone LB4-341B4, complete sequence Length = 164065 Score = 50.1 bits (25), Expect = 0.052 Identities = 28/29 (96%) Strand = Plus / Minus Query: 336 atggggagaaagaagaggaggaggaagag 364 ||||| ||||||||||||||||||||||| Sbjct: 86411 atgggaagaaagaagaggaggaggaagag 86383
>gb|AC139042.18| Mus musculus chromosome 18, clone RP23-261C19, complete sequence Length = 195202 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagag 364 ||||||||||||||||||||||||| Sbjct: 124432 ggagaaagaagaggaggaggaagag 124456
>gb|AC138641.10| Mus musculus chromosome 5, clone RP23-466K15, complete sequence Length = 175628 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 85054 gagaaagaagaggaggaggaagagg 85078 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||| Sbjct: 94132 ggagaaggaagaggaggaggaagagg 94157
>gb|AC167969.2| Mus musculus BAC clone RP24-446H24 from chromosome 17, complete sequence Length = 178774 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 44580 gagaaagaagaggaggaggaagagg 44604
>gb|AC122015.3| Mus musculus BAC clone RP24-358M18 from chromosome 6, complete sequence Length = 166966 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 159077 gagaaagaagaggaggaggaagagg 159101 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaaga 363 ||||||||||||||||||||||| Sbjct: 159104 gagaaagaagaggaggaggaaga 159126
>gb|AC126672.3| Mus musculus BAC clone RP24-473A18 from chromosome 9, complete sequence Length = 191730 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 132709 gagaaagaagaggaggaggaagagg 132733
>gb|AC122230.4| Mus musculus BAC clone RP23-133F23 from 9, complete sequence Length = 183554 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagag 364 ||||||||||||||||||||||||| Sbjct: 146713 ggagaaagaagaggaggaggaagag 146689
>gb|AC126805.4| Mus musculus BAC clone RP23-109A15 from 13, complete sequence Length = 177083 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Minus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 25005 gagaaagaagaggaggaggaagagg 24981
>gb|AC124521.2| Mus musculus BAC clone RP23-395M9 from 5, complete sequence Length = 184380 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Minus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 90737 gagaaagaagaggaggaggaagagg 90713
>gb|BC096868.1| Danio rerio similar to Neurofilament triplet L protein (68 kDa neurofilament protein) (Neurofilament light polypeptide) (NF-L), mRNA (cDNA clone IMAGE:3815311), partial cds Length = 1581 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 1458 gagaaagaagaggaggaggaagagg 1482
>ref|NM_001039838.1| Danio rerio zgc:136626 (zgc:136626), mRNA gb|BC114232.1| Danio rerio zgc:136626, mRNA (cDNA clone MGC:136626 IMAGE:7054847), complete cds Length = 2240 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 1449 gagaaagaagaggaggaggaagagg 1473
>gb|AC115458.5| Rattus norvegicus 13 BAC CH230-190J23 (Children's Hospital Oakland Research Institute) complete sequence Length = 69404 Score = 50.1 bits (25), Expect = 0.052 Identities = 28/29 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagaggt 366 |||||||| |||||||||||||||||||| Sbjct: 49925 ggggagaaggaagaggaggaggaagaggt 49953
>emb|Z78205.1|BHT1UL Bovine herpesvirus type 1 UL22-35 genes Length = 37000 Score = 50.1 bits (25), Expect = 0.052 Identities = 28/29 (96%) Strand = Plus / Plus Query: 751 ggcgctgccgccaagaaggagctcgacgc 779 ||||||||||||||||||||||| ||||| Sbjct: 2613 ggcgctgccgccaagaaggagctggacgc 2641
>emb|AJ004801.1|BHV1CGEN Bovine herpesvirus type 1.1 complete genome Length = 135301 Score = 50.1 bits (25), Expect = 0.052 Identities = 28/29 (96%) Strand = Plus / Plus Query: 751 ggcgctgccgccaagaaggagctcgacgc 779 ||||||||||||||||||||||| ||||| Sbjct: 33413 ggcgctgccgccaagaaggagctggacgc 33441
>ref|XM_689292.1| PREDICTED: Danio rerio similar to Neurofilament triplet L protein (68 kDa neurofilament protein) (Neurofilament light polypeptide) (NF-L) (LOC566027), mRNA Length = 2009 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 1452 gagaaagaagaggaggaggaagagg 1476
>gb|AC122406.5| Mus musculus BAC clone RP24-126L14 from chromosome 17, complete sequence Length = 161377 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 113734 gagaaagaagaggaggaggaagagg 113758
>gb|AC153130.4| Mus musculus BAC clone RP24-252F22 from chromosome 13, complete sequence Length = 186412 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Minus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 125275 gagaaagaagaggaggaggaagagg 125251
>gb|AC026424.5| Homo sapiens chromosome 5 clone CTD-2174D2, complete sequence Length = 123003 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 1458 gcagaaactcaagaagtggggaagg 1482 ||||||||||||||||||||||||| Sbjct: 11352 gcagaaactcaagaagtggggaagg 11376
>emb|AL669897.15| Mouse DNA sequence from clone RP23-78H4 on chromosome 11 Contains the Ywhae gene for tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon polypeptide, the Doc2b gene for double C2 beta, a novl gene, the 3' end of the gene for a novel protein similar to rat rabphilin-3a related protein and two CpG islands, complete sequence Length = 178980 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 76816 gagaaagaagaggaggaggaagagg 76840
>gb|AC010245.4|AC010245 Homo sapiens chromosome 5 clone CTC-366B18, complete sequence Length = 117840 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Minus Query: 1458 gcagaaactcaagaagtggggaagg 1482 ||||||||||||||||||||||||| Sbjct: 62109 gcagaaactcaagaagtggggaagg 62085
>gb|AC008488.7|AC008488 Homo sapiens chromosome 5 clone CTC-424O12, complete sequence Length = 208117 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 1458 gcagaaactcaagaagtggggaagg 1482 ||||||||||||||||||||||||| Sbjct: 175574 gcagaaactcaagaagtggggaagg 175598
>emb|BX005158.8| Zebrafish DNA sequence from clone DKEY-222N6 in linkage group 8, complete sequence Length = 74638 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 352 gagaaagaagaggaggaggaagagg 376
>emb|AL772311.19| Mouse DNA sequence from clone RP23-87P16 on chromosome 4, complete sequence Length = 234393 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Minus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 92159 gagaaagaagaggaggaggaagagg 92135
>gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complete sequence Length = 185649 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 45798 gagaaagaagaggaggaggaagagg 45822
>emb|CT025701.10| Mouse DNA sequence from clone RP24-68C7 on chromosome 9, complete sequence Length = 120779 Score = 50.1 bits (25), Expect = 0.052 Identities = 28/29 (96%) Strand = Plus / Plus Query: 337 tggggagaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| |||| Sbjct: 42268 tggggagaaagaagaggaggaggaggagg 42296
>emb|AL954310.6| Zebrafish DNA sequence from clone CH211-255G12, complete sequence Length = 156407 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 154759 gagaaagaagaggaggaggaagagg 154783
>emb|AL929433.10| Mouse DNA sequence from clone RP23-193M23 on chromosome 4, complete sequence Length = 198426 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagag 364 ||||||||||||||||||||||||| Sbjct: 125231 ggagaaagaagaggaggaggaagag 125207
>gb|AC138721.4| Mus musculus BAC clone RP23-157G22 from 6, complete sequence Length = 187385 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||||| Sbjct: 111631 gagaaagaagaggaggaggaagagg 111655 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaaga 363 ||||||||||||||||||||||| Sbjct: 111658 gagaaagaagaggaggaggaaga 111680
>gb|AC139378.4| Mus musculus BAC clone RP23-265F20 from 9, complete sequence Length = 256632 Score = 50.1 bits (25), Expect = 0.052 Identities = 25/25 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagag 364 ||||||||||||||||||||||||| Sbjct: 143982 ggagaaagaagaggaggaggaagag 144006
>ref|XM_001151954.1| PREDICTED: Pan troglodytes hypothetical protein LOC745742 (LOC745742), mRNA Length = 1062 Score = 48.1 bits (24), Expect = 0.20 Identities = 33/36 (91%) Strand = Plus / Plus Query: 2092 ccaggtgcacctcctccaccaccacctccagggaga 2127 ||||| ||||||||| ||||| |||||||||||||| Sbjct: 359 ccaggagcacctccttcaccatcacctccagggaga 394 Score = 46.1 bits (23), Expect = 0.81 Identities = 32/35 (91%) Strand = Plus / Plus Query: 2092 ccaggtgcacctcctccaccaccacctccagggag 2126 ||||| ||||||||| ||||| ||||||||||||| Sbjct: 466 ccaggagcacctccttcaccatcacctccagggag 500 Score = 46.1 bits (23), Expect = 0.81 Identities = 32/35 (91%) Strand = Plus / Plus Query: 2092 ccaggtgcacctcctccaccaccacctccagggag 2126 ||||| ||||||||| ||||| ||||||||||||| Sbjct: 576 ccaggagcacctccttcaccatcacctccagggag 610 Score = 46.1 bits (23), Expect = 0.81 Identities = 32/35 (91%) Strand = Plus / Plus Query: 2092 ccaggtgcacctcctccaccaccacctccagggag 2126 ||||| ||||||||| ||||| ||||||||||||| Sbjct: 631 ccaggagcacctccttcaccatcacctccagggag 665
>ref|XM_001167189.1| PREDICTED: Pan troglodytes claspin, transcript variant 1 (CLSPN), mRNA Length = 5478 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 1921 ggagaaagaagaggaggaggaaga 1944
>ref|XM_513311.2| PREDICTED: Pan troglodytes claspin, transcript variant 2 (CLSPN), mRNA Length = 4555 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 2113 ggagaaagaagaggaggaggaaga 2136
>ref|XM_001079658.1| PREDICTED: Rattus norvegicus hypothetical protein LOC687671 (LOC687671), mRNA Length = 774 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||||| Sbjct: 577 ggggaggaagaagaggaggaggaagagg 604 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||| ||||||||||||||||||||| Sbjct: 624 ggaggaagaagaggaggaggaagagg 649
>ref|XM_001071008.1| PREDICTED: Rattus norvegicus hypothetical protein LOC689503 (LOC689503), mRNA Length = 453 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||||| Sbjct: 256 ggggaggaagaagaggaggaggaagagg 283 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||| ||||||||||||||||||||| Sbjct: 303 ggaggaagaagaggaggaggaagagg 328
>gb|BC115025.1| Homo sapiens claspin homolog (Xenopus laevis), mRNA (cDNA clone MGC:131612 IMAGE:7961363), complete cds Length = 4007 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 1870 ggagaaagaagaggaggaggaaga 1893
>gb|BC115026.1| Homo sapiens claspin homolog (Xenopus laevis), mRNA (cDNA clone MGC:131613 IMAGE:7961366), complete cds Length = 4193 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 2062 ggagaaagaagaggaggaggaaga 2085
>ref|NM_117970.3| Arabidopsis thaliana unknown protein (AT4G18570) mRNA, complete cds Length = 2309 Score = 48.1 bits (24), Expect = 0.20 Identities = 36/40 (90%) Strand = Plus / Plus Query: 2486 tggttgatgagagagcagtgctaaagcatttcgattggcc 2525 |||||||||||||||||||| | || |||||||| ||||| Sbjct: 1585 tggttgatgagagagcagtgttgaaacatttcgagtggcc 1624 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 2911 ttccgtgttcatcagtttgctggagg 2936 |||||||||||||||||||| ||||| Sbjct: 2004 ttccgtgttcatcagtttgccggagg 2029
>gb|AC167537.7| Mus musculus chromosome 8, clone RP23-99B10, complete sequence Length = 201791 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 76156 ggagaaagaagaggaggaggaaga 76179 Score = 44.1 bits (22), Expect = 3.2 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 aaagaagaggaggaggaagagg 365 |||||||||||||||||||||| Sbjct: 122424 aaagaagaggaggaggaagagg 122403 Score = 44.1 bits (22), Expect = 3.2 Identities = 22/22 (100%) Strand = Plus / Minus Query: 344 aaagaagaggaggaggaagagg 365 |||||||||||||||||||||| Sbjct: 122695 aaagaagaggaggaggaagagg 122674
>gb|AC156952.22| Mus musculus 10 BAC RP24-385D2 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 179140 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 146747 ggagaaagaagaggaggaggaaga 146770
>gb|AC102130.7| Mus musculus chromosome 3, clone RP23-223I2, complete sequence Length = 176409 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 44699 agaaagaagaggaggaggaagagg 44722
>gb|AC118193.9| Mus musculus chromosome 8, clone RP23-241A10, complete sequence Length = 222682 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 341 gagaaagaagaggaggaggaagag 364 |||||||||||||||||||||||| Sbjct: 218312 gagaaagaagaggaggaggaagag 218289
>gb|AC166782.4| Mus musculus chromosome 8, clone wi1-146O13, complete sequence Length = 37508 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 21243 ggagaaagaagaggaggaggaaga 21266
>gb|AC163686.3| Mus musculus BAC clone RP23-3C10 from chromosome 6, complete sequence Length = 209207 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 194419 ggagaaagaagaggaggaggaaga 194442
>gb|AC102756.8| Mus musculus chromosome 3, clone RP24-167K1, complete sequence Length = 175712 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 133898 ggagaaagaagaggaggaggaaga 133875
>gb|AC167246.2| Mus musculus BAC clone RP23-401H11 from chromosome 9, complete sequence Length = 160140 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 133855 agaaagaagaggaggaggaagagg 133832
>gb|BC081019.1| Xenopus laevis MGC81609 protein, mRNA (cDNA clone MGC:81609 IMAGE:6863823), complete cds Length = 3653 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 337 tggggagaaagaagaggaggaggaagag 364 ||||||| |||||||||||||||||||| Sbjct: 594 tggggaggaagaagaggaggaggaagag 621
>gb|AC124107.8| Mus musculus chromosome 5, clone RP24-317M4, complete sequence Length = 194641 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 186050 agaaagaagaggaggaggaagagg 186073
>gb|AC165233.6| Mus musculus chromosome 8, clone RP23-307O2, complete sequence Length = 158925 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 341 gagaaagaagaggaggaggaagag 364 |||||||||||||||||||||||| Sbjct: 15016 gagaaagaagaggaggaggaagag 14993
>gb|AC022235.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-121E15, complete sequence Length = 197761 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 100831 ggagaaagaagaggaggaggaaga 100808
>gb|AC129580.14| Mus musculus chromosome 14, clone RP24-149P3, complete sequence Length = 185100 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 31248 agaaagaagaggaggaggaagagg 31225
>ref|XM_502163.1| Yarrowia lipolytica CLIB122, YALI0C23056g predicted mRNA Length = 2910 Score = 48.1 bits (24), Expect = 0.20 Identities = 30/32 (93%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggtcaaga 371 |||| ||||||||||||||||||| ||||||| Sbjct: 1344 ggaggaagaagaggaggaggaagaagtcaaga 1375
>gb|AC156987.7| Mus musculus chromosome 7, clone RP23-78K13, complete sequence Length = 231140 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 |||||||||||||| ||||||||||||| Sbjct: 103898 ggggagaaagaagaagaggaggaagagg 103925
>gb|AC159996.7| Mus musculus chromosome 5, clone RP23-46J11, complete sequence Length = 208036 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 13244 agaaagaagaggaggaggaagagg 13267
>gb|AC107803.15| Mus musculus chromosome 9, clone RP23-47I9, complete sequence Length = 198199 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 2893 agaaagaagaggaggaggaagagg 2870
>gb|AC162916.3| Mus musculus BAC clone RP23-395G18 from chromosome 1, complete sequence Length = 224904 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 45852 agaaagaagaggaggaggaagagg 45829
>gb|AC154402.2| Mus musculus BAC clone RP24-235N24 from chromosome 13, complete sequence Length = 145213 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 ||||||||||| |||||||||||||||| Sbjct: 51604 ggggagaaagaggaggaggaggaagagg 51631
>gb|AC136513.2| Mus musculus BAC clone RP23-477N9 from chromosome 5, complete sequence Length = 188517 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 113966 agaaagaagaggaggaggaagagg 113943
>gb|AC134603.4| Mus musculus BAC clone RP23-246L24 from chromosome 7, complete sequence Length = 229312 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 103389 ggagaaagaagaggaggaggaaga 103366
>gb|AC121777.3| Mus musculus BAC clone RP23-359A23 from chromosome 16, complete sequence Length = 192846 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 114783 agaaagaagaggaggaggaagagg 114760
>gb|AC122303.2| Mus musculus BAC clone RP23-279L13 from 6, complete sequence Length = 188201 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 77550 agaaagaagaggaggaggaagagg 77573
>gb|BC038991.2| Homo sapiens claspin homolog (Xenopus laevis), mRNA (cDNA clone IMAGE:6050313), partial cds Length = 2187 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 2095 ggagaaagaagaggaggaggaaga 2118
>gb|AC108527.6| Rattus norvegicus 9 BAC CH230-7F11 (Children's Hospital Oakland Research Institute) complete sequence Length = 225777 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 32218 ggagaaagaagaggaggaggaaga 32241
>gb|AC127789.4| Rattus norvegicus 1 BAC CH230-15M17 (Children's Hospital Oakland Research Institute) complete sequence Length = 240825 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagagg 365 |||||||| ||||||||||||||||||| Sbjct: 32887 ggggagaaggaagaggaggaggaagagg 32860
>gb|AC084324.8| Mus musculus Strain C57BL6/J chromosome 2 BAC, RP23-96L7 Complete Sequence, complete sequence Length = 205893 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 202269 agaaagaagaggaggaggaagagg 202292
>dbj|AK138776.1| Mus musculus 0 day neonate thymus cDNA, RIKEN full-length enriched library, clone:A430061H04 product:unclassifiable, full insert sequence Length = 793 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 229 ggagaaagaagaggaggaggaaga 206
>gb|AY128285.1| Arabidopsis thaliana AT4g18560/F28J12_220 mRNA, complete cds Length = 2134 Score = 48.1 bits (24), Expect = 0.20 Identities = 36/40 (90%) Strand = Plus / Plus Query: 2486 tggttgatgagagagcagtgctaaagcatttcgattggcc 2525 |||||||||||||||||||| | || |||||||| ||||| Sbjct: 1410 tggttgatgagagagcagtgttgaaacatttcgagtggcc 1449 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 2911 ttccgtgttcatcagtttgctggagg 2936 |||||||||||||||||||| ||||| Sbjct: 1829 ttccgtgttcatcagtttgccggagg 1854
>gb|BC113116.1| Homo sapiens claspin homolog (Xenopus laevis), mRNA (cDNA clone MGC:131615 IMAGE:7961377), complete cds Length = 4199 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 2062 ggagaaagaagaggaggaggaaga 2085
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7 Length = 29644043 Score = 48.1 bits (24), Expect = 0.20 Identities = 39/44 (88%) Strand = Plus / Plus Query: 2842 gacgcgttgcaaggcacggacaaagagcccaacagggagttctt 2885 ||||| ||||||||||| |||||||| |||| ||| |||||||| Sbjct: 8692733 gacgcattgcaaggcactgacaaagaccccagcagagagttctt 8692776
>gb|AC097634.2| Homo sapiens chromosome 3 clone RP11-154H23, complete sequence Length = 193553 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagag 364 |||||||||||||||||||||||| Sbjct: 64809 gagaaagaagaggaggaggaagag 64832
>emb|AL354864.16| Human DNA sequence from clone RP11-435D7 on chromosome 1 Contains the 5' end of the PSMB2 gene for proteasome (prosome, macropain) subunit, beta type, 2, a novel transcript (FLJ38984), a putative novel transcript, the CLSPN gene for claspin homolog (Xenopus laevis) and the 5' end of the EIF2C4 gene for eukaryotic translation initiation factor 2C, 4, complete sequence Length = 194296 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 62961 ggagaaagaagaggaggaggaaga 62984
>gb|AC154603.3| Mus musculus BAC clone RP23-344D21 from chromosome 13, complete sequence Length = 216297 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 91338 ggagaaagaagaggaggaggaaga 91315 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 ||||||||||||||| |||||||||| Sbjct: 91374 ggagaaagaagaggatgaggaagagg 91349
>gb|AC158524.2| Mus musculus BAC clone RP23-377I1 from chromosome 13, complete sequence Length = 191904 Score = 48.1 bits (24), Expect = 0.20 Identities = 30/32 (93%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagaggtcaaga 371 ||||||||| |||||||||||||||| ||||| Sbjct: 171111 ggagaaagaggaggaggaggaagaggacaaga 171080
>gb|AC146885.3| Callithrix jacchus clone CH259-349L5, complete sequence Length = 213940 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||||| Sbjct: 64300 ggggaggaagaagaggaggaggaagagg 64327
>gb|AF187873.1|AF187873 Cavia porcellus inwardly-rectifying potassium channel Kir2.2 (KCNJ12) gene, complete cds Length = 9642 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaagag 364 |||||||||||||||||||||||| Sbjct: 1805 gagaaagaagaggaggaggaagag 1828
>gb|AC025815.10|AC025815 Arabidopsis thaliana chromosome 1 BAC T8D8 genomic sequence, complete sequence Length = 55021 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 2099 cacctcctccaccaccacctccag 2122 |||||||||||||||||||||||| Sbjct: 52181 cacctcctccaccaccacctccag 52204
>gb|AC035249.7|AC035249 Arabidopsis thaliana chromosome 1 BAC F8D11 genomic sequence, complete sequence Length = 109431 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 2099 cacctcctccaccaccacctccag 2122 |||||||||||||||||||||||| Sbjct: 5277 cacctcctccaccaccacctccag 5300
>dbj|AP005768.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0039C01 Length = 151054 Score = 48.1 bits (24), Expect = 0.20 Identities = 39/44 (88%) Strand = Plus / Plus Query: 2842 gacgcgttgcaaggcacggacaaagagcccaacagggagttctt 2885 ||||| ||||||||||| |||||||| |||| ||| |||||||| Sbjct: 51374 gacgcattgcaaggcactgacaaagaccccagcagagagttctt 51417
>gb|AC012451.8| Homo sapiens BAC clone RP11-414K19 from 2, complete sequence Length = 188121 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 184328 ggagaaagaagaggaggaggaaga 184305
>gb|BT004523.1| Arabidopsis thaliana At4g18560/F28J12_220 gene, complete cds Length = 1929 Score = 48.1 bits (24), Expect = 0.20 Identities = 36/40 (90%) Strand = Plus / Plus Query: 2486 tggttgatgagagagcagtgctaaagcatttcgattggcc 2525 |||||||||||||||||||| | || |||||||| ||||| Sbjct: 1364 tggttgatgagagagcagtgttgaaacatttcgagtggcc 1403 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 2911 ttccgtgttcatcagtttgctggagg 2936 |||||||||||||||||||| ||||| Sbjct: 1783 ttccgtgttcatcagtttgccggagg 1808
>dbj|AP005255.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBb0087F05 Length = 143908 Score = 48.1 bits (24), Expect = 0.20 Identities = 39/44 (88%) Strand = Plus / Plus Query: 2842 gacgcgttgcaaggcacggacaaagagcccaacagggagttctt 2885 ||||| ||||||||||| |||||||| |||| ||| |||||||| Sbjct: 106473 gacgcattgcaaggcactgacaaagaccccagcagagagttctt 106516
>gb|AC015916.13| Homo sapiens chromosome 17, clone CTD-2339F15, complete sequence Length = 102564 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 ||||||||||||||| |||||||||||| Sbjct: 67682 ggggagaaagaagagaaggaggaagagg 67709
>gb|AC007462.3| Homo sapiens BAC clone RP11-85C4 from 2, complete sequence Length = 163464 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 126277 agaaagaagaggaggaggaagagg 126300
>dbj|AP001313.1| Arabidopsis thaliana genomic DNA, chromosome 3, BAC clone:T5M7 Length = 65177 Score = 48.1 bits (24), Expect = 0.20 Identities = 60/72 (83%) Strand = Plus / Plus Query: 1119 aaagcaagtggaaggcctacagatgaacagattcagtgaagtagaggagctggtgtacct 1178 ||||||||||||||| || || ||||| || || |||||||| ||||| |||| || || Sbjct: 57161 aaagcaagtggaagggcttcaaatgaataggtttagtgaagttgaggaattggtttatct 57220 Query: 1179 gcgttgggtcaa 1190 ||||||||||| Sbjct: 57221 acgttgggtcaa 57232 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 2743 ccagttgattggttatctgattctgg 2768 ||||||||||||||||||||| |||| Sbjct: 59116 ccagttgattggttatctgatactgg 59141
>gb|AY659987.1| Macropus eugenii prion protein PrP (PRNP) gene, complete cds Length = 66512 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaa 361 |||||||||||||||||||||||| Sbjct: 30017 ggggagaaagaagaggaggaggaa 29994
>emb|AL929441.37| Mouse DNA sequence from clone RP23-418E20 on chromosome 4, complete sequence Length = 202920 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaa 361 |||||||||||||||||||||||| Sbjct: 143979 ggggagaaagaagaggaggaggaa 144002
>emb|BX826449.1|CNS0A49I Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB27ZF11 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 2022 Score = 48.1 bits (24), Expect = 0.20 Identities = 36/40 (90%) Strand = Plus / Plus Query: 2486 tggttgatgagagagcagtgctaaagcatttcgattggcc 2525 |||||||||||||||||||| | || |||||||| ||||| Sbjct: 1426 tggttgatgagagagcagtgttgaaacatttcgagtggcc 1465 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 2911 ttccgtgttcatcagtttgctggagg 2936 |||||||||||||||||||| ||||| Sbjct: 1845 ttccgtgttcatcagtttgccggagg 1870
>gb|AC132114.4| Mus musculus BAC clone RP24-112A6 from chromosome 9, complete sequence Length = 192639 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 160586 ggagaaagaagaggaggaggaaga 160609
>emb|AL929021.13| Mouse DNA sequence from clone RP23-89H14 on chromosome 2, complete sequence Length = 181549 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||||| Sbjct: 29431 ggggaggaagaagaggaggaggaagagg 29458
>gb|AC158183.2| Selaginella moellendorffii clone JGIASXY-5D8, complete sequence Length = 39479 Score = 48.1 bits (24), Expect = 0.20 Identities = 48/56 (85%) Strand = Plus / Minus Query: 1162 gaggagctggtgtacctgcgttgggtcaacgcctgtctgcgattcgagctccgcaa 1217 ||||||||||| |||||||| |||||||| || || ||||| | |||||| ||||| Sbjct: 32657 gaggagctggtctacctgcgctgggtcaatgcttgcctgcgctacgagctacgcaa 32602
>gb|BC091633.1| Xenopus laevis hypothetical protein MGC98482, mRNA (cDNA clone MGC:98482 IMAGE:7198444), complete cds Length = 3166 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 336 atggggagaaagaagaggaggaggaaga 363 |||||||| ||||||||||||||||||| Sbjct: 2219 atggggaggaagaagaggaggaggaaga 2246
>gb|AC144773.3| Mus musculus BAC clone RP24-176P22 from 1, complete sequence Length = 167510 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 14706 agaaagaagaggaggaggaagagg 14729
>ref|NM_001013983.1| Rattus norvegicus similar to Hypothetical protein KIAA0152 (RGD1307736), mRNA gb|BC089839.1| Rattus norvegicus similar to Hypothetical protein KIAA0152, mRNA (cDNA clone MGC:108831 IMAGE:7365814), complete cds Length = 1788 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 817 agaaagaagaggaggaggaagagg 840
>gb|AC154560.3| Mus musculus BAC clone RP23-400E20 from chromosome 17, complete sequence Length = 197657 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||| |||| Sbjct: 62118 ggggagaaagaagaggaggaggaggagg 62091
>gb|AC146694.12| Pan troglodytes clone rp43-178l17, complete sequence Length = 229508 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||||| Sbjct: 206931 ggggaggaagaagaggaggaggaagagg 206958
>ref|NM_022111.2| Homo sapiens claspin homolog (Xenopus laevis) (CLSPN), mRNA Length = 4379 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 2069 ggagaaagaagaggaggaggaaga 2092
>gb|AC153893.3| Mus musculus 10 BAC RP23-124O20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 228194 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 29904 ggagaaagaagaggaggaggaaga 29927
>emb|AL591542.20| Mouse DNA sequence from clone RP23-321M14 on chromosome 2, complete sequence Length = 197190 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 75232 agaaagaagaggaggaggaagagg 75255
>gb|AC134525.5| Mus musculus BAC clone RP24-496F7 from 8, complete sequence Length = 215900 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 341 gagaaagaagaggaggaggaagag 364 |||||||||||||||||||||||| Sbjct: 41517 gagaaagaagaggaggaggaagag 41494
>emb|CT009762.8| Mouse DNA sequence from clone RP23-211O9 on chromosome 13, complete sequence Length = 229171 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagagg 365 ||||||||||| |||||||||||||||| Sbjct: 113359 ggggagaaagaggaggaggaggaagagg 113332
>emb|CT025538.13| Mouse DNA sequence from clone RP23-386E7 on chromosome 14, complete sequence Length = 206957 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 184508 agaaagaagaggaggaggaagagg 184485
>gb|AC132431.3| Mus musculus BAC clone RP23-211M23 from 6, complete sequence Length = 207155 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 131264 ggagaaagaagaggaggaggaaga 131287
>emb|CR382129.1| Yarrowia lipolytica chromosome C of strain CLIB122 of Yarrowia lipolytica Length = 3272609 Score = 48.1 bits (24), Expect = 0.20 Identities = 30/32 (93%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggtcaaga 371 |||| ||||||||||||||||||| ||||||| Sbjct: 3095278 ggaggaagaagaggaggaggaagaagtcaaga 3095309
>emb|AL611963.24| Mouse DNA sequence from clone RP23-79J18 on chromosome 4, complete sequence Length = 222196 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 119988 ggagaaagaagaggaggaggaaga 119965
>emb|AL928623.5| Mouse DNA sequence from clone RP23-276I21 on chromosome 2, complete sequence Length = 184480 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagagg 365 |||||||||||||||||||||||| Sbjct: 3626 agaaagaagaggaggaggaagagg 3603
>emb|AL607108.17| Mouse DNA sequence from clone RP23-42F6 on chromosome 11, complete sequence Length = 202842 Score = 48.1 bits (24), Expect = 0.20 Identities = 27/28 (96%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||||| Sbjct: 185541 ggggaggaagaagaggaggaggaagagg 185568 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||| ||||||||||||||||||||| Sbjct: 1862 ggaggaagaagaggaggaggaagagg 1837
>gb|AC141646.4| Mus musculus BAC clone RP23-84E4 from chromosome 9, complete sequence Length = 193235 Score = 48.1 bits (24), Expect = 0.20 Identities = 24/24 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaaga 363 |||||||||||||||||||||||| Sbjct: 82001 ggagaaagaagaggaggaggaaga 82024
>ref|XM_001234698.1| PREDICTED: Gallus gallus similar to 4930506M07Rik protein (LOC771423), mRNA Length = 1775 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 901 cctccgccgccaccaccgcctcc 923
>ref|XM_001220551.1| Chaetomium globosum CBS 148.51 predicted protein (CHGG_01331) mRNA, complete cds Length = 537 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2100 acctcctccaccaccacctccag 2122 ||||||||||||||||||||||| Sbjct: 235 acctcctccaccaccacctccag 257
>gb|BC107395.2| Mus musculus keratin 77, mRNA (cDNA clone MGC:130400 IMAGE:40058152), complete cds Length = 1850 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 1565 cctccgccgccaccaccgcctcc 1543
>ref|NM_001057112.1| Oryza sativa (japonica cultivar-group) Os03g0588200 (Os03g0588200) mRNA, complete cds Length = 2620 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggt 366 ||||||||| ||||||||||||||||| Sbjct: 462 ggagaaagaggaggaggaggaagaggt 488
>gb|AE014298.4| Drosophila melanogaster chromosome X, complete sequence Length = 22422827 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 10500063 cctccgccgccaccaccgcctcc 10500085
>tpg|BK005256.1| TPA_exp: Mus musculus embryonic type II keratin 1 mRNA, complete cds Length = 1719 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 1565 cctccgccgccaccaccgcctcc 1543
>ref|NM_001003667.1| Mus musculus keratin 77 (Krt77), mRNA tpg|BK003993.1| TPA_exp: Mus musculus type II keratin Kb39 mRNA, complete cds Length = 1719 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 1565 cctccgccgccaccaccgcctcc 1543
>gb|AC189549.1| Brassica rapa subsp. pekinensis clone KBrH005C21, complete sequence Length = 159860 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2099 cacctcctccaccaccacctcca 2121 ||||||||||||||||||||||| Sbjct: 14997 cacctcctccaccaccacctcca 14975
>ref|XM_392742.3| PREDICTED: Apis mellifera similar to Wiskott-Aldrich syndrome (eczema-thrombocytopenia) (LOC409218), mRNA Length = 1799 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2099 cacctcctccaccaccacctcca 2121 ||||||||||||||||||||||| Sbjct: 1354 cacctcctccaccaccacctcca 1376
>ref|XM_001059738.1| PREDICTED: Rattus norvegicus hypothetical protein LOC680973 (LOC680973), mRNA Length = 567 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggagga 360 ||||||||||||||||||||||| Sbjct: 532 ggggagaaagaagaggaggagga 554
>ref|XM_001112202.1| PREDICTED: Macaca mulatta hypothetical protein LOC718881 (LOC718881), mRNA Length = 9219 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2136 ccctccgccgccaccaccgcctc 2158 ||||||||||||||||||||||| Sbjct: 240 ccctccgccgccaccaccgcctc 262
>emb|CT025774.19| Mouse DNA sequence from clone RP23-362H18 on chromosome 16, complete sequence Length = 221856 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagag 364 |||||||| |||||||||||||||||| Sbjct: 26742 ggggagaaggaagaggaggaggaagag 26716
>emb|CT009561.24| Mouse DNA sequence from clone RP23-128B6 on chromosome 16, complete sequence Length = 141692 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagag 364 |||||| |||||||||||||||||||| Sbjct: 99109 ggggaggaagaagaggaggaggaagag 99083 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||| ||||||||||||||||||||| Sbjct: 99134 ggaggaagaagaggaggaggaagagg 99109
>gb|AC118646.23| Mus musculus chromosome 15, clone RP24-116A18, complete sequence Length = 205272 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaag 362 ||||||||||||||||||||||| Sbjct: 13709 ggagaaagaagaggaggaggaag 13687
>gb|AC104862.15| Mus musculus chromosome 15, clone RP23-124I9, complete sequence Length = 168581 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 155116 cctccgccgccaccaccgcctcc 155138
>gb|AC158976.14| Mus musculus chromosome 15, clone RP24-71M3, complete sequence Length = 182465 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggt 366 ||||||||| ||||||||||||||||| Sbjct: 16856 ggagaaagaggaggaggaggaagaggt 16882
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 519 caacaacgccgccgagatggagcggct 545 |||||||| |||||||||||||||||| Sbjct: 234119 caacaacggcgccgagatggagcggct 234093
>gb|AC119980.7| Mus musculus chromosome 8, clone RP24-495J19, complete sequence Length = 145150 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagag 364 ||||||||||||||||||||||| Sbjct: 13151 agaaagaagaggaggaggaagag 13129
>gb|AC116525.24| Mus musculus chromosome 15, clone RP24-352I18, complete sequence Length = 149726 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagaggt 366 ||||||||| ||||||||||||||||| Sbjct: 23339 ggagaaagaggaggaggaggaagaggt 23313
>gb|AC154760.2| Mus musculus BAC clone RP24-414E6 from chromosome 14, complete sequence Length = 163089 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 gaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||| Sbjct: 88336 gaaagaagaggaggaggaagagg 88314 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||| ||||||||||||||||||||| Sbjct: 87895 ggaggaagaagaggaggaggaagagg 87870
>gb|AC135502.4| Oryza sativa chromosome 3 BAC OSJNBb0085A04 genomic sequence, complete sequence Length = 132292 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggt 366 ||||||||| ||||||||||||||||| Sbjct: 46235 ggagaaagaggaggaggaggaagaggt 46261
>gb|AC168883.3| Mus musculus 10 BAC RP23-406F5 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 171839 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 339 gggagaaagaagaggaggaggaagagg 365 |||| |||||||||||||||||||||| Sbjct: 126874 gggaaaaagaagaggaggaggaagagg 126848
>gb|AC125273.9| Mus musculus chromosome 1, clone RP24-156N4, complete sequence Length = 187198 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagag 364 ||||||||||||||||||||||| Sbjct: 33802 agaaagaagaggaggaggaagag 33780
>gb|AC145882.3| Pan troglodytes BAC clone RP43-7E19 from 7, complete sequence Length = 197080 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 342 agaaagaagaggaggaggaagag 364 ||||||||||||||||||||||| Sbjct: 58717 agaaagaagaggaggaggaagag 58695
>gb|AC101983.16| Mus musculus chromosome 6, clone RP24-352A8, complete sequence Length = 153860 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 339 gggagaaagaagaggaggaggaagagg 365 |||||| |||||||||||||||||||| Sbjct: 34508 gggagagagaagaggaggaggaagagg 34482
>gb|AC115777.16| Mus musculus chromosome 6, clone RP23-139O6, complete sequence Length = 216399 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagag 364 |||||||| |||||||||||||||||| Sbjct: 90776 ggggagaaggaagaggaggaggaagag 90750
>gb|AC132852.12| Mus musculus chromosome 9, clone RP24-298N7, complete sequence Length = 183786 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 343 gaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||| Sbjct: 171696 gaaagaagaggaggaggaagagg 171718
>gb|AF049850.1|MMHC438N12 Mus musculus major histocompatibility locus class III region: complement C4 (C4) and cytochrome P450 hydroxylase A (CYP21OH-A) genes, complete cds; slp pseudogene, complete sequence; NG6, SKI, and complement factor B (Bf) genes, complete cds; and complement factor C2 (C2) gene, partial cds Length = 149886 Score = 46.1 bits (23), Expect = 0.81 Identities = 29/31 (93%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggtcaag 370 |||||| ||||||||||||||||||| |||| Sbjct: 12952 ggagaaggaagaggaggaggaagaggacaag 12982
>ref|XM_710937.1| Candida albicans SC5314 putative actin-binding protein (CaO19_2190), mRNA Length = 1995 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2099 cacctcctccaccaccacctcca 2121 ||||||||||||||||||||||| Sbjct: 20 cacctcctccaccaccacctcca 42
>ref|XM_710879.1| Candida albicans SC5314 putative actin-binding protein (CaO19_9736), mRNA Length = 1995 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2099 cacctcctccaccaccacctcca 2121 ||||||||||||||||||||||| Sbjct: 20 cacctcctccaccaccacctcca 42
>gb|AC079365.5| Mus musculus strain C57BL6/J chromosome 6 clone RP23-172N5, complete sequence Length = 191310 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaaga 363 ||||||||||||||||||||||| Sbjct: 158719 gagaaagaagaggaggaggaaga 158741 Score = 44.1 bits (22), Expect = 3.2 Identities = 25/26 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagagg 365 |||||| ||||||||||||||||||| Sbjct: 69786 ggagaaggaagaggaggaggaagagg 69811
>gb|AY610958.1| Mus musculus intersectin 1 isoform 13 (Itsn) mRNA, partial cds, alternatively spliced Length = 371 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 141 cctgcccctgcccctgcccacct 163 ||||||||||||||||||||||| Sbjct: 336 cctgcccctgcccctgcccacct 358
>gb|AC132322.3| Mus musculus BAC clone RP24-262F3 from chromosome 13, complete sequence Length = 155179 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2099 cacctcctccaccaccacctcca 2121 ||||||||||||||||||||||| Sbjct: 62863 cacctcctccaccaccacctcca 62885
>gb|AC121301.8| Mus musculus chromosome 7, clone RP23-432H1, complete sequence Length = 205639 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaaga 363 ||||||||||||||||||||||| Sbjct: 97453 gagaaagaagaggaggaggaaga 97475
>gb|AC125254.9| Mus musculus chromosome 9, clone RP24-156I15, complete sequence Length = 161503 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 343 gaaagaagaggaggaggaagagg 365 ||||||||||||||||||||||| Sbjct: 154666 gaaagaagaggaggaggaagagg 154644
>gb|AC118639.12| Mus musculus chromosome 15, clone RP24-112I4, complete sequence Length = 166053 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 339 gggagaaagaagaggaggaggaagagg 365 |||||||||||||||| |||||||||| Sbjct: 120252 gggagaaagaagaggaagaggaagagg 120278
>gb|AC161537.7| Mus musculus chromosome 15, clone RP23-471J11, complete sequence Length = 188471 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 339 gggagaaagaagaggaggaggaagagg 365 |||||||||||||||| |||||||||| Sbjct: 181907 gggagaaagaagaggaagaggaagagg 181881
>gb|AC107850.11| Mus musculus chromosome 17, clone RP23-450G2, complete sequence Length = 216615 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 338 ggggagaaagaagaggaggagga 360 ||||||||||||||||||||||| Sbjct: 49662 ggggagaaagaagaggaggagga 49684
>gb|AC006372.2| Homo sapiens BAC clone RP11-331D5 from 7, complete sequence Length = 190846 Score = 46.1 bits (23), Expect = 0.81 Identities = 32/35 (91%) Strand = Plus / Plus Query: 2092 ccaggtgcacctcctccaccaccacctccagggag 2126 ||||| ||||||||| ||||| ||||||||||||| Sbjct: 51110 ccaggagcacctccttcaccatcacctccagggag 51144
>gb|AC125291.3| Drosophila melanogaster X BAC CH221-17A11 (CHORI Sheared BAC Drosophila melanogaster library) complete sequence Length = 166613 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 162213 cctccgccgccaccaccgcctcc 162191
>gb|AC005153.2| Homo sapiens PAC clone RP4-537P9 from 7, complete sequence Length = 124191 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2099 cacctcctccaccaccacctcca 2121 ||||||||||||||||||||||| Sbjct: 102235 cacctcctccaccaccacctcca 102257
>gb|AC134837.3| Mus musculus BAC clone RP24-338L20 from chromosome 16, complete sequence Length = 175319 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 141 cctgcccctgcccctgcccacct 163 ||||||||||||||||||||||| Sbjct: 38318 cctgcccctgcccctgcccacct 38296
>gb|AC009192.72| Mus musculus strain 129/Sv clone ct7-555d9 map 6, complete sequence Length = 120530 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaag 362 ||||||||||||||||||||||| Sbjct: 24353 ggagaaagaagaggaggaggaag 24375
>ref|NM_132412.1| Drosophila melanogaster CG9817-RA (CG9817), mRNA Length = 6497 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 4502 cctccgccgccaccaccgcctcc 4480
>gb|AC110920.10| Mus musculus chromosome 12, clone RP23-328I23, complete sequence Length = 223308 Score = 46.1 bits (23), Expect = 0.81 Identities = 29/31 (93%) Strand = Plus / Minus Query: 335 catggggagaaagaagaggaggaggaagagg 365 |||| |||||| ||||||||||||||||||| Sbjct: 159741 catgaggagaaggaagaggaggaggaagagg 159711
>gb|AC012397.33| Mus musculus strain 129/Sv clone ct7-369p18 map 6, complete sequence Length = 140198 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaag 362 ||||||||||||||||||||||| Sbjct: 68219 ggagaaagaagaggaggaggaag 68241
>gb|AC145871.4| Pan troglodytes BAC clone RP43-6N15 from chromosome 7, complete sequence Length = 230197 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2099 cacctcctccaccaccacctcca 2121 ||||||||||||||||||||||| Sbjct: 102404 cacctcctccaccaccacctcca 102382
>gb|AC157986.4| Mus musculus chromosome 19, clone RP23-160F18, complete sequence Length = 207504 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaagaggt 366 |||||| |||||||||||||||||||| Sbjct: 100403 ggagaaggaagaggaggaggaagaggt 100377
>gb|AC157921.5| Mus musculus chromosome 1, clone RP23-129L19, complete sequence Length = 220521 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 342 agaaagaagaggaggaggaagag 364 ||||||||||||||||||||||| Sbjct: 133993 agaaagaagaggaggaggaagag 134015
>dbj|AP007164.1| Aspergillus oryzae RIB40 genomic DNA, SC111 Length = 2356219 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 2099 cacctcctccaccaccacctccaggga 2125 ||||||||||||| ||||||||||||| Sbjct: 120487 cacctcctccacccccacctccaggga 120461
>dbj|AK135093.1| Mus musculus adult male olfactory brain cDNA, RIKEN full-length enriched library, clone:6430584I17 product:Potassium channel KCNH3 (Fragment) homolog [Mus musculus], full insert sequence Length = 3226 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaag 362 ||||||||||||||||||||||| Sbjct: 659 ggagaaagaagaggaggaggaag 637
>gb|AC155648.14| Mus musculus 6 BAC RP24-88B16 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 199446 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggagga 360 ||||||||||||||||||||||| Sbjct: 77040 ggggagaaagaagaggaggagga 77018
>gb|AC158621.9| Mus musculus 10 BAC RP23-294J10 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 172764 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 339 gggagaaagaagaggaggaggaagagg 365 |||| |||||||||||||||||||||| Sbjct: 50076 gggaaaaagaagaggaggaggaagagg 50050
>gb|AF207067.5| Homo sapiens chromosome 8 clone CTB-875C8 map 8q24.2, complete sequence Length = 124310 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaaga 363 ||||||||||||||||||||||| Sbjct: 19725 gagaaagaagaggaggaggaaga 19747
>gb|AC090844.7| Homo sapiens chromosome 17, clone RP11-387H17, complete sequence Length = 227857 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 101061 gctgcctgcccctgcccctgccc 101083
>dbj|AK160949.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:4022410L16 product:intersectin (SH3 domain protein 1A), full insert sequence Length = 2890 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 141 cctgcccctgcccctgcccacct 163 ||||||||||||||||||||||| Sbjct: 2230 cctgcccctgcccctgcccacct 2252
>ref|XM_755609.1| Ustilago maydis 521 hypothetical protein (UM04555.1) partial mRNA Length = 4836 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 757 gccgccaagaaggagctcgacgc 779 ||||||||||||||||||||||| Sbjct: 3085 gccgccaagaaggagctcgacgc 3107
>gb|AC023723.4| Drosophila melanogaster X BAC RP98-48E6 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 179363 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 25470 cctccgccgccaccaccgcctcc 25448
>gb|AC023709.4| Drosophila melanogaster X BAC RP98-10I17 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 163710 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 2137 cctccgccgccaccaccgcctcc 2159 ||||||||||||||||||||||| Sbjct: 123517 cctccgccgccaccaccgcctcc 123495
>gb|AC107460.5| Homo sapiens chromosome 8, clone RP11-452N4, complete sequence Length = 137945 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaaga 363 ||||||||||||||||||||||| Sbjct: 4246 gagaaagaagaggaggaggaaga 4268
>emb|CT025868.1| Human DNA sequence from clone XX-HCC1954_31O13, complete sequence Length = 84064 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 21587 gctgcctgcccctgcccctgccc 21565
>gb|AC090127.11| Mus musculus chromosome 6, clone RP23-128D23, complete sequence Length = 212404 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 3230 gtttgtaaaaagtgaaccacagt 3252 ||||||||||||||||||||||| Sbjct: 204246 gtttgtaaaaagtgaaccacagt 204268
>dbj|AK021149.1| Mus musculus adult male corpus striatum cDNA, RIKEN full-length enriched library, clone:C030044P22 product:unclassifiable, full insert sequence Length = 1080 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 340 ggagaaagaagaggaggaggaag 362 ||||||||||||||||||||||| Sbjct: 51 ggagaaagaagaggaggaggaag 29
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3 Length = 36192742 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggt 366 ||||||||| ||||||||||||||||| Sbjct: 21534370 ggagaaagaggaggaggaggaagaggt 21534396 Score = 44.1 bits (22), Expect = 3.2 Identities = 22/22 (100%) Strand = Plus / Plus Query: 1482 gagcaaggatgatggcagctat 1503 |||||||||||||||||||||| Sbjct: 33504012 gagcaaggatgatggcagctat 33504033
>emb|AL683812.12| Human DNA sequence from clone RP5-1014E24 on chromosome 1, complete sequence Length = 40731 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggagga 360 ||||||||||||||||||||||| Sbjct: 25691 ggggagaaagaagaggaggagga 25669
>gb|AC022681.8| Homo sapiens chromosome 8, clone RP11-731D24, complete sequence Length = 219658 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaaga 363 ||||||||||||||||||||||| Sbjct: 209672 gagaaagaagaggaggaggaaga 209694
>emb|AL158172.5| Human DNA sequence from clone RP1-169O23 on chromosome 1 Contains the 3' end of the PLA2G5 gene for phospholipase A2 group V, the PLA2G2D gene for phospholipase A2 group IID and the 5' end of the PLA2G2F gene for phospholipase A2 group IIF, complete sequence Length = 98743 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 339 gggagaaagaagaggaggaggaagagg 365 ||||| ||||||||||||||||||||| Sbjct: 46355 gggaggaagaagaggaggaggaagagg 46329
>emb|CR954268.1| Human DNA sequence from clone XX-HCC1954_40B13, complete sequence Length = 107537 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 82834 gctgcctgcccctgcccctgccc 82856
>gb|AC131664.3| Mus musculus BAC clone RP23-274J16 from chromosome 5, complete sequence Length = 189996 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 2099 cacctcctccaccaccacctcca 2121 ||||||||||||||||||||||| Sbjct: 46791 cacctcctccaccaccacctcca 46813
>emb|AL161549.2|ATCHRIV49 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 49 Length = 199075 Score = 46.1 bits (23), Expect = 0.81 Identities = 35/39 (89%) Strand = Plus / Plus Query: 2487 ggttgatgagagagcagtgctaaagcatttcgattggcc 2525 ||||||||||||||||||| | || |||||||| ||||| Sbjct: 11195 ggttgatgagagagcagtgttgaaacatttcgagtggcc 11233
>emb|AL021710.1|ATF28J12 Arabidopsis thaliana DNA chromosome 4, BAC clone F28J12 (ESSAII project) Length = 110102 Score = 46.1 bits (23), Expect = 0.81 Identities = 35/39 (89%) Strand = Plus / Plus Query: 2487 ggttgatgagagagcagtgctaaagcatttcgattggcc 2525 ||||||||||||||||||| | || |||||||| ||||| Sbjct: 92373 ggttgatgagagagcagtgttgaaacatttcgagtggcc 92411
>emb|AJ577236.1|UMA577236 Ustilago maydis myo5 gene for myosin 5 Length = 4836 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 757 gccgccaagaaggagctcgacgc 779 ||||||||||||||||||||||| Sbjct: 3085 gccgccaagaaggagctcgacgc 3107
>gb|AC160090.4| Mus musculus 6 BAC RP23-322E20 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 206093 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggaggaagag 364 |||||||| |||||||||||||||||| Sbjct: 169406 ggggagaaggaagaggaggaggaagag 169380
>gb|AC158627.6| Mus musculus 10 BAC RP23-451N6 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 183225 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggt 366 ||||| ||||||||||||||||||||| Sbjct: 65619 ggagatagaagaggaggaggaagaggt 65645
>emb|CR938745.1| Human DNA sequence from clone XX-HCC1954_32J13, complete sequence Length = 164033 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 58555 gctgcctgcccctgcccctgccc 58577
>emb|CR936885.1| Human DNA sequence from clone XX-HCC1954_35K12, complete sequence Length = 175639 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 86022 gctgcctgcccctgcccctgccc 86044
>emb|CR936851.1| Human DNA sequence from clone XX-HCC1954_35H09, complete sequence Length = 138165 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 64659 gctgcctgcccctgcccctgccc 64637
>emb|AL645903.8| Mouse DNA sequence from clone RP23-179M4 on chromosome 11, complete sequence Length = 181669 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Minus Query: 338 ggggagaaagaagaggaggagga 360 ||||||||||||||||||||||| Sbjct: 6884 ggggagaaagaagaggaggagga 6862
>gb|AC018843.4|AC018843 Homo sapiens chromosome 3 clone RP11-900O22 map 3p, complete sequence Length = 211012 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 4076 gctgcctgcccctgcccctgccc 4098
>gb|AC090956.1|AC090956 Homo sapiens chromosome 3 clone RP11-659G4 map 3p, complete sequence Length = 202844 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 158650 gctgcctgcccctgcccctgccc 158672
>gb|AC026218.5|AC026218 Homo sapiens chromosome 3 clone RP11-813N23 map 3p, complete sequence Length = 198597 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 171691 gctgcctgcccctgcccctgccc 171713
>gb|AC018505.4|AC018505 Homo sapiens chromosome 3 clone RP11-58I13 map 3p, complete sequence Length = 196044 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 57085 gctgcctgcccctgcccctgccc 57107
>gb|AC018831.4|AC018831 Homo sapiens chromosome 3 clone RP11-481B18 map 3p, complete sequence Length = 178548 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 85481 gctgcctgcccctgcccctgccc 85503
>emb|CR589878.6| Human DNA sequence from clone XX-HCC1954_10P22, complete sequence Length = 87071 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 137 gctgcctgcccctgcccctgccc 159 ||||||||||||||||||||||| Sbjct: 23544 gctgcctgcccctgcccctgccc 23566
>gb|AF230878.1|AF230878 Mus musculus transcriptional corepressor TIF1beta gene, complete cds Length = 9519 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 341 gagaaagaagaggaggaggaaga 363 ||||||||||||||||||||||| Sbjct: 407 gagaaagaagaggaggaggaaga 429
>dbj|AK120221.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013041G13, full insert sequence Length = 2623 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggt 366 ||||||||| ||||||||||||||||| Sbjct: 465 ggagaaagaggaggaggaggaagaggt 491
>gb|AC135105.11| Mus musculus strain C57BL/6J clone rp23-354f7, complete sequence Length = 209282 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaag 362 ||||||||||||||||||||||| Sbjct: 174817 ggagaaagaagaggaggaggaag 174839
>gb|AC132113.3| Mus musculus BAC clone RP24-217M2 from chromosome 3, complete sequence Length = 177519 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 339 gggagaaagaagaggaggaggaagagg 365 ||||||| ||||||||||||||||||| Sbjct: 39207 gggagaaggaagaggaggaggaagagg 39233
>gb|BC066105.1| Mus musculus intersectin 1 (SH3 domain protein 1A), mRNA (cDNA clone IMAGE:30535151), complete cds Length = 6017 Score = 46.1 bits (23), Expect = 0.81 Identities = 23/23 (100%) Strand = Plus / Plus Query: 141 cctgcccctgcccctgcccacct 163 ||||||||||||||||||||||| Sbjct: 2091 cctgcccctgcccctgcccacct 2113
>gb|AC102722.7| Mus musculus chromosome 19, clone RP24-108O16, complete sequence Length = 141681 Score = 46.1 bits (23), Expect = 0.81 Identities = 26/27 (96%) Strand = Plus / Plus Query: 340 ggagaaagaagaggaggaggaagaggt 366 |||||| |||||||||||||||||||| Sbjct: 39818 ggagaaggaagaggaggaggaagaggt 39844 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 582,058,676 Number of extensions: 34698513 Number of successful extensions: 349929 Number of sequences better than 10.0: 1077 Number of HSP's gapped: 349882 Number of HSP's successfully gapped: 1260 Length of query: 3295 Length of database: 18,610,659,111 Length adjustment: 24 Effective length of query: 3271 Effective length of database: 18,499,340,271 Effective search space: 60511342026441 Effective search space used: 60511342026441 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 15 (30.2 bits)
