ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name FLbaf89n22
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC184097.2| Populus trichocarpa clone Pop1-88A18, complete se... 62 1e-05
2gb|AC183420.2| Populus trichocarpa clone Pop1-23K9, complete seq... 56 6e-04
3gb|AY959233.1| Sciadopitys verticillata clone 4 ty3/gypsy-like r... 52 0.010
4gb|AY959232.1| Sciadopitys verticillata clone 1 ty3/gypsy-like r... 52 0.010
5gb|AC185960.11| Glycine max clone gmw2-38l18, complete sequence 50 0.040
6gb|AY136628.2| Petunia integrifolia subsp. inflata S2 self-incom... 50 0.040
7emb|CT009484.8| M.truncatula DNA sequence from clone MTH2-69D3 o... 50 0.040
8gb|AC151709.9| Medicago truncatula clone mth2-31g22, complete se... 46 0.62
9gb|AE017347.1| Cryptococcus neoformans var. neoformans JEC21 chr... 46 0.62
10ref|XM_572049.1| Cryptococcus neoformans var. neoformans JEC21 h... 46 0.62
11ref|XM_572048.1| Cryptococcus neoformans var. neoformans JEC21 h... 46 0.62
12ref|XM_572047.1| Cryptococcus neoformans var. neoformans JEC21 h... 46 0.62
13gb|AC068284.5| Homo sapiens BAC clone RP11-473K18 from 2, comple... 46 0.62
14gb|AY959218.1| Lycopodium lagopus clone 1 ty3/gypsy-like retrotr... 46 0.62
15gb|AC163497.14| Mus musculus chromosome 1, clone RP24-185N14, co... 46 0.62
16emb|AL590842.1| Yersinia pestis CO92 complete genome 44 2.5
17gb|AE017042.1| Yersinia pestis biovar Microtus str. 91001, compl... 44 2.5
18gb|CP000308.1| Yersinia pestis Antiqua, complete genome 44 2.5
19gb|CP000305.1| Yersinia pestis Nepal516, complete genome 44 2.5
20gb|DQ103759.1| Bougainvillea spectabilis chlorotic vein-banding ... 44 2.5
21ref|XM_462088.1| Debaryomyces hansenii CBS767 hypothetical prote... 44 2.5
22ref|XM_462089.1| Debaryomyces hansenii CBS767 hypothetical prote... 44 2.5
23gb|AC099564.2| Homo sapiens chromosome 1 clone RP11-359A17, comp... 44 2.5
24gb|AC010748.5| Homo sapiens BAC clone CTD-2532L16 from 16, compl... 44 2.5
25emb|AL357499.10| Human DNA sequence from clone RP11-455L10 on ch... 44 2.5
26emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, comp... 44 2.5
27emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS... 44 2.5
28gb|AY959213.1| Physcomitrella patens clone 2 ty3/gypsy-like retr... 44 2.5
29gb|AY898769.1| Spermophilus fulvus voucher Sf41 SrY (SrY) gene, ... 44 2.5
30gb|AY898768.1| Spermophilus major major voucher Sm195 SrY (SrY) ... 44 2.5
31gb|AY898767.1| Spermophilus pygmaeus septentrionalis voucher Sp2... 44 2.5
32emb|CR925799.3| Wallaby DNA sequence from clone GRWB-66O5, compl... 44 2.5
33emb|AL806511.9| Mouse DNA sequence from clone RP23-22B15 on chro... 44 2.5
34gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytoge... 44 2.5
35emb|CR388157.38| Zebrafish DNA sequence from clone DKEY-29B5 in ... 42 9.8
36gb|BT026529.1| Bos taurus ubiquitin associated and SH3 domain co... 42 9.8
37gb|AC189318.1| Brassica rapa subsp. pekinensis clone KBrB036G18,... 42 9.8
38gb|AC153161.23| Glycine max clone gmw1-77p13, complete sequence 42 9.8
39gb|AC174315.4| Medicago truncatula clone mth2-165c4, complete se... 42 9.8
40emb|CR759948.9| Zebrafish DNA sequence from clone DKEYP-122B2 in... 42 9.8
41gb|AY849797.1| Ophiopogon japonicus putative centromeric retrotr... 42 9.8
42ref|XM_639137.1| Dictyostelium discoideum AX4 hypothetical prote... 42 9.8
43gb|AC109170.10| Mus musculus chromosome 8, clone RP23-87B3, comp... 42 9.8
44ref|XM_851542.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
45ref|XM_851501.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
46ref|XM_851464.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
47ref|XM_851418.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
48ref|XM_851378.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
49ref|XM_843474.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
50ref|XM_851292.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
51ref|XM_851252.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
52ref|XM_851211.1| PREDICTED: Canis familiaris similar to pericent... 42 9.8
53ref|XM_532832.2| PREDICTED: Canis familiaris similar to pericent... 42 9.8
54gb|AC130539.3| Mus musculus BAC clone RP23-455J15 from chromosom... 42 9.8
55gb|AC123794.4| Mus musculus BAC clone RP24-315P14 from chromosom... 42 9.8
56gb|AF411964.1| HIV-1 isolate 99ZACM4 from South Africa, complete... 42 9.8
57gb|AC016919.15| Homo sapiens 3 BAC RP11-220J13 (Roswell Park Can... 42 9.8
58gb|AY950594.1| Citrus yellow mosaic virus polyprotein gene, part... 42 9.8
59gb|AY928807.1| Citrus yellow mosaic virus polyprotein gene, part... 42 9.8
60gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome 42 9.8
61ref|NM_070184.2| Caenorhabditis elegans GCL (Drosophila germ cel... 42 9.8
62ref|XM_805765.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 9.8
63ref|XM_802374.1| Trypanosoma cruzi strain CL Brener hypothetical... 42 9.8
64gb|AC007120.6| Arabidopsis thaliana chromosome 2 clone T15D9 map... 42 9.8
65dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 9.8
66emb|CR956375.5| Pig DNA sequence from clone CH242-268P22 on chro... 42 9.8
67gb|AC092264.2| Homo sapiens chromosome 1 clone RP4-640P3, comple... 42 9.8
68emb|AL133413.5| Human DNA sequence from clone RP11-54K22 on chro... 42 9.8
69emb|CR936324.2| Medicago truncatula chromosome 5 clone mth2-62a2... 42 9.8
70gb|AC104596.4| Homo sapiens BAC clone RP11-54P19 from 4, complet... 42 9.8
71gb|AC013448.7| Homo sapiens BAC clone RP11-551D18 from 2, comple... 42 9.8
72gb|AC012327.6|AC012327 Arabidopsis thaliana chromosome 3 BAC T14... 42 9.8
73gb|AC116956.2| Dictyostelium discoideum chromosome 2 map 1418423... 42 9.8
74dbj|AP005188.5| Oryza sativa (japonica cultivar-group) genomic D... 42 9.8
75gb|AF546188.1| Contiguous genomic DNA sequence comprising the 19... 42 9.8
76dbj|AP003916.2| Oryza sativa (japonica cultivar-group) genomic D... 42 9.8
77gb|AF466202.2| Zea mays putative pol protein gene, partial cds; ... 42 9.8
78gb|AC027663.14|AC027663 Homo sapiens chromosome 1 clone RP11-285... 42 9.8
79gb|AC019013.2|AC019013 Genomic Sequence For Arabidopsis thaliana... 42 9.8
80ref|NM_001015599.1| Bos taurus ubiquitin associated and SH3 doma... 42 9.8
81emb|AL132865.1| Caenorhabditis elegans YAC Y62E10A, complete seq... 42 9.8
82gb|AY856484.1| Zingiber officinale clone ZoP22 genomic sequence 42 9.8
83gb|AC138313.4| Mus musculus BAC clone RP23-243P9 from 9, complet... 42 9.8
84emb|CR962121.2| Medicago truncatula chromosome 5 clone mte1-77f5... 42 9.8 
>gb|AC184097.2| Populus trichocarpa clone Pop1-88A18, complete sequence
          Length = 96720
 Score = 61.9 bits (31), Expect = 1e-05
 Identities = 61/71 (85%)
 Strand = Plus / Plus

                                                                         
Query: 2439  ttgtttgaatgggtagtcatgccatttggactctcaaatgcaccaagtacctttatgcac 2498
             |||| ||||||| |||| ||||||||||||||  |||||||||| ||||| |||||||  
Sbjct: 50560 ttgtatgaatggttagtaatgccatttggacttacaaatgcacctagtacgtttatgcgt 50619

                        
Query: 2499  ttgatgaatca 2509
             || ||||||||
Sbjct: 50620 ttaatgaatca 50630
to top
>gb|AC183420.2| Populus trichocarpa clone Pop1-23K9, complete sequence
          Length = 145826

 Score = 56.0 bits (28), Expect = 6e-04
 Identities = 49/56 (87%)
 Strand = Plus / Minus

                                                                     
Query: 2439  ttgtttgaatgggtagtcatgccatttggactctcaaatgcaccaagtacctttat 2494
             |||| ||||||| |||| ||||||||||||||  |||||||||| ||||| |||||
Sbjct: 41295 ttgtatgaatggttagtaatgccatttggacttacaaatgcacctagtacgtttat 41240
to top
>gb|AY959233.1| Sciadopitys verticillata clone 4 ty3/gypsy-like retrotransposon
            reverse transcriptase (RT) gene, partial cds
          Length = 352

 Score = 52.0 bits (26), Expect = 0.010
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 2430 aaggaagggttgtttgaatgggtagtcatgccatttgg 2467
            |||||||| |||||||||||| | ||||||||||||||
Sbjct: 201  aaggaaggtttgtttgaatggttggtcatgccatttgg 238
to top
>gb|AY959232.1| Sciadopitys verticillata clone 1 ty3/gypsy-like retrotransposon
            reverse transcriptase (RT) gene, partial cds
          Length = 352

 Score = 52.0 bits (26), Expect = 0.010
 Identities = 35/38 (92%)
 Strand = Plus / Plus

                                                  
Query: 2430 aaggaagggttgtttgaatgggtagtcatgccatttgg 2467
            |||||||| |||||||||||| | ||||||||||||||
Sbjct: 201  aaggaaggtttgtttgaatggttggtcatgccatttgg 238
to top
>gb|AC185960.11| Glycine max clone gmw2-38l18, complete sequence
          Length = 163908

 Score = 50.1 bits (25), Expect = 0.040
 Identities = 49/57 (85%)
 Strand = Plus / Plus

                                                                      
Query: 2439  ttgtttgaatgggtagtcatgccatttggactctcaaatgcaccaagtacctttatg 2495
             |||| ||||||| |||| ||||| ||||| ||| | ||||||||||| |||||||||
Sbjct: 76068 ttgtatgaatggttagtgatgccttttgggctcactaatgcaccaagcacctttatg 76124
to top
>gb|AY136628.2| Petunia integrifolia subsp. inflata S2 self-incompatibility
             ribonuclease (S2-RNase) and S2-locus F-box protein (SLF2)
             genes, complete cds
          Length = 328473

 Score = 50.1 bits (25), Expect = 0.040
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                      
Query: 2379  catcaaatccgtatcagaccccgggatgaatggaaaaccgc 2419
             ||||||||||| || | |||| |||||||||||||||||||
Sbjct: 16426 catcaaatccggatgaaacccggggatgaatggaaaaccgc 16466



 Score = 50.1 bits (25), Expect = 0.040
 Identities = 37/41 (90%)
 Strand = Plus / Plus

                                                       
Query: 2379   catcaaatccgtatcagaccccgggatgaatggaaaaccgc 2419
              ||||||||||| || | |||| |||||||||||||||||||
Sbjct: 135677 catcaaatccggatgaaacccggggatgaatggaaaaccgc 135717



 Score = 44.1 bits (22), Expect = 2.5
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                       
Query: 2378  tcatcaaatccgtatcagaccccgggatgaatggaaaaccgc 2419
             |||||||||||| || | |||| |||| ||||||||||||||
Sbjct: 45199 tcatcaaatccggatgaaacccggggacgaatggaaaaccgc 45240



 Score = 42.1 bits (21), Expect = 9.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                      
Query: 2379  catcaaatccgtatcagaccccgggatgaatggaaaaccgc 2419
             ||||||||||| || | ||||  ||||||||||||||||||
Sbjct: 54719 catcaaatccggatgaaacccgaggatgaatggaaaaccgc 54679



 Score = 42.1 bits (21), Expect = 9.8
 Identities = 36/41 (87%)
 Strand = Plus / Minus

                                                       
Query: 2379   catcaaatccgtatcagaccccgggatgaatggaaaaccgc 2419
              ||||||||||| || | |||| |||||||||| ||||||||
Sbjct: 167002 catcaaatccggatgaaacccggggatgaatgaaaaaccgc 166962
to top
>emb|CT009484.8| M.truncatula DNA sequence from clone MTH2-69D3 on chromosome 3,
             complete sequence
          Length = 109089

 Score = 50.1 bits (25), Expect = 0.040
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                          
Query: 2454  gtcatgccatttggactctcaaatgcacc 2482
             |||||||||||||||||||| ||||||||
Sbjct: 91711 gtcatgccatttggactctccaatgcacc 91739
to top
>gb|AC151709.9| Medicago truncatula clone mth2-31g22, complete sequence
          Length = 116699

 Score = 46.1 bits (23), Expect = 0.62
 Identities = 44/51 (86%)
 Strand = Plus / Plus

                                                               
Query: 2475 aatgcaccaagtacctttatgcacttgatgaatcaagtccttcgacaattc 2525
            ||||| ||||||||||||||||   | ||||||||||| ||||||| ||||
Sbjct: 8085 aatgctccaagtacctttatgcgtctaatgaatcaagtacttcgaccattc 8135
to top
>gb|AE017347.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 7, complete
              sequence
          Length = 1347793

 Score = 46.1 bits (23), Expect = 0.62
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 1347   tgaagacgatgaggaagaatacgaatgtgaagatg 1381
              ||||||||||||||||||  |||||||||| ||||
Sbjct: 928938 tgaagacgatgaggaagatgacgaatgtgatgatg 928904
to top
>ref|XM_572049.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNG03290) partial mRNA
          Length = 1508

 Score = 46.1 bits (23), Expect = 0.62
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 1347 tgaagacgatgaggaagaatacgaatgtgaagatg 1381
            ||||||||||||||||||  |||||||||| ||||
Sbjct: 1244 tgaagacgatgaggaagatgacgaatgtgatgatg 1278
to top
>ref|XM_572048.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNG03290) partial mRNA
          Length = 1482

 Score = 46.1 bits (23), Expect = 0.62
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 1347 tgaagacgatgaggaagaatacgaatgtgaagatg 1381
            ||||||||||||||||||  |||||||||| ||||
Sbjct: 1244 tgaagacgatgaggaagatgacgaatgtgatgatg 1278
to top
>ref|XM_572047.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
            (CNG03290) partial mRNA
          Length = 1452

 Score = 46.1 bits (23), Expect = 0.62
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                               
Query: 1347 tgaagacgatgaggaagaatacgaatgtgaagatg 1381
            ||||||||||||||||||  |||||||||| ||||
Sbjct: 1188 tgaagacgatgaggaagatgacgaatgtgatgatg 1222
to top
>gb|AC068284.5| Homo sapiens BAC clone RP11-473K18 from 2, complete sequence
          Length = 110512

 Score = 46.1 bits (23), Expect = 0.62
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                        
Query: 1783  aagggcaaagaaagttcctactctttc 1809
             ||||||||||||||| |||||||||||
Sbjct: 38959 aagggcaaagaaagtacctactctttc 38933
to top
>gb|AY959218.1| Lycopodium lagopus clone 1 ty3/gypsy-like retrotransposon reverse
            transcriptase (RT) gene, partial cds
          Length = 348

 Score = 46.1 bits (23), Expect = 0.62
 Identities = 43/50 (86%)
 Strand = Plus / Plus

                                                              
Query: 2457 atgccatttggactctcaaatgcaccaagtacctttatgcacttgatgaa 2506
            ||||||||||| ||| ||||||| |||  ||||||||||  |||||||||
Sbjct: 223  atgccatttgggctcacaaatgctccagntacctttatgaccttgatgaa 272
to top
>gb|AC163497.14| Mus musculus chromosome 1, clone RP24-185N14, complete sequence
          Length = 116121

 Score = 46.1 bits (23), Expect = 0.62
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                         
Query: 731    catacaagctgaaaggagttggtgcat 757
              ||||||||||||||| |||||||||||
Sbjct: 101764 catacaagctgaaagcagttggtgcat 101790
to top
>emb|AL590842.1| Yersinia pestis CO92 complete genome
          Length = 4653728

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 687     tgaagtgatggagtttccggaa 708
               ||||||||||||||||||||||
Sbjct: 1316238 tgaagtgatggagtttccggaa 1316259
to top
>gb|AE017042.1| Yersinia pestis biovar Microtus str. 91001, complete genome
          Length = 4595065

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 687     tgaagtgatggagtttccggaa 708
               ||||||||||||||||||||||
Sbjct: 1068498 tgaagtgatggagtttccggaa 1068477
to top
>gb|CP000308.1| Yersinia pestis Antiqua, complete genome
          Length = 4702289

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 687     tgaagtgatggagtttccggaa 708
               ||||||||||||||||||||||
Sbjct: 1229222 tgaagtgatggagtttccggaa 1229243
to top
>gb|CP000305.1| Yersinia pestis Nepal516, complete genome
          Length = 4534590

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 687     tgaagtgatggagtttccggaa 708
               ||||||||||||||||||||||
Sbjct: 3189610 tgaagtgatggagtttccggaa 3189589
to top
>gb|DQ103759.1| Bougainvillea spectabilis chlorotic vein-banding virus polyprotein
            gene, partial cds
          Length = 676

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                      
Query: 2442 tttgaatgggtagtcatgccatttgg 2467
            ||||||||| ||||||||||||||||
Sbjct: 86   tttgaatggctagtcatgccatttgg 111
to top
>ref|XM_462088.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G13541g)
            partial mRNA
          Length = 300

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 1342 gatggtgaagacgatgaggaag 1363
            ||||||||||||||||||||||
Sbjct: 205  gatggtgaagacgatgaggaag 226
to top
>ref|XM_462089.1| Debaryomyces hansenii CBS767 hypothetical protein (DEHA0G13552g)
            partial mRNA
          Length = 3582

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 1342 gatggtgaagacgatgaggaag 1363
            ||||||||||||||||||||||
Sbjct: 3518 gatggtgaagacgatgaggaag 3497
to top
>gb|AC099564.2| Homo sapiens chromosome 1 clone RP11-359A17, complete sequence
          Length = 189509

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                            
Query: 757    tggtggcaccgcgttcaagaagagcgcatg 786
              ||||||||||| ||||||||||||| ||||
Sbjct: 138136 tggtggcaccgagttcaagaagagcacatg 138107
to top
>gb|AC010748.5| Homo sapiens BAC clone CTD-2532L16 from 16, complete sequence
          Length = 145459

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 564   gagagtacccaaccctacatat 585
             ||||||||||||||||||||||
Sbjct: 17826 gagagtacccaaccctacatat 17847
to top
>emb|AL357499.10| Human DNA sequence from clone RP11-455L10 on chromosome 1 Contains part
              of the CHRM3 gene for muscarinic 3 cholinergic receptor,
              complete sequence
          Length = 150651

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 757    tggtggcaccgcgttcaagaagagcgcatg 786
              ||||||||||| ||||||||||||| ||||
Sbjct: 144939 tggtggcaccgagttcaagaagagcacatg 144968
to top
>emb|BX936398.1| Yersinia pseudotuberculosis IP32953 genome, complete sequence
          Length = 4744671

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 687     tgaagtgatggagtttccggaa 708
               ||||||||||||||||||||||
Sbjct: 1428241 tgaagtgatggagtttccggaa 1428262
to top
>emb|CR382139.1| Debaryomyces hansenii chromosome G of strain CBS767 of Debaryomyces
               hansenii
          Length = 2051428

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 1342    gatggtgaagacgatgaggaag 1363
               ||||||||||||||||||||||
Sbjct: 1040116 gatggtgaagacgatgaggaag 1040137
to top
>gb|AY959213.1| Physcomitrella patens clone 2 ty3/gypsy-like retrotransposon reverse
            transcriptase (RT) gene, partial cds
          Length = 345

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                          
Query: 2454 gtcatgccatttggactctcaaatgcacca 2483
            |||||||| ||||||||| |||||||||||
Sbjct: 223  gtcatgccctttggactcacaaatgcacca 252
to top
>gb|AY898769.1| Spermophilus fulvus voucher Sf41 SrY (SrY) gene, partial cds
          Length = 312

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 517 gaagaatatgatgatacccttgaaga 542
           ||||||||||||| ||||||||||||
Sbjct: 73  gaagaatatgatggtacccttgaaga 48
to top
>gb|AY898768.1| Spermophilus major major voucher Sm195 SrY (SrY) gene, partial cds
          Length = 350

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 517 gaagaatatgatgatacccttgaaga 542
           ||||||||||||| ||||||||||||
Sbjct: 111 gaagaatatgatggtacccttgaaga 86
to top
>gb|AY898767.1| Spermophilus pygmaeus septentrionalis voucher Sp2 SrY (SrY) gene,
           partial cds
          Length = 304

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                     
Query: 517 gaagaatatgatgatacccttgaaga 542
           ||||||||||||| ||||||||||||
Sbjct: 65  gaagaatatgatggtacccttgaaga 40
to top
>emb|CR925799.3| Wallaby DNA sequence from clone GRWB-66O5, complete sequence
          Length = 165490

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 1860  tatctctaaggaggaggggaaaagta 1885
             ||||| ||||||||||||||||||||
Sbjct: 23286 tatctttaaggaggaggggaaaagta 23261
to top
>emb|AL806511.9| Mouse DNA sequence from clone RP23-22B15 on chromosome X, complete
             sequence
          Length = 178981

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 1830  cattattctaccaaataaaatt 1851
             ||||||||||||||||||||||
Sbjct: 10338 cattattctaccaaataaaatt 10359
to top
>gb|AC155338.1| Brassica rapa subsp. pekinensis chromosome Cytogenetic chromosome 1 clone
              KBrH138P04, complete sequence
          Length = 137697

 Score = 44.1 bits (22), Expect = 2.5
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 2442   tttgaatgggtagtcatgccatttgg 2467
              ||||||||| ||||||||||||||||
Sbjct: 113147 tttgaatggttagtcatgccatttgg 113172
to top
>emb|CR388157.38| Zebrafish DNA sequence from clone DKEY-29B5 in linkage group 12, complete
              sequence
          Length = 225145

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1923   agacatgaaggaggcagattt 1943
              |||||||||||||||||||||
Sbjct: 149564 agacatgaaggaggcagattt 149544
to top
>gb|BT026529.1| Bos taurus ubiquitin associated and SH3 domain containing, A
            (UBASH3A), mRNA, complete cds
          Length = 2283

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1919 tggaagacatgaaggaggcagattt 1943
            ||||||| |||||||||||||||||
Sbjct: 1483 tggaagagatgaaggaggcagattt 1507
to top
>gb|AC189318.1| Brassica rapa subsp. pekinensis clone KBrB036G18, complete sequence
          Length = 128207

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                   
Query: 2442   tttgaatgggtagtcatgccatttggactctcaaatgcaccaagtacctttat 2494
              ||||||||| | |||||||| |||||  | ||||| ||||||||||| |||||
Sbjct: 123374 tttgaatggcttgtcatgccttttggtttgtcaaacgcaccaagtacttttat 123322
to top
>gb|AC153161.23| Glycine max clone gmw1-77p13, complete sequence
          Length = 174762

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 48/57 (84%)
 Strand = Plus / Minus

                                                                       
Query: 2439   ttgtttgaatgggtagtcatgccatttggactctcaaatgcaccaagtacctttatg 2495
              |||| ||||||| |||| ||||| ||||  ||| | ||||||||||| |||||||||
Sbjct: 137175 ttgtatgaatggctagtgatgccttttgagctcactaatgcaccaagcacctttatg 137119
to top
>gb|AC174315.4| Medicago truncatula clone mth2-165c4, complete sequence
          Length = 87538

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 3     ctatctataataggacttgtt 23
             |||||||||||||||||||||
Sbjct: 19698 ctatctataataggacttgtt 19678
to top
>emb|CR759948.9| Zebrafish DNA sequence from clone DKEYP-122B2 in linkage group 24,
             complete sequence
          Length = 58432

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1835  ttctaccaaataaaattgatg 1855
             |||||||||||||||||||||
Sbjct: 21830 ttctaccaaataaaattgatg 21810
to top
>gb|AY849797.1| Ophiopogon japonicus putative centromeric retrotransposon
            nonfunctional gag-pol polyprotein gene, partial sequence
          Length = 507

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 1750 agaccttggcaatttgatgtggatactac 1778
            ||||| |||||||||||||||||| ||||
Sbjct: 503  agaccatggcaatttgatgtggatgctac 475
to top
>ref|XM_639137.1| Dictyostelium discoideum AX4 hypothetical protein (DDBDRAFT_0217572)
            mRNA, complete cds
          Length = 4203

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1342 gatggtgaagacgatgaggaagaat 1366
            |||| ||||||||||||||||||||
Sbjct: 3640 gatgatgaagacgatgaggaagaat 3664
to top
>gb|AC109170.10| Mus musculus chromosome 8, clone RP23-87B3, complete sequence
          Length = 274518

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1121   aggctccatatcttccatatc 1141
              |||||||||||||||||||||
Sbjct: 112432 aggctccatatcttccatatc 112452
to top
>ref|XM_851542.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 10 (LOC475618), mRNA
          Length = 6906

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2242 ggtgaagacgatgaggaagaa 2262
to top
>ref|XM_851501.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 9 (LOC475618), mRNA
          Length = 6726

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2227 ggtgaagacgatgaggaagaa 2247
to top
>ref|XM_851464.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 8 (LOC475618), mRNA
          Length = 6960

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2227 ggtgaagacgatgaggaagaa 2247
to top
>ref|XM_851418.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 7 (LOC475618), mRNA
          Length = 7018

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2342 ggtgaagacgatgaggaagaa 2362
to top
>ref|XM_851378.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 6 (LOC475618), mRNA
          Length = 6712

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2036 ggtgaagacgatgaggaagaa 2056
to top
>ref|XM_843474.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 2 (LOC475618), mRNA
          Length = 6783

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2125 ggtgaagacgatgaggaagaa 2145
to top
>ref|XM_851292.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 5 (LOC475618), mRNA
          Length = 7021

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2357 ggtgaagacgatgaggaagaa 2377
to top
>ref|XM_851252.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 4 (LOC475618), mRNA
          Length = 7108

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2351 ggtgaagacgatgaggaagaa 2371
to top
>ref|XM_851211.1| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 3 (LOC475618), mRNA
          Length = 7135

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2459 ggtgaagacgatgaggaagaa 2479
to top
>ref|XM_532832.2| PREDICTED: Canis familiaris similar to pericentriolar material 1,
            transcript variant 1 (LOC475618), mRNA
          Length = 7136

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1345 ggtgaagacgatgaggaagaa 1365
            |||||||||||||||||||||
Sbjct: 2227 ggtgaagacgatgaggaagaa 2247
to top
>gb|AC130539.3| Mus musculus BAC clone RP23-455J15 from chromosome 9, complete sequence
          Length = 179156

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1246   aaggcaaatgaaggcccaaag 1266
              |||||||||||||||||||||
Sbjct: 142160 aaggcaaatgaaggcccaaag 142180
to top
>gb|AC123794.4| Mus musculus BAC clone RP24-315P14 from chromosome 8, complete sequence
          Length = 187246

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1121   aggctccatatcttccatatc 1141
              |||||||||||||||||||||
Sbjct: 121737 aggctccatatcttccatatc 121757
to top
>gb|AF411964.1| HIV-1 isolate 99ZACM4 from South Africa, complete genome
          Length = 9764

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1276 tgtggtaaagagggacacata 1296
            |||||||||||||||||||||
Sbjct: 1974 tgtggtaaagagggacacata 1994
to top
>gb|AC016919.15| Homo sapiens 3 BAC RP11-220J13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 165714

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1498  ggtgaatggtaaggtatgcaaatta 1522
             ||||||||||| |||||||||||||
Sbjct: 42369 ggtgaatggtatggtatgcaaatta 42393
to top
>gb|AY950594.1| Citrus yellow mosaic virus polyprotein gene, partial cds
          Length = 638

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 2444 tgaatgggtagtcatgccatttgga 2468
            ||||||| |||||||||||||||||
Sbjct: 74   tgaatggctagtcatgccatttgga 98
to top
>gb|AY928807.1| Citrus yellow mosaic virus polyprotein gene, partial cds
          Length = 638

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 2444 tgaatgggtagtcatgccatttgga 2468
            ||||||| |||||||||||||||||
Sbjct: 74   tgaatggctagtcatgccatttgga 98
to top
>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 432    aggtaatcttggagcaagacc 452
              |||||||||||||||||||||
Sbjct: 607728 aggtaatcttggagcaagacc 607708
to top
>ref|NM_070184.2| Caenorhabditis elegans GCL (Drosophila germ cell-less) homolog family
            member (gcl-1) (gcl-1) mRNA, complete cds
          Length = 1497

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1341 tgatggtgaagacgatgaggaagaa 1365
            ||||| |||||||||||||||||||
Sbjct: 1434 tgatgatgaagacgatgaggaagaa 1458
to top
>ref|XM_805765.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053505171.60) partial mRNA
          Length = 1185

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1339 catgatggtgaagacgatgag 1359
            |||||||||||||||||||||
Sbjct: 623  catgatggtgaagacgatgag 603
to top
>ref|XM_802374.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053511559.20) partial mRNA
          Length = 1185

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 1339 catgatggtgaagacgatgag 1359
            |||||||||||||||||||||
Sbjct: 623  catgatggtgaagacgatgag 603
to top
>gb|AC007120.6| Arabidopsis thaliana chromosome 2 clone T15D9 map mi421, complete
             sequence
          Length = 102331

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 2451  gtagtcatgccatttggactctcaaatgc 2479
             ||||||||||||||||||||  |||||||
Sbjct: 46828 gtagtcatgccatttggacttacaaatgc 46800
to top
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7
          Length = 29644043

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                         
Query: 1346     gtgaagacgatgaggaagaatacga 1370
                |||||| ||||||||||||||||||
Sbjct: 16313065 gtgaaggcgatgaggaagaatacga 16313041
to top
>emb|CR956375.5| Pig DNA sequence from clone CH242-268P22 on chromosome 17, complete
             sequence
          Length = 79274

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 2226  cctgctcacgccaaagaaaga 2246
             |||||||||||||||||||||
Sbjct: 10281 cctgctcacgccaaagaaaga 10261
to top
>gb|AC092264.2| Homo sapiens chromosome 1 clone RP4-640P3, complete sequence
          Length = 113330

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1627  aagaaaggtgtgaatatgaag 1647
             |||||||||||||||||||||
Sbjct: 68150 aagaaaggtgtgaatatgaag 68130
to top
>emb|AL133413.5| Human DNA sequence from clone RP11-54K22 on chromosome 9q34.11-34.2
             Contains a NADH dehydrogenase 3, mitochondrial (MTND3)
             pseudogene, complete sequence
          Length = 157790

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 1715  tagttgatatggacaccaaccatgt 1739
             |||||||||||| ||||||||||||
Sbjct: 47254 tagttgatatggccaccaaccatgt 47278
to top
>emb|CR936324.2| Medicago truncatula chromosome 5 clone mth2-62a22, COMPLETE SEQUENCE
          Length = 121881

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 510    tgaaggtgaagaatatgatga 530
              |||||||||||||||||||||
Sbjct: 104979 tgaaggtgaagaatatgatga 104999
to top
>gb|AC104596.4| Homo sapiens BAC clone RP11-54P19 from 4, complete sequence
          Length = 168591

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1809  catttggaacaagagaaggat 1829
             |||||||||||||||||||||
Sbjct: 44746 catttggaacaagagaaggat 44766
to top
>gb|AC013448.7| Homo sapiens BAC clone RP11-551D18 from 2, complete sequence
          Length = 129553

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 498   tgttgaaggttctgaaggtgaagaa 522
             ||||| |||||||||||||||||||
Sbjct: 19857 tgttgcaggttctgaaggtgaagaa 19833
to top
>gb|AC012327.6|AC012327 Arabidopsis thaliana chromosome 3 BAC T14A11 genomic sequence, complete
             sequence
          Length = 86585

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 2451  gtagtcatgccatttggactctcaaatgc 2479
             ||||||||||||||||||||  |||||||
Sbjct: 73601 gtagtcatgccatttggacttacaaatgc 73629
to top
>gb|AC116956.2| Dictyostelium discoideum chromosome 2 map 1418423-1684967 strain AX4,
              complete sequence
          Length = 266544

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 1342   gatggtgaagacgatgaggaagaat 1366
              |||| ||||||||||||||||||||
Sbjct: 247584 gatgatgaagacgatgaggaagaat 247608
to top
>dbj|AP005188.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0473C09
          Length = 141066

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1346  gtgaagacgatgaggaagaatacga 1370
             |||||| ||||||||||||||||||
Sbjct: 19121 gtgaaggcgatgaggaagaatacga 19097
to top
>gb|AF546188.1| Contiguous genomic DNA sequence comprising the 19-kDa-zein gene family
              from Zea mays, complete sequence
          Length = 203363

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 192    tgcttcaagtggtatcagagc 212
              |||||||||||||||||||||
Sbjct: 182252 tgcttcaagtggtatcagagc 182232
to top
>dbj|AP003916.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
              clone:OJ1634_H04
          Length = 151699

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 1346   gtgaagacgatgaggaagaatacga 1370
              |||||| ||||||||||||||||||
Sbjct: 133503 gtgaaggcgatgaggaagaatacga 133479
to top
>gb|AF466202.2| Zea mays putative pol protein gene, partial cds; and putative gag-pol
             precursor -orf2, putative Fourf gag/pol protein, putative
             NADP-dependent malic enzyme, putative argonaute protein,
             putative pinhead protein, putative pol protein, putative
             gag protein, putative TNP2, r1-B73 proteins, putative
             genetic modifier, putative S-receptor kinase, putative
             aldose reductase-related protein, putative glutathione
             peroxidase, putative glycerol 3-phosphate permease,
             putative response regulator, and putative 4-coumarate-CoA
             ligase-like protein genes, complete cds
          Length = 290350

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 2436  gggttgtttgaatgggtagtcatgccatttgga 2468
             ||||||||||||||||| || ||| ||||||||
Sbjct: 83891 gggttgtttgaatgggttgtgatgacatttgga 83859
to top
>gb|AC027663.14|AC027663 Homo sapiens chromosome 1 clone RP11-285I23, complete sequence
          Length = 170969

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1627  aagaaaggtgtgaatatgaag 1647
             |||||||||||||||||||||
Sbjct: 64294 aagaaaggtgtgaatatgaag 64274
to top
>gb|AC019013.2|AC019013 Genomic Sequence For Arabidopsis thaliana, Clone T5E15, Chromosome V,
              complete sequence
          Length = 114056

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                           
Query: 2451   gtagtcatgccatttggactctcaaatgc 2479
              ||||||||||||||||||||  |||||||
Sbjct: 104144 gtagtcatgccatttggacttacaaatgc 104172
to top
>ref|NM_001015599.1| Bos taurus ubiquitin associated and SH3 domain containing, A short
            form (UBASH3A), mRNA
 gb|BT020696.1| Bos taurus ubiquitin associated and SH3 domain containing, A
            (UBASH3A), mRNA, complete cds
          Length = 2286

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1919 tggaagacatgaaggaggcagattt 1943
            ||||||| |||||||||||||||||
Sbjct: 1475 tggaagagatgaaggaggcagattt 1499
to top
>emb|AL132865.1| Caenorhabditis elegans YAC Y62E10A, complete sequence
          Length = 57237

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 1341  tgatggtgaagacgatgaggaagaa 1365
             ||||| |||||||||||||||||||
Sbjct: 50247 tgatgatgaagacgatgaggaagaa 50223
to top
>gb|AY856484.1| Zingiber officinale clone ZoP22 genomic sequence
          Length = 371

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 2436 gggttgtttgaatgggtagtcatgccatttgga 2468
            ||||||| ||||||| |||| ||||||||||||
Sbjct: 38   gggttgtatgaatggttagtgatgccatttgga 70
to top
>gb|AC138313.4| Mus musculus BAC clone RP23-243P9 from 9, complete sequence
          Length = 195883

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1246   aaggcaaatgaaggcccaaag 1266
              |||||||||||||||||||||
Sbjct: 157011 aaggcaaatgaaggcccaaag 156991
to top
>emb|CR962121.2| Medicago truncatula chromosome 5 clone mte1-77f5, COMPLETE SEQUENCE
          Length = 107392

 Score = 42.1 bits (21), Expect = 9.8
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 510  tgaaggtgaagaatatgatga 530
            |||||||||||||||||||||
Sbjct: 3149 tgaaggtgaagaatatgatga 3169


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 483,006,557
Number of extensions: 25991295
Number of successful extensions: 184667
Number of sequences better than 10.0: 84
Number of HSP's gapped: 184667
Number of HSP's successfully gapped: 88
Length of query: 2547
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 2524
Effective length of database: 18,503,978,556
Effective search space: 46704041875344
Effective search space used: 46704041875344
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 15 (30.2 bits)
to top