>ref|NM_029458.1| Mus musculus HORMA domain containing 2 (Hormad2), mRNA
 gb|BC120783.1| Mus musculus HORMA domain containing 2, mRNA (cDNA clone MGC:156020
            IMAGE:40129706), complete cds
          Length = 1343
 Score = 46.1 bits (23), Expect = 0.27
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1003 ttactatgaaactccattattat 1025
            |||||||||||||||||||||||
Sbjct: 776  ttactatgaaactccattattat 798

>gb|BC120781.1| Mus musculus HORMA domain containing 2, mRNA (cDNA clone MGC:156018
            IMAGE:40129704), complete cds
          Length = 1343

 Score = 46.1 bits (23), Expect = 0.27
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1003 ttactatgaaactccattattat 1025
            |||||||||||||||||||||||
Sbjct: 776  ttactatgaaactccattattat 798

>dbj|AK015939.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
            library, clone:4930529M09 product:hypothetical HORMA
            domain containing protein, full insert sequence
          Length = 1915

 Score = 46.1 bits (23), Expect = 0.27
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 1003 ttactatgaaactccattattat 1025
            |||||||||||||||||||||||
Sbjct: 778  ttactatgaaactccattattat 800

>emb|AL645910.8| Mouse DNA sequence from clone RP23-173M6 on chromosome 11 Contains the
             5' end of a novel gene, the Mtmr3 gene for myotubularin
             related protein 3 and a glyceraldehyde-3-phosphate
             dehydrogenase (Gapd) pseudogene, complete sequence
          Length = 204413

 Score = 46.1 bits (23), Expect = 0.27
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 1003  ttactatgaaactccattattat 1025
             |||||||||||||||||||||||
Sbjct: 31207 ttactatgaaactccattattat 31185

>gb|AC069235.23|AC069235 Homo sapiens 12 BAC RP11-173C20 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 90500

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 621  ggagaggaagaaggaagaggat 642
            ||||||||||||||||||||||
Sbjct: 1091 ggagaggaagaaggaagaggat 1112

>emb|AL121656.2|CNS01DS6 BAC sequence from the SPG4 candidate region at 2p21-2p22 BAC 367K01 of
              library CITB_978_SKB from chromosome 2 of Homo sapiens
              (Human)
          Length = 179206

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 31/34 (91%)
 Strand = Plus / Minus

                                                
Query: 627    gaagaaggaagaggatagggaagcaaagatgaag 660
              ||||||||||||||||| |||||  |||||||||
Sbjct: 137032 gaagaaggaagaggataaggaagagaagatgaag 136999

>emb|AL606967.14| Mouse DNA sequence from clone RP23-304D5 on chromosome 4, complete
             sequence
          Length = 188425

 Score = 44.1 bits (22), Expect = 1.1
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 316   tcccctgctggagaagtgttctggaacatt 345
             |||||||||||||||||| ||| |||||||
Sbjct: 85078 tcccctgctggagaagtgctctagaacatt 85107

>emb|CT030229.19| Mouse DNA sequence from clone RP23-289E11 on chromosome 13, complete
             sequence
          Length = 155894

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 622   gagaggaagaaggaagaggat 642
             |||||||||||||||||||||
Sbjct: 39598 gagaggaagaaggaagaggat 39618

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 169     gcacgcattggcgcagttcat 189
               |||||||||||||||||||||
Sbjct: 2347285 gcacgcattggcgcagttcat 2347305

>gb|AC161237.8| Mus musculus chromosome 3, clone RP23-307M9, complete sequence
          Length = 206004

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 621    ggagaggaagaaggaagagga 641
              |||||||||||||||||||||
Sbjct: 134552 ggagaggaagaaggaagagga 134572

>gb|AC161505.4| Mus musculus chromosome 8, clone RP24-307K17, complete sequence
          Length = 215514

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 621   ggagaggaagaaggaagagga 641
             |||||||||||||||||||||
Sbjct: 63450 ggagaggaagaaggaagagga 63430

>gb|AC124624.13| Mus musculus chromosome 5, clone RP23-417K9, complete sequence
          Length = 192261

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 445   tcaggaagcacttggcagacctgta 469
             ||||||||||||||||||| |||||
Sbjct: 73080 tcaggaagcacttggcagagctgta 73104

>gb|AC127677.4| Mus musculus BAC clone RP24-226C2 from chromosome 8, complete sequence
          Length = 167913

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 621    ggagaggaagaaggaagagga 641
              |||||||||||||||||||||
Sbjct: 127325 ggagaggaagaaggaagagga 127305

>gb|AC121610.2| Mus musculus BAC clone RP23-326L12 from 10, complete sequence
          Length = 192060

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1022   ttatgaaactcttttattatg 1042
              |||||||||||||||||||||
Sbjct: 182352 ttatgaaactcttttattatg 182332

>emb|AL512487.1|SPAC20H4 S.pombe chromosome I cosmid c20H4
          Length = 20674

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 429   actactatcttttccatcagg 449
             |||||||||||||||||||||
Sbjct: 20290 actactatcttttccatcagg 20270

>emb|BX537131.17| Zebrafish DNA sequence from clone CH211-266K2 in linkage group 14,
              complete sequence
          Length = 140171

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1084   attatgaagctcttttattat 1104
              |||||||||||||||||||||
Sbjct: 135734 attatgaagctcttttattat 135714

>emb|Z84497.1|HSO14 Human DNA sequence from clone XX-O14 on chromosome 6 Contains the
            BRD2 gene for bromodomain-containing protein 2 (RING3,
            KIAA9001), ESTs, STSs, GSSs and two CpG islands, complete
            sequence
          Length = 40740

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                             
Query: 628  aagaaggaagaggatagggaagcaaagatgaag 660
            |||||||||||| | ||||||| ||||||||||
Sbjct: 2495 aagaaggaagagtagagggaagtaaagatgaag 2463

>emb|BX005422.5| Human DNA sequence from clone DASS-32K24 on chromosome 6, complete
             sequence
          Length = 97466

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 628   aagaaggaagaggatagggaagcaaagatgaag 660
             |||||||||||| | ||||||| ||||||||||
Sbjct: 28514 aagaaggaagagtagagggaagtaaagatgaag 28546

>emb|AL805913.4| Human DNA sequence from clone DAQB-22D21 on chromosome 6 Contains the
             3' end of the BRD2 gene for bromodomain containing 2, the
             HLA-DOA gene for the major histocompatibility complex,
             class II, DO alpha, the HLA-DPA1 gene for the major
             histocompatibility complex, class II, DP alpha 1, the
             RPL32P1 pseudogene for ribosomal protein L32 pseudogene 1,
             the 3' end of the HLA-DPB1 gene for the major
             histocompatibility complex, class II, DP beta 1 and 1 CpG
             isalnd, complete sequence
          Length = 106728

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 628   aagaaggaagaggatagggaagcaaagatgaag 660
             |||||||||||| | ||||||| ||||||||||
Sbjct: 25483 aagaaggaagagtagagggaagtaaagatgaag 25515

>emb|AL645931.7| Human DNA sequence from clone XXbac-138A21 on chromosome 6 Contains
            the HLA-DOA, HLA-DPA1 and HLA-DPB1 genes for major
            histocompatibility complex class II proteins DO alpha, DP
            alpha 1 and DP beta 1, the HLA-DPA2 major
            histocompatibility complex class II DP alpha 2
            pseudogene, ribosomal protein L32 pseudogene RPL32P1, a
            pseudogene similar to part of collagens, the 5' end of an
            HLA class II histocompatibility antigen D or S beta
            pseudogene, the 5' end of a novel protein similar to
            major histocompatibility complex class II DP beta 1
            precursor and a CpG island, complete sequence
          Length = 124899

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 628  aagaaggaagaggatagggaagcaaagatgaag 660
            |||||||||||| | ||||||| ||||||||||
Sbjct: 8522 aagaaggaagagtagagggaagtaaagatgaag 8554

>emb|AL662845.5| Human DNA sequence from clone XXbac-136A3 on chromosome 6 contains the
             HLA-DMB gene for major histocompatibility complex, class
             II, DM beta, the HLA-DMA gene for major histocompatibility
             complex, class II, DM alpha, the BRD2 gene for bromodomain
             containing 2, the HLA-DOA gene for major
             histocompatibility complex, class II, DO alpha and two CpG
             islands, complete sequence
          Length = 97128

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 628   aagaaggaagaggatagggaagcaaagatgaag 660
             |||||||||||| | ||||||| ||||||||||
Sbjct: 77995 aagaaggaagagtagagggaagtaaagatgaag 78027

>emb|BX908386.7| Zebrafish DNA sequence from clone DKEY-188K17 in linkage group 18,
             complete sequence
          Length = 77322

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1084  attatgaagctcttttattat 1104
             |||||||||||||||||||||
Sbjct: 39427 attatgaagctcttttattat 39447

>emb|CR936909.2| Human DNA sequence from clone DAMA-214M2 on chromosome 6, complete
             sequence
          Length = 40809

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 628   aagaaggaagaggatagggaagcaaagatgaag 660
             |||||||||||| | ||||||| ||||||||||
Sbjct: 24708 aagaaggaagagtagagggaagtaaagatgaag 24740

>emb|CR759795.4| Human DNA sequence from clone DAMC-206D4 on chromosome 6, complete
            sequence
          Length = 119898

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                             
Query: 628  aagaaggaagaggatagggaagcaaagatgaag 660
            |||||||||||| | ||||||| ||||||||||
Sbjct: 2952 aagaaggaagagtagagggaagtaaagatgaag 2984

>emb|CR759829.6| Human DNA sequence from clone DADB-17J1 on chromosome 6, complete
             sequence
          Length = 93292

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 628   aagaaggaagaggatagggaagcaaagatgaag 660
             |||||||||||| | ||||||| ||||||||||
Sbjct: 22749 aagaaggaagagtagagggaagtaaagatgaag 22781

>ref|NM_022016.1| Mus musculus interphotoreceptor matrix proteoglycan 1 (Impg1), mRNA
 gb|AF229929.1|AF229929 Mus musculus sialoprotein associated with cones and rods SPACR mRNA,
            complete cds
          Length = 3675

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 378  aaacagttgttgttcttccag 398
            |||||||||||||||||||||
Sbjct: 3141 aaacagttgttgttcttccag 3161

>emb|BX663518.10| Zebrafish DNA sequence from clone CH211-214O7 in linkage group 7,
              complete sequence
          Length = 200579

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1084   attatgaagctcttttattat 1104
              |||||||||||||||||||||
Sbjct: 121460 attatgaagctcttttattat 121440

>emb|AL670884.7| Mouse DNA sequence from clone RP23-372M15 on chromosome 4, complete
              sequence
          Length = 143363

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 623    agaggaagaaggaagaggataggga 647
              |||||||||||| ||||||||||||
Sbjct: 125438 agaggaagaagggagaggataggga 125414

>emb|BX322570.4| Zebrafish DNA sequence from clone DKEY-27H10 in linkage group 1,
             complete sequence
          Length = 185032

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1084  attatgaagctcttttattat 1104
             |||||||||||||||||||||
Sbjct: 70765 attatgaagctcttttattat 70745

>emb|AL844604.4| Mouse DNA sequence from clone RP24-318C20 on chromosome 4, complete
            sequence
          Length = 173133

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 623  agaggaagaaggaagaggataggga 647
            |||||||||||| ||||||||||||
Sbjct: 4263 agaggaagaagggagaggataggga 4239

>emb|BX000349.7| Zebrafish DNA sequence from clone DKEY-63L3 in linkage group 7, complete
              sequence
          Length = 173706

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1084   attatgaagctcttttattat 1104
              |||||||||||||||||||||
Sbjct: 167151 attatgaagctcttttattat 167131

>emb|AL844217.7| Zebrafish DNA sequence from clone DKEY-218L17, complete sequence
          Length = 246026

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1084  attatgaagctcttttattat 1104
             |||||||||||||||||||||
Sbjct: 34890 attatgaagctcttttattat 34870

>dbj|AP002518.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-64D24, complete
              sequence
          Length = 164795

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1009   tgaaactccattattatgaaa 1029
              |||||||||||||||||||||
Sbjct: 139235 tgaaactccattattatgaaa 139215

>gb|AC093350.15| Mus musculus chromosome 3, clone RP23-16G3, complete sequence
          Length = 200326

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 969  tgtgttgttgaaccttgtcca 989
            |||||||||||||||||||||
Sbjct: 3804 tgtgttgttgaaccttgtcca 3824

>gb|AC125099.3| Mus musculus BAC clone RP24-201C14 from 3, complete sequence
          Length = 166720

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 969   tgtgttgttgaaccttgtcca 989
             |||||||||||||||||||||
Sbjct: 96885 tgtgttgttgaaccttgtcca 96865

>gb|AC171197.1| Mus musculus BAC clone RP23-216J7 from chromosome 5, complete sequence
          Length = 211677

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 445    tcaggaagcacttggcagacctgta 469
              ||||||||||||||||||| |||||
Sbjct: 165285 tcaggaagcacttggcagagctgta 165309

>gb|AC161414.3| Mus musculus chromosome 1, clone CH36-500J15, complete sequence
          Length = 165234

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 621    ggagaggaagaaggaagagga 641
              |||||||||||||||||||||
Sbjct: 164762 ggagaggaagaaggaagagga 164782

>gb|AC153500.3| Mus musculus 10 BAC RP23-28O3 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 188884

 Score = 42.1 bits (21), Expect = 4.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1022   ttatgaaactcttttattatg 1042
              |||||||||||||||||||||
Sbjct: 165158 ttatgaaactcttttattatg 165178


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 197,098,196
Number of extensions: 10938628
Number of successful extensions: 276583
Number of sequences better than 10.0: 38
Number of HSP's gapped: 276583
Number of HSP's successfully gapped: 38
Length of query: 1125
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 1102
Effective length of database: 18,503,978,556
Effective search space: 20391384368712
Effective search space used: 20391384368712
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)