>ref|XM_657696.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN5184.2), mRNA
          Length = 2541
 Score = 85.7 bits (43), Expect = 3e-13
 Identities = 82/95 (86%)
 Strand = Plus / Plus

                                                                        
Query: 144  ttccccggtgtcgttgtgttcagcgagatctaccaagtaaccggccccgtctcccgcttc 203
            |||||||| || || || ||||||||||||||||| || |||||||||||| | ||||||
Sbjct: 1798 ttccccggggtagtcgtattcagcgagatctaccaggttaccggccccgtcgcgcgcttc 1857

                                               
Query: 204  gcccgccaaatcgcatcccaaggctacatcgtcgc 238
            |||||||| |||||   ||| ||||||||||||||
Sbjct: 1858 gcccgccagatcgccggccagggctacatcgtcgc 1892

>gb|AE016817.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome IV,
               complete sequence
          Length = 1466886

 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 41/43 (95%)
 Strand = Plus / Minus

                                                          
Query: 400     acggccgcgtcggcgccacgggcatgtgcctaggcggccacct 442
               |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 1160034 acggccgcatcggcgccacgggcatgtgcctcggcggccacct 1159992

>ref|NM_209714.1| Eremothecium gossypii ADR265Cp (ADR265C), mRNA
          Length = 819

 Score = 69.9 bits (35), Expect = 2e-08
 Identities = 41/43 (95%)
 Strand = Plus / Plus

                                                      
Query: 400 acggccgcgtcggcgccacgggcatgtgcctaggcggccacct 442
           |||||||| |||||||||||||||||||||| |||||||||||
Sbjct: 359 acggccgcatcggcgccacgggcatgtgcctcggcggccacct 401

>ref|XM_745367.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g07120)
           partial mRNA
          Length = 441

 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 50/56 (89%)
 Strand = Plus / Minus

                                                                   
Query: 603 aaccatgtgccgccggaggggcgggacctgatccgcaagacgctgcatgagaaggg 658
           |||||||| || ||||||||  | ||||||||||||||||| ||||||||||||||
Sbjct: 144 aaccatgttcccccggagggtagagacctgatccgcaagaccctgcatgagaaggg 89

>ref|XM_745366.1| Aspergillus fumigatus Af293 hypothetical protein (Afu1g07130)
           partial mRNA
          Length = 804

 Score = 63.9 bits (32), Expect = 1e-06
 Identities = 50/56 (89%)
 Strand = Plus / Plus

                                                                   
Query: 603 aaccatgtgccgccggaggggcgggacctgatccgcaagacgctgcatgagaaggg 658
           |||||||| || ||||||||  | ||||||||||||||||| ||||||||||||||
Sbjct: 556 aaccatgttcccccggagggtagagacctgatccgcaagaccctgcatgagaaggg 611



 Score = 61.9 bits (31), Expect = 4e-06
 Identities = 55/63 (87%)
 Strand = Plus / Plus

                                                                       
Query: 144 ttccccggtgtcgttgtgttcagcgagatctaccaagtaaccggccccgtctcccgcttc 203
           ||||| |||||||| ||||||||||||||||||||||| || || || ||||| || |||
Sbjct: 100 ttccctggtgtcgtagtgttcagcgagatctaccaagtgactggacctgtctcgcggttc 159

              
Query: 204 gcc 206
           |||
Sbjct: 160 gcc 162

>ref|XM_001211823.1| Aspergillus terreus NIH2624 Delta(24(24(1)))-sterol reductase
            (ATEG_02645) mRNA, complete cds
          Length = 2418

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 113/142 (79%)
 Strand = Plus / Plus

                                                                        
Query: 577  tgatgatgatctttgggaagcgggataaccatgtgccgccggaggggcgggacctgatcc 636
            |||| |||||||| ||||||   || |||||||| || ||||| ||  ||||  ||||||
Sbjct: 2144 tgatcatgatcttcgggaagaacgacaaccatgttccaccggaaggaagggatttgatcc 2203

                                                                        
Query: 637  gcaagacgctgcatgagaagggggtgttgtttgggtggtgggaggtggcgtgggcgcagc 696
            | ||||||||||| || ||||| ||| ||||| | |  |  |||||||| ||||| ||||
Sbjct: 2204 gaaagacgctgcacgacaagggcgtgctgtttagtttttacgaggtggcttgggctcagc 2263

                                  
Query: 697  atgcattcatccgcgatgagct 718
            |||| || || |||||||||||
Sbjct: 2264 atgcgtttattcgcgatgagct 2285



 Score = 42.1 bits (21), Expect = 3.7
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 162  ttcagcgagatctaccaagtaaccggccc 190
            ||||||||||||||||| || ||||||||
Sbjct: 1729 ttcagcgagatctaccaggtgaccggccc 1757

>emb|BX284745.1|NCB18E6 Neurospora crassa DNA linkage group II BAC clone B18E6
          Length = 68593

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                   
Query: 684   gcgtgggcgcagcatgcattcatccgcgatgagctaagtaaagggcggtacgat 737
             ||||||||||| ||||| |||||| | |||||| | || |||||||||||||||
Sbjct: 40202 gcgtgggcgcaacatgcgttcatcagggatgagttgagcaaagggcggtacgat 40255



 Score = 46.1 bits (23), Expect = 0.24
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                        
Query: 183   accggccccgtctcccgcttcgcccgccaaatcgcatcccaaggctacatcgtcgcggc 241
             ||||| |||||  |||| || ||||||||||||||    ||||||||||||||||||||
Sbjct: 39566 accggtcccgttgcccgttttgcccgccaaatcgccggtcaaggctacatcgtcgcggc 39624

>ref|XM_958271.1| Neurospora crassa OR74A hypothetical protein (NCU09600.1) partial
           mRNA
          Length = 804

 Score = 52.0 bits (26), Expect = 0.004
 Identities = 47/54 (87%)
 Strand = Plus / Plus

                                                                 
Query: 684 gcgtgggcgcagcatgcattcatccgcgatgagctaagtaaagggcggtacgat 737
           ||||||||||| ||||| |||||| | |||||| | || |||||||||||||||
Sbjct: 637 gcgtgggcgcaacatgcgttcatcagggatgagttgagcaaagggcggtacgat 690



 Score = 46.1 bits (23), Expect = 0.24
 Identities = 50/59 (84%)
 Strand = Plus / Plus

                                                                      
Query: 183 accggccccgtctcccgcttcgcccgccaaatcgcatcccaaggctacatcgtcgcggc 241
           ||||| |||||  |||| || ||||||||||||||    ||||||||||||||||||||
Sbjct: 67  accggtcccgttgcccgttttgcccgccaaatcgccggtcaaggctacatcgtcgcggc 125

>ref|XM_381008.1| Gibberella zeae PH-1 chromosome 1 hypothetical protein (FG00832.1)
           partial mRNA
          Length = 852

 Score = 48.1 bits (24), Expect = 0.060
 Identities = 84/104 (80%)
 Strand = Plus / Plus

                                                                       
Query: 162 ttcagcgagatctaccaagtaaccggccccgtctcccgcttcgcccgccaaatcgcatcc 221
           ||||| ||||| |||||||| ||||| || ||  | ||||| |||||||| |||||   |
Sbjct: 130 ttcagtgagatttaccaagtcaccggtcctgtggctcgctttgcccgccagatcgctggc 189

                                                       
Query: 222 caaggctacatcgtcgcggcgccctcatcctaccacgaattcac 265
           || ||||||||||| || || || ||||| |||||||| |||||
Sbjct: 190 cagggctacatcgttgccgctccttcatcataccacgacttcac 233

>gb|CP000469.1| Shewanella sp. ANA-3, complete genome
          Length = 4972204

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 432     ggcggccacctagcctaccgcgccgc 457
               ||||||||| ||||||||||||||||
Sbjct: 3982047 ggcggccacttagcctaccgcgccgc 3982072

>gb|AC190391.4| Canis Familiaris chromosome 2, clone XX-25C16, complete sequence
          Length = 194249

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 935   ggaagacatccagcaatagaca 956
             ||||||||||||||||||||||
Sbjct: 32329 ggaagacatccagcaatagaca 32308

>gb|CP000444.1| Shewanella sp. MR-7, complete genome
          Length = 4792610

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 432     ggcggccacctagcctaccgcgccgc 457
               ||||||||| ||||||||||||||||
Sbjct: 3811134 ggcggccacttagcctaccgcgccgc 3811159

>gb|CP000446.1| Shewanella sp. MR-4, complete genome
          Length = 4706287

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 432    ggcggccacctagcctaccgcgccgc 457
              ||||||||| ||||||||||||||||
Sbjct: 941734 ggcggccacttagcctaccgcgccgc 941709

>ref|NM_102971.1| Arabidopsis thaliana unknown protein (AT1G32375) mRNA, complete cds
          Length = 1269

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 759  tttgagatgctcaaggagttgt 780
            ||||||||||||||||||||||
Sbjct: 1201 tttgagatgctcaaggagttgt 1222

>gb|AC007767.3|F5D14 Sequence of BAC F5D14 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 127462

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 759   tttgagatgctcaaggagttgt 780
             ||||||||||||||||||||||
Sbjct: 42398 tttgagatgctcaaggagttgt 42419

>gb|AC122424.4| Mus musculus BAC clone RP24-173E19 from 8, complete sequence
          Length = 175181

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 930   agaaaggaagacatccagcaat 951
             ||||||||||||||||||||||
Sbjct: 64449 agaaaggaagacatccagcaat 64470

>gb|AC142262.3| Mus musculus BAC clone RP24-486I4 from 8, complete sequence
          Length = 204183

 Score = 44.1 bits (22), Expect = 0.94
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 930  agaaaggaagacatccagcaat 951
            ||||||||||||||||||||||
Sbjct: 2508 agaaaggaagacatccagcaat 2487

>ref|XM_001225916.1| Chaetomium globosum CBS 148.51 hypothetical protein (CHGG_08261)
           mRNA, complete cds
          Length = 732

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 45/53 (84%)
 Strand = Plus / Plus

                                                                
Query: 684 gcgtgggcgcagcatgcattcatccgcgatgagctaagtaaagggcggtacga 736
           |||||||| ||||| || ||||||||||| ||||| || ||||| || |||||
Sbjct: 565 gcgtgggcccagcacgccttcatccgcgacgagctgagcaaaggccgctacga 617

>gb|AC103609.6| Mus musculus chromosome 3, clone RP23-359D10, complete sequence
          Length = 182664

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 498   acagatatacacagccacacg 518
             |||||||||||||||||||||
Sbjct: 27160 acagatatacacagccacacg 27180

>gb|AC125168.4| Mus musculus BAC clone RP24-449N2 from chromosome 3, complete sequence
          Length = 166604

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 498    acagatatacacagccacacg 518
              |||||||||||||||||||||
Sbjct: 116674 acagatatacacagccacacg 116694

>ref|NM_001039163.1| Rattus norvegicus tumor suppressor candidate 5 (Tusc5), mRNA
 dbj|AB218813.1| Rattus norvegicus mRNA for hypothetical protein, complete cds, brain
            endothelial cell derived gene-1
          Length = 3410

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 866  agacaagagccacatggaaat 886
            |||||||||||||||||||||
Sbjct: 1483 agacaagagccacatggaaat 1503

>ref|XM_389378.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09202.1)
           partial mRNA
          Length = 921

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 77  caaagccggcggcgacatgcg 97
           |||||||||||||||||||||
Sbjct: 920 caaagccggcggcgacatgcg 900

>emb|AL662864.14| Human DNA sequence from clone RP11-493K23 on chromosome X Contains two
             novel genes, two novel genes similar to poly(A) binding
             protein cytoplasmic 1 (LOC340530, LOC340529) and two CpG
             islands, complete sequence
          Length = 120769

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 861   agatcagacaagagccacatg 881
             |||||||||||||||||||||
Sbjct: 97577 agatcagacaagagccacatg 97597

>gb|AC044802.6| Homo sapiens chromosome 16 clone RP11-61A14, complete sequence
          Length = 170691

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 656   gggggtgttgtttgggtggtgggag 680
             ||||||||||||||||||| |||||
Sbjct: 19272 gggggtgttgtttgggtggagggag 19248

>emb|AL135750.5|HSO20 Homo sapiens chromosome X sequence from BAC CEPHB20O20 region
              PHKA1-DXS227 map Xq13, complete sequence
          Length = 115637

 Score = 42.1 bits (21), Expect = 3.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 861    agatcagacaagagccacatg 881
              |||||||||||||||||||||
Sbjct: 101022 agatcagacaagagccacatg 101042


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 132,066,944
Number of extensions: 7022438
Number of successful extensions: 179020
Number of sequences better than 10.0: 25
Number of HSP's gapped: 179017
Number of HSP's successfully gapped: 29
Length of query: 985
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 962
Effective length of database: 18,503,978,556
Effective search space: 17800827370872
Effective search space used: 17800827370872
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)