>ref|XM_001087551.1| PREDICTED: Macaca mulatta similar to Josephin domain containing 3
           (LOC696602), mRNA
          Length = 1498
 Score = 44.1 bits (22), Expect = 0.84
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 425 tgttttgcatcctcatcctctg 446
           ||||||||||||||||||||||
Sbjct: 907 tgttttgcatcctcatcctctg 886

>gb|AC097535.3| Homo sapiens BAC clone RP11-802H3 from 4, complete sequence
          Length = 72759

 Score = 44.1 bits (22), Expect = 0.84
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                      
Query: 488  gaaatgtttctttctccttgattttc 513
            |||||||||||||||||||| |||||
Sbjct: 2941 gaaatgtttctttctccttgcttttc 2916

>gb|AC152350.31| Medicago truncatula clone mth2-72d18, complete sequence
          Length = 113323

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 789   tggatacaaaatagtattata 809
             |||||||||||||||||||||
Sbjct: 68719 tggatacaaaatagtattata 68739

>ref|XM_612376.2| PREDICTED: Bos taurus similar to centromere protein F (350/400kD)
            (LOC533089), mRNA
          Length = 10149

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 494  tttctttctccttgattttct 514
            |||||||||||||||||||||
Sbjct: 1321 tttctttctccttgattttct 1301

>gb|U33050.4|SCD8035 Saccharomyces cerevisiae chromosome IV cosmids 9410, 8035, 8166, and
             9787
          Length = 69009

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 491   atgtttctttctccttgattt 511
             |||||||||||||||||||||
Sbjct: 67908 atgtttctttctccttgattt 67888

>gb|AF459096.1| Saccharomyces cerevisiae NB64 small subunit mitochondrial ribosomal
           protein Rsm28-1 (RSM28-1) gene, complete cds; nuclear
           gene for mitochondrial product
          Length = 885

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 491 atgtttctttctccttgattt 511
           |||||||||||||||||||||
Sbjct: 248 atgtttctttctccttgattt 228

>gb|AF459095.1| Saccharomyces cerevisiae NB64/D273-10B small subunit mitochondrial
           ribosomal protein Rsm28 (YDR494w/RSM28) gene, complete
           cds; nuclear gene for mitochondrial product
          Length = 1086

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 491 atgtttctttctccttgattt 511
           |||||||||||||||||||||
Sbjct: 248 atgtttctttctccttgattt 228

>emb|AL160058.8| Human DNA sequence from clone RP11-280O1 on chromosome 1 Contains the
             5' end of the LMX1A gene for alpha LIM homeobox
             transcription factor 1, the RXRG gene for gamma retinoid X
             receptor, the 3' end of a novel gene (FLJ35813) and two
             CpG islands, complete sequence
          Length = 155369

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 480   tgtgtgctgaaatgtttcttt 500
             |||||||||||||||||||||
Sbjct: 40893 tgtgtgctgaaatgtttcttt 40913

>emb|AL596084.13| Mouse DNA sequence from clone RP23-196B5 on chromosome 11 Contains the
              Pank3 gene for pantothenate kinase 3, a pseudogene similar
              to part of ribosomal protein L7a (Rpl7a), a pseudogene
              similar to part of fibrillarin (Fbl), the Rars gene for
              arginyl-tRNA synthetase, the 3' end of the gene for a novel
              protein similar to human KIBRA and two CpG islands,
              complete sequence
          Length = 181103

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 487    tgaaatgtttctttctccttg 507
              |||||||||||||||||||||
Sbjct: 173212 tgaaatgtttctttctccttg 173232

>dbj|AP002031.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K3D20
          Length = 81208

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 30    accttcgcttccatcaaaaca 50
             |||||||||||||||||||||
Sbjct: 61987 accttcgcttccatcaaaaca 62007

>gb|DQ331085.1| Synthetic construct Saccharomyces cerevisiae clone FLH144427.01X
           RSM28 gene, complete sequence
          Length = 1086

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 491 atgtttctttctccttgattt 511
           |||||||||||||||||||||
Sbjct: 248 atgtttctttctccttgattt 228

>gb|AF080121.1|T25C13 Arabidopsis thaliana BAC T25C13
          Length = 120067

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 30    accttcgcttccatcaaaaca 50
             |||||||||||||||||||||
Sbjct: 93743 accttcgcttccatcaaaaca 93763

>emb|Y14407.1|HSHS12ENH Homo sapiens DNA for 3' IgH locus control region, alpha HS1,2
            enhancer
          Length = 3735

 Score = 42.1 bits (21), Expect = 3.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 109  gcctccctcgctggcgctggacggg 133
            |||||||||||||| ||||||||||
Sbjct: 3704 gcctccctcgctggggctggacggg 3728


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 149,151,968
Number of extensions: 8401910
Number of successful extensions: 156483
Number of sequences better than 10.0: 13
Number of HSP's gapped: 156483
Number of HSP's successfully gapped: 13
Length of query: 881
Length of database: 18,610,659,111
Length adjustment: 22
Effective length of query: 859
Effective length of database: 18,508,616,841
Effective search space: 15898901866419
Effective search space used: 15898901866419
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 14 (28.2 bits)