ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | FLbaf8h08 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY103621.1| Zea mays PCO154872 mRNA sequence Length = 805 Score = 648 bits (327), Expect = 0.0 Identities = 450/491 (91%) Strand = Plus / Plus Query: 42 cctccggtctcgagagctcgccagaatggtcgcccacaggttccaccagtaccaggtggt 101 ||||||| | || ||||||||| ||||||||||||||||||||| |||||||||||||| Sbjct: 43 cctccggccacgcgagctcgccgaaatggtcgcccacaggttccatcagtaccaggtggt 102 Query: 102 gggtcgcgcgctgccgaccccgggcgatgagcagcccaagatctaccgcatgaagctctg 161 ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| Sbjct: 103 gggtcgcgcgctgccgaccccaaccgatgagcaccccaagatctaccgcatgaagctctg 162 Query: 162 ggccaccaacgaggtccgcgccaagtccaagttctggtacttcctgaggaagctcaagaa 221 ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 163 ggccaccaacgaggttcgcgccaagtccaagttctggtacttcctgagaaagctcaagaa 222 Query: 222 ggtgaagaaggccaacggccagatgctcgccatcaacgagatctttgagaagaacccgac 281 |||||||||| ||| ||||||||||| ||||||||||||||||||||| |||||||| Sbjct: 223 ggtgaagaagagcaatggccagatgcttgccatcaacgagatctttgagcgcaacccgac 282 Query: 282 caccatcaagaactacggcatctggctgcgctaccagagcaggaccggttaccacaacat 341 ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 283 caccatcaagaactatggcatctggctgcgctaccagagcaggactggttaccacaacat 342 Query: 342 gtacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatgtacacggagat 401 ||||||||||||||||||||| || |||||||||| |||||||||||||||| ||||| Sbjct: 343 gtacaaggagtaccgcgacaccaccctgaacggcgcagtggagcagatgtacaacgagat 402 Query: 402 ggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagactgcgacggtgga 461 ||| || || ||||||||| | ||||| ||||| |||||||||||||| |||||||| | Sbjct: 403 ggcctcccgccaccgcgtgaggtccccctgcatacagatcatcaagacagcgacggtcca 462 Query: 462 cttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttccc 521 ||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||| Sbjct: 463 cttcaagctgtgcaagagggacaacaccaagcagttccacaactccgagatcaagttccc 522 Query: 522 gctggtgtacc 532 ||| ||||||| Sbjct: 523 gcttgtgtacc 533
>ref|NM_001062870.1| Oryza sativa (japonica cultivar-group) Os05g0565000 (Os05g0565000) mRNA, complete cds Length = 965 Score = 577 bits (291), Expect = e-161 Identities = 423/467 (90%) Strand = Plus / Plus Query: 66 aatggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccggg 125 |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||| || Sbjct: 64 aatggtcgcctacaggttccatcagtaccaggtggtgggtcgcgcgctcccgacccccgg 123 Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 124 cgatgagcaccccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 183 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 |||||||||||||||||||||||||||||| ||||||||||||||| ||| || ||||| Sbjct: 184 gtccaagttctggtacttcctgaggaagctgaagaaggtgaagaagagcaatggacagat 243 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||||||||||||||||||||||||| ||||| || || |||||||||||||||||||| Sbjct: 244 gctcgccatcaacgagatctttgagcgtaaccctacaacgatcaagaactacggcatctg 303 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 |||||| ||||||||||| || ||||||||||||||||||||||| ||||| ||||| || Sbjct: 304 gctgcgttaccagagcagaacaggttaccacaacatgtacaaggaataccgtgacactac 363 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 425 |||||| || | |||||||||||||||||| |||||||| || || ||||| ||| | | Sbjct: 364 tctgaatggtgctgtggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggtt 423 Query: 426 cccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaa 485 ||| ||||| |||||||||||||| || || || |||||||||| |||||||||||||| Sbjct: 424 cccctgcattcagatcatcaagaccgcaacagttcacttcaagctctgcaagagggacaa 483 Query: 486 cacgaagcagttccacaactcgaagatcaagttcccgctggtgtacc 532 ||| |||||||||||||||||||| |||||||||||||| ||||||| Sbjct: 484 cactaagcagttccacaactcgaatatcaagttcccgctcgtgtacc 530
>dbj|AK102673.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033102C12, full insert sequence Length = 966 Score = 577 bits (291), Expect = e-161 Identities = 423/467 (90%) Strand = Plus / Plus Query: 66 aatggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccggg 125 |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||| || Sbjct: 65 aatggtcgcctacaggttccatcagtaccaggtggtgggtcgcgcgctcccgacccccgg 124 Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 125 cgatgagcaccccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 184 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 |||||||||||||||||||||||||||||| ||||||||||||||| ||| || ||||| Sbjct: 185 gtccaagttctggtacttcctgaggaagctgaagaaggtgaagaagagcaatggacagat 244 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||||||||||||||||||||||||| ||||| || || |||||||||||||||||||| Sbjct: 245 gctcgccatcaacgagatctttgagcgtaaccctacaacgatcaagaactacggcatctg 304 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 |||||| ||||||||||| || ||||||||||||||||||||||| ||||| ||||| || Sbjct: 305 gctgcgttaccagagcagaacaggttaccacaacatgtacaaggaataccgtgacactac 364 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 425 |||||| || | |||||||||||||||||| |||||||| || || ||||| ||| | | Sbjct: 365 tctgaatggtgctgtggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggtt 424 Query: 426 cccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaa 485 ||| ||||| |||||||||||||| || || || |||||||||| |||||||||||||| Sbjct: 425 cccctgcattcagatcatcaagaccgcaacagttcacttcaagctctgcaagagggacaa 484 Query: 486 cacgaagcagttccacaactcgaagatcaagttcccgctggtgtacc 532 ||| |||||||||||||||||||| |||||||||||||| ||||||| Sbjct: 485 cactaagcagttccacaactcgaatatcaagttcccgctcgtgtacc 531
>emb|CT830899.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCSA030A12, full insert sequence Length = 807 Score = 569 bits (287), Expect = e-159 Identities = 422/467 (90%) Strand = Plus / Plus Query: 66 aatggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccggg 125 |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||| || Sbjct: 69 aatggtcgcctacaggttccatcagtaccaggtggtgggtcgcgcgctcccgacccccgg 128 Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 129 cgatgagcaccccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 188 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 |||||||||||||||||||||||||||||| ||||| ||||||||| ||| || ||||| Sbjct: 189 gtccaagttctggtacttcctgaggaagctgaagaaagtgaagaagagcaatggacagat 248 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||||||||||||||||||||||||| ||||| || || |||||||||||||||||||| Sbjct: 249 gctcgccatcaacgagatctttgagcgtaaccctacaacgatcaagaactacggcatctg 308 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 |||||| ||||||||||| || ||||||||||||||||||||||| ||||| ||||| || Sbjct: 309 gctgcgttaccagagcagaacaggttaccacaacatgtacaaggaataccgtgacactac 368 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 425 |||||| || | |||||||||||||||||| |||||||| || || ||||| ||| | | Sbjct: 369 tctgaatggtgctgtggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggtt 428 Query: 426 cccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaa 485 ||| ||||| |||||||||||||| || || || |||||||||| |||||||||||||| Sbjct: 429 cccctgcattcagatcatcaagaccgcaacagttcacttcaagctctgcaagagggacaa 488 Query: 486 cacgaagcagttccacaactcgaagatcaagttcccgctggtgtacc 532 ||| |||||||||||||||||||| |||||||||||||| ||||||| Sbjct: 489 cactaagcagttccacaactcgaatatcaagttcccgctcgtgtacc 535
>gb|BT017327.1| Zea mays clone EL01N0320F05.c mRNA sequence Length = 791 Score = 545 bits (275), Expect = e-152 Identities = 404/447 (90%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||| ||||||||||||||||| |||||||||||||| || ||||||||||| | Sbjct: 57 caggttccatcagtaccaggtggtggggcgcgcgctgccgacgcccggcgatgagcactc 116 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 117 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagagcaagttctg 176 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 ||||||| |||||||| | |||||||| |||||| |||||||||| | || |||||||| Sbjct: 177 gtacttcttgaggaagttgaagaaggttaagaagagcaacggccaggtcctggccatcaa 236 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 ||||||||||||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 237 cgagatctttgagcgtaacccgacgacaatcaagaactacggcatctggctgcgctacca 296 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 |||||| ||||| |||||||||||||||||||||||||||||||| || ||||| |||| Sbjct: 297 gagcagaaccggctaccacaacatgtacaaggagtaccgcgacacaaccctgaatggcgc 356 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 ||||||||||||||||| |||||||| || || ||||||||| | ||||| |||||||| Sbjct: 357 tgtggagcagatgtacaacgagatggcctctcgccaccgcgtgaggtccccctgcatcca 416 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 |||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||| Sbjct: 417 gatcatcaagactgcgacggtgcacttcaagctctgcaagagggacaacactaagcagtt 476 Query: 498 ccacaactcgaagatcaagttcccgct 524 ||||||| |||||||||||||||| Sbjct: 477 ccacaacagtgagatcaagttcccgct 503
>gb|AY103768.1| Zea mays PCO155588 mRNA sequence Length = 818 Score = 529 bits (267), Expect = e-147 Identities = 408/455 (89%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||| ||||||||||||||||| |||||||||||||| || ||||| ||||| || Sbjct: 75 caggttccatcagtaccaggtggtggggcgcgcgctgccgacgcccggcgacgagcaccc 134 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| Sbjct: 135 caagatctaccgcatgaagctctgggccaccaacgaagtccgcgccaagagcaagttctg 194 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 |||||||||||||||| | |||||||| |||||| |||||| ||| | || |||||||| Sbjct: 195 gtacttcctgaggaagttgaagaaggttaagaagagcaacggtcaggtcctggccatcaa 254 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 ||||||||| ||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 255 cgagatcttcgagcgtaacccgacgacgatcaagaactacggcatctggctgcgctacca 314 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 |||||| ||||| |||||||||||||||||||||||||||||||| || ||||| |||| Sbjct: 315 gagcagaaccggctaccacaacatgtacaaggagtaccgcgacacaaccctgaatggcgc 374 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 ||||||||||||||||| |||||||| || || ||||||||| | ||||| |||||||| Sbjct: 375 tgtggagcagatgtacaacgagatggcttctcgccaccgcgtgaggtccccctgcatcca 434 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 |||||||||||||||||||||| |||||||||| ||||||||||||||||| |||||||| Sbjct: 435 gatcatcaagactgcgacggtgcacttcaagctctgcaagagggacaacactaagcagtt 494 Query: 498 ccacaactcgaagatcaagttcccgctggtgtacc 532 ||||||| ||||||||||||| || ||||||| Sbjct: 495 ccacaacagtgagatcaagttcccactcgtgtacc 529
>gb|BT016199.1| Zea mays clone Contig32 mRNA sequence Length = 732 Score = 505 bits (255), Expect = e-140 Identities = 405/455 (89%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||| ||||||||||||||||| |||||||||||||| || ||||| ||||| || Sbjct: 82 caggttccatcagtaccaggtggtggggcgcgcgctgccgacgcccggcgacgagcaccc 141 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| Sbjct: 142 caagatctaccgcatgaagctctgggccaccaacgaagtccgcgccaagagcaagttctg 201 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 |||||||||||||||| | |||||||| |||||| |||||| ||| | || |||||||| Sbjct: 202 gtacttcctgaggaagttgaagaaggttaagaagagcaacggtcaggtcctggccatcaa 261 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 ||||||||| ||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 262 cgagatcttcgagcgtaacccgacgacgatcaagaactacggcatctggctgcgctacca 321 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 |||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||| Sbjct: 322 gagcagaaccggctaccacaacatgtacaaggagtaccgcgacacaaccctgaacggcgc 381 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 ||| ||||||||||||| |||||||| || || ||||||||| | ||||| |||||||| Sbjct: 382 tgtagagcagatgtacaatgagatggcttctcgccaccgcgtgaggtccccatgcatcca 441 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 |||||||||||| || || ||| |||||||||||||||||||||||||||| |||||||| Sbjct: 442 gatcatcaagaccgccacagtgcacttcaagctgtgcaagagggacaacaccaagcagtt 501 Query: 498 ccacaactcgaagatcaagttcccgctggtgtacc 532 |||||| ||||||||||||| || ||||||| Sbjct: 502 tcacaacagtgagatcaagttcccactcgtgtacc 536
>gb|BT017504.1| Zea mays clone EL01N0414H05.c mRNA sequence Length = 834 Score = 468 bits (236), Expect = e-128 Identities = 362/404 (89%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||| ||||||||||||||||| |||||||||||||| || ||||| ||||| || Sbjct: 62 caggttccatcagtaccaggtggtggggcgcgcgctgccgacgcccggcgacgagcaccc 121 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 |||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| Sbjct: 122 caagatctaccgcatgaagctctgggccaccaacgaagtccgcgccaagagcaagttctg 181 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 |||||||||||||||| | |||||||| |||||| |||||| ||| | || |||||||| Sbjct: 182 gtacttcctgaggaagttgaagaaggttaagaagagcaacggtcaggtcctggccatcaa 241 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 ||||||||| ||| |||||||| || |||||||||||||||||||||||||||||||| Sbjct: 242 cgagatcttcgagcgtaacccgacgacgatcaagaactacggcatctggctgcgctacca 301 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 |||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||| Sbjct: 302 gagcagaaccggctaccacaacatgtacaaggagtaccgcgacacaaccctgaacggcgc 361 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 ||| ||||||||||||| |||||||| || || ||||||||| | ||||| |||||||| Sbjct: 362 tgtagagcagatgtacaatgagatggcttctcgccaccgcgtgaggtccccatgcatcca 421 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagaggg 481 |||||||||||| || || ||| ||||||||||||||||||||| Sbjct: 422 gatcatcaagaccgccacagtgcacttcaagctgtgcaagaggg 465
>emb|CT833868.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA111J03, full insert sequence Length = 886 Score = 392 bits (198), Expect = e-106 Identities = 390/454 (85%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||||||||||||||||||||| | | |||||||| ||| ||| ||||| || Sbjct: 83 caggttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccc 142 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 143 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 202 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 ||||||||| | ||||| ||||||||||||||| |||||| ||||| || |||||||| Sbjct: 203 gtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatcaa 262 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 |||||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||| Sbjct: 263 cgagatttttgagaagaacccaacgactatcaagaactatggcatctggctgcgttacca 322 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 ||| ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 323 gagtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgc 382 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 || |||||||||||||| |||||||| || || ||||| || | | ||| ||||| || Sbjct: 383 cgttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattca 442 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 ||||||||||||||| || || |||| || || |||||| | |||||||| |||||||| Sbjct: 443 gatcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagtt 502 Query: 498 ccacaactcgaagatcaagttcccgctggtgtac 531 |||||| || | ||||||||||| ||||||||| Sbjct: 503 ccacaagtcagatatcaagttcccactggtgtac 536
>emb|CT833867.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCRA111J02, full insert sequence Length = 889 Score = 392 bits (198), Expect = e-106 Identities = 390/454 (85%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||||||||||||||||||||| | | |||||||| ||| ||| ||||| || Sbjct: 83 caggttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccc 142 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 143 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 202 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 ||||||||| | ||||| ||||||||||||||| |||||| ||||| || |||||||| Sbjct: 203 gtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatcaa 262 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 |||||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||| Sbjct: 263 cgagatttttgagaagaacccaacgactatcaagaactatggcatctggctgcgttacca 322 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 ||| ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 323 gagtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgc 382 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 || |||||||||||||| |||||||| || || ||||| || | | ||| ||||| || Sbjct: 383 cgttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattca 442 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 ||||||||||||||| || || |||| || || |||||| | |||||||| |||||||| Sbjct: 443 gatcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagtt 502 Query: 498 ccacaactcgaagatcaagttcccgctggtgtac 531 |||||| || | ||||||||||| ||||||||| Sbjct: 503 ccacaagtcagatatcaagttcccactggtgtac 536
>ref|NM_001050799.1| Oryza sativa (japonica cultivar-group) Os01g0752300 (Os01g0752300) mRNA, complete cds Length = 909 Score = 385 bits (194), Expect = e-103 Identities = 389/454 (85%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||||||||||||||||||||| | | |||||||| ||| ||| ||||| || Sbjct: 128 caggttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccc 187 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 188 caagatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctg 247 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 ||||||||| | ||||| ||||||||||||||| |||||| ||||| || |||||||| Sbjct: 248 gtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatcaa 307 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 |||||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||| Sbjct: 308 cgagatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttacca 367 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 ||| ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 368 gagtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgc 427 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 || |||||||||||||| |||||||| || || ||||| || | | ||| ||||| || Sbjct: 428 cgttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattca 487 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 ||||||||||||||| || || |||| || || |||||| | |||||||| |||||||| Sbjct: 488 gatcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagtt 547 Query: 498 ccacaactcgaagatcaagttcccgctggtgtac 531 |||||| || | ||||||||||| ||||||||| Sbjct: 548 ccacaagtcagatatcaagttcccactggtgtac 581
>gb|DQ244656.1| Zea mays clone 9937 mRNA sequence Length = 778 Score = 381 bits (192), Expect = e-102 Identities = 404/477 (84%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||||||| | ||||||||||||||||| |||||||| || |||||| Sbjct: 83 gatgtgcagcctaagatctacaggatgaagctctgggccacgaacgaggttcgtgccaag 142 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||||||| |||||||||| |||||||| |||||| |||||| |||||| Sbjct: 143 tccaagttctggtacttcttgaggaagctgaagaaggttaagaagagcaacggtcagatg 202 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 |||||||||||||||||||||||||||||||| || ||||||||||||| || |||||| Sbjct: 203 ctcgccatcaacgagatctttgagaagaacccaacaaccatcaagaactttggaatctgg 262 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | |||||||||||||| || |||||||||||||||||||||||||||||||| || Sbjct: 263 ttgaggtaccagagcaggactggataccacaacatgtacaaggagtaccgcgacaccacc 322 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 426 ||||||| | ||||||||||||||||| |||||||||||||| |||||||| | | | Sbjct: 323 ttgaacggagccgtggagcagatgtacaccgagatggcgtcgcgacaccgcgtcaggttc 382 Query: 427 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 486 || ||||||||||||||||||||||| || || |||||| ||||||||||| | | Sbjct: 383 ccttgcatccagatcatcaagactgccactgtcccggccaagctctgcaagagggagagc 442 Query: 487 acgaagcagttccacaactcgaagatcaagttcccgctggtgtaccagaaggtgcgnnnn 546 || ||||||||||||||| || ||||||||||| |||||| || ||||| | Sbjct: 443 accaagcagttccacaacagcaaaatcaagttcccattggtgttccgcaaggtcagacca 502 Query: 547 nnnacccgcaagctcaagaccacctacaaggccacaaggcccaacctcttcatgtga 603 ||| | |||||||||||||||||||||||| | | ||||||| | ||||||||| Sbjct: 503 ccaaccaggaagctcaagaccacctacaaggcctccaagcccaacttgttcatgtga 559
>dbj|AK121755.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033088C04, full insert sequence Length = 910 Score = 377 bits (190), Expect = e-101 Identities = 388/454 (85%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||||||||||||||||||||| | | |||||||| | | ||| ||||| || Sbjct: 129 caggttccaccagtaccaggtggtggggaggggcctgccgacgcggaccgacgagcaccc 188 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Sbjct: 189 caagatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctg 248 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 ||||||||| | ||||| ||||||||||||||| |||||| ||||| || |||||||| Sbjct: 249 gtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatcaa 308 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 |||||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||| Sbjct: 309 cgagatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttacca 368 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 ||| ||||| || |||||||||||||||||||||||||| || || || || || || | Sbjct: 369 gagtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgc 428 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 || |||||||||||||| |||||||| || || ||||| || | | ||| ||||| || Sbjct: 429 cgttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattca 488 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 ||||||||||||||| || || |||| || || |||||| | |||||||| |||||||| Sbjct: 489 gatcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagtt 548 Query: 498 ccacaactcgaagatcaagttcccgctggtgtac 531 |||||| || | ||||||||||| ||||||||| Sbjct: 549 ccacaagtcagatatcaagttcccactggtgtac 582
>gb|DQ244745.1| Zea mays clone 10450 mRNA sequence Length = 729 Score = 373 bits (188), Expect = e-100 Identities = 394/465 (84%) Strand = Plus / Plus Query: 139 aagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctgg 198 ||||||||| | ||||||||||||||||| |||||||| || |||||||||||||||||| Sbjct: 95 aagatctacaggatgaagctctgggccacgaacgaggttcgtgccaagtccaagttctgg 154 Query: 199 tacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaac 258 |||||| |||||||||| |||||||| |||||| |||||| |||||||||||||||||| Sbjct: 155 tacttcttgaggaagctgaagaaggttaagaagagcaacggtcagatgctcgccatcaac 214 Query: 259 gagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccag 318 |||||||||||||||||||| || ||||||||||||| || |||||| || | |||||| Sbjct: 215 gagatctttgagaagaacccaacaaccatcaagaactttggaatctggttgaggtaccag 274 Query: 319 agcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggt 378 |||||||| || |||||||||||||||||||||||||||||||| || ||||||| | Sbjct: 275 agcaggactggataccacaacatgtacaaggagtaccgcgacaccaccttgaacggagcc 334 Query: 379 gtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccag 438 ||||||||||||||||| |||||||||||||| |||||||| | | ||| ||||||||| Sbjct: 335 gtggagcagatgtacaccgagatggcgtcgcgacaccgcgtcaggttcccttgcatccag 394 Query: 439 atcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttc 498 |||||||||||||| || || |||||| ||||||||||| | ||| ||||||||| Sbjct: 395 atcatcaagactgccactgtcccggccaagctctgcaagagggagagcaccaagcagttc 454 Query: 499 cacaactcgaagatcaagttcccgctggtgtaccagaaggtgcgnnnnnnnacccgcaag 558 |||||| || ||||||||||| |||||| || ||||| | ||| | ||| Sbjct: 455 cacaacagcaaaatcaagttcccattggtgttccgcaaggtcagaccaccaaccaggaag 514 Query: 559 ctcaagaccacctacaaggccacaaggcccaacctcttcatgtga 603 ||||||||||||||||||||| | | ||||||| | ||||||||| Sbjct: 515 ctcaagaccacctacaaggcctccaagcccaacttgttcatgtga 559
>ref|NM_001050340.1| Oryza sativa (japonica cultivar-group) Os01g0666900 (Os01g0666900) mRNA, complete cds Length = 588 Score = 325 bits (164), Expect = 1e-85 Identities = 293/336 (87%) Strand = Plus / Plus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 182 ggtacttcctgaggaagctgaagaaggtgaagaagagcaacggccagatgctcgccatca 241 Query: 257 acgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacc 316 |||||||||| ||| ||||| ||||| ||||||||||| |||||||||||||| |||| Sbjct: 242 acgagatcttcgagcgcaacccaaccacgatcaagaactatggcatctggctgcgttacc 301 Query: 317 agagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcg 376 ||||||| |||||||||||||||||||||||||||||||| ||||| || |||| || | Sbjct: 302 agagcagaaccggttaccacaacatgtacaaggagtaccgtgacactacattgaatggtg 361 Query: 377 gtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcc 436 ||||| ||||||||||| |||||||| || || ||||| ||| | | ||| ||||||| Sbjct: 362 ccgtggaacagatgtacaccgagatggcttctcgccaccgtgtgagattcccttgcatcc 421 Query: 437 agatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagt 496 ||||||||||||| || || || |||||||||| ||||||||||||||||| ||||||| Sbjct: 422 agatcatcaagaccgccactgtccacttcaagctctgcaagagggacaacaccaagcagt 481 Query: 497 tccacaactcgaagatcaagttcccgctggtgtacc 532 |||||||| || ||||||||||| || ||||||| Sbjct: 482 tccacaacgggagcatcaagttcccccttgtgtacc 517 Score = 174 bits (88), Expect = 3e-40 Identities = 112/120 (93%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 ||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| || Sbjct: 12 caggttccatcagtaccaggtggtggggcgcgcgctgccgacccccggcgatgagcaccc 71 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 |||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||| Sbjct: 72 caagatctaccggatgaagctctgggccaccaatgaggtccgcgccaagagcaagttctg 131
>emb|CT830898.1| Oryza sativa (indica cultivar-group) cDNA clone:OSIGCEA047P21, full insert sequence Length = 1986 Score = 301 bits (152), Expect = 2e-78 Identities = 185/196 (94%) Strand = Plus / Plus Query: 66 aatggtcgcccacaggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccggg 125 |||||||||| |||||||||| |||||||||||||||||||||||||| |||||||| || Sbjct: 67 aatggtcgcctacaggttccatcagtaccaggtggtgggtcgcgcgctcccgacccccgg 126 Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 127 cgatgagcaccccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 186 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 |||||||||||||||||||||||||||||| ||||| ||||||||| ||| || ||||| Sbjct: 187 gtccaagttctggtacttcctgaggaagctgaagaaagtgaagaagagcaatggacagat 246 Query: 246 gctcgccatcaacgag 261 |||||||||||||||| Sbjct: 247 gctcgccatcaacgag 262 Score = 272 bits (137), Expect = 2e-69 Identities = 239/273 (87%) Strand = Plus / Plus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 ||||||||||| ||||| || || |||||||||||||||||||||||||| ||||||| Sbjct: 1286 agatctttgagcgtaaccctacaacgatcaagaactacggcatctggctgcgttaccaga 1345 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 |||| || ||||||||||||||||||||||| ||||| ||||| |||||||| || | || Sbjct: 1346 gcagaacaggttaccacaacatgtacaaggaataccgtgacactactctgaatggtgctg 1405 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 |||||||||||||||| |||||||| || || ||||| ||| | | ||| ||||| |||| Sbjct: 1406 tggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggttcccctgcattcaga 1465 Query: 440 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 499 |||||||||| || || || |||||||||| ||||||||||||||||| |||||||||| Sbjct: 1466 tcatcaagaccgcaacagttcacttcaagctctgcaagagggacaacactaagcagttcc 1525 Query: 500 acaactcgaagatcaagttcccgctggtgtacc 532 |||||||||| |||||||||||||| ||||||| Sbjct: 1526 acaactcgaatatcaagttcccgctcgtgtacc 1558
>gb|DQ175860.1| Hordeum vulgare clone DsC33 Ds insertion site flanking region genomic sequence Length = 556 Score = 293 bits (148), Expect = 5e-76 Identities = 148/148 (100%) Strand = Plus / Minus Query: 611 cccactgcctactgttttagcgtgtgtaagagtttgaatgttttgcatgtggaagttttg 670 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 149 cccactgcctactgttttagcgtgtgtaagagtttgaatgttttgcatgtggaagttttg 90 Query: 671 gttatgcactttgagaatgttttcagttggcactgaggatgctgctgcgttgatgcaact 730 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 89 gttatgcactttgagaatgttttcagttggcactgaggatgctgctgcgttgatgcaact 30 Query: 731 cttgactttgtttcgtattagtaatgag 758 |||||||||||||||||||||||||||| Sbjct: 29 cttgactttgtttcgtattagtaatgag 2 Score = 145 bits (73), Expect = 3e-31 Identities = 84/87 (96%), Gaps = 3/87 (3%) Strand = Plus / Minus Query: 192 gttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgc 251 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 555 gttctggtacttcctgaggaagctcaagaaggtgaagaaggccaa---ccagatgctcgc 499 Query: 252 catcaacgagatctttgagaagaaccc 278 ||||||||||||||||||||||||||| Sbjct: 498 catcaacgagatctttgagaagaaccc 472
>emb|CT984608.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 822 Score = 281 bits (142), Expect = 2e-72 Identities = 373/450 (82%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 |||||| |||||||||||||| |||||| | || ||||| ||| || ||||| || || Sbjct: 85 caggtttcaccagtaccaggttgtgggtagagccctgcccaccggggcggatgaccaccc 144 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 |||||||| ||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 145 gaagatctatcgcatgaagctgtgggccaccaatgaggtccgtgccaagtccaagttctg 204 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 ||| |||||||||||||| |||||||| |||||| ||| |||||| ||||||||||||| Sbjct: 205 gtatttcctgaggaagctgaagaaggtaaagaagagcaatggccaggtgctcgccatcaa 264 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 |||||| |||||||||||||| || | ||||| ||||| || || ||||| || ||||| Sbjct: 265 cgagatttttgagaagaacccaacaaagatcaataactatgggatatggctccgttacca 324 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 ||| | || || |||||||||||||||||||| ||| | || || || ||||| || | Sbjct: 325 aagccgaactggataccacaacatgtacaaggaatacagagataccacactgaatggggc 384 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 ||||||||||||||| || |||||||| || || ||| | || | | |||||| ||||| Sbjct: 385 tgtggagcagatgtatactgagatggcatctcgccacagagtcaggttcccgtgtatcca 444 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 |||||||||||| || || || ||||| ||||||||||| | ||| ||||| || Sbjct: 445 gatcatcaagacagccactgttccagcgaagctttgcaagagggagagcaccaagcaatt 504 Query: 498 ccacaactcgaagatcaagttcccgctggt 527 |||||||||||||||||||||| ||||||| Sbjct: 505 ccacaactcgaagatcaagttctcgctggt 534
>emb|CT981176.1| partial cDNA sequence from a Lambda ZAP II normalized full-length cDNA library of differentiating xylem from Eucalyptus gunnii Length = 825 Score = 281 bits (142), Expect = 2e-72 Identities = 373/450 (82%) Strand = Plus / Plus Query: 78 caggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcc 137 |||||| |||||||||||||| |||||| | || ||||| ||| || ||||| || || Sbjct: 85 caggtttcaccagtaccaggttgtgggtagagccctgcccaccggggcggatgaccaccc 144 Query: 138 caagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctg 197 |||||||| ||||||||||| ||||||||||| |||||||| ||||||||||||||||| Sbjct: 145 gaagatctatcgcatgaagctgtgggccaccaatgaggtccgtgccaagtccaagttctg 204 Query: 198 gtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaa 257 ||| |||||||||||||| |||||||| |||||| ||| |||||| ||||||||||||| Sbjct: 205 gtatttcctgaggaagctgaagaaggtaaagaagagcaatggccaggtgctcgccatcaa 264 Query: 258 cgagatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctacca 317 |||||| |||||||||||||| || | ||||| ||||| || || ||||| || ||||| Sbjct: 265 cgagatttttgagaagaacccaacaaagatcaataactatgggatatggctccgttacca 324 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 ||| | || || |||||||||||||||||||| ||| | || || || ||||| || | Sbjct: 325 aagccgaactggataccacaacatgtacaaggaatacagagataccacactgaatggggc 384 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 ||||||||||||||| || |||||||| || || ||| | || | | |||||| ||||| Sbjct: 385 tgtggagcagatgtatactgagatggcatctcgccacagagtcaggttcccgtgtatcca 444 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 |||||||||||| || || || ||||| ||||||||||| | ||| ||||| || Sbjct: 445 gatcatcaagacagccactgttccagcgaagctttgcaagagggagagcaccaagcaatt 504 Query: 498 ccacaactcgaagatcaagttcccgctggt 527 |||||||||||||||||||||| ||||||| Sbjct: 505 ccacaactcgaagatcaagttctcgctggt 534
>ref|NM_129000.2| Arabidopsis thaliana structural constituent of ribosome (AT2G34480) mRNA, complete cds Length = 785 Score = 276 bits (139), Expect = 1e-70 Identities = 331/395 (83%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 101 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 160 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 161 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 220 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 221 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 280 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 281 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 340 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 426 || ||||| | ||| |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 341 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 400 Query: 427 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 486 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 401 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 460 Query: 487 acgaagcagttccacaactcgaagatcaagttccc 521 || || |||||||||||| |||||||||||||| Sbjct: 461 actaaacagttccacaacagcaagatcaagttccc 495
>gb|BT000076.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA, complete cds Length = 672 Score = 276 bits (139), Expect = 1e-70 Identities = 331/395 (83%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 61 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 120 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 121 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 180 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 181 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 240 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 241 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 300 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 426 || ||||| | ||| |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 301 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 360 Query: 427 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 486 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 361 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 420 Query: 487 acgaagcagttccacaactcgaagatcaagttccc 521 || || |||||||||||| |||||||||||||| Sbjct: 421 actaaacagttccacaacagcaagatcaagttccc 455
>gb|AY120778.1| Arabidopsis thaliana 60S ribosomal protein L18A (At2g34480) mRNA, complete cds Length = 734 Score = 276 bits (139), Expect = 1e-70 Identities = 331/395 (83%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 96 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 155 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 156 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 215 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 216 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 275 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 276 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 335 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 426 || ||||| | ||| |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 336 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 395 Query: 427 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 486 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 396 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 455 Query: 487 acgaagcagttccacaactcgaagatcaagttccc 521 || || |||||||||||| |||||||||||||| Sbjct: 456 actaaacagttccacaacagcaagatcaagttccc 490
>emb|BX818972.1|CNS0A9U8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB32ZE10 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 752 Score = 276 bits (139), Expect = 1e-70 Identities = 331/395 (83%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 95 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 154 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 155 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 214 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 215 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 274 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 275 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 334 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 426 || ||||| | ||| |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 335 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 394 Query: 427 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 486 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 395 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 454 Query: 487 acgaagcagttccacaactcgaagatcaagttccc 521 || || |||||||||||| |||||||||||||| Sbjct: 455 actaaacagttccacaacagcaagatcaagttccc 489
>emb|BX818907.1|CNS0A9RI Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB25ZH03 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 704 Score = 276 bits (139), Expect = 1e-70 Identities = 331/395 (83%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 47 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 106 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||| ||| |||||||||||||||||||||||||| || || |||||| Sbjct: 107 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatg 166 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 167 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 226 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | |||||||| || || || |||||||||||||||||||||||||| ||||| ||| Sbjct: 227 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgtgacaccact 286 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 426 || ||||| | ||| |||||||||||||| |||||||| || || ||||| || | | | Sbjct: 287 cttaacggagctgttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattc 346 Query: 427 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 486 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 347 ccttgcattcagatcatcaagacagccactgtcccagccaagctgtgcaagagagagagc 406 Query: 487 acgaagcagttccacaactcgaagatcaagttccc 521 || || |||||||||||| |||||||||||||| Sbjct: 407 actaaacagttccacaacagcaagatcaagttccc 441
>gb|AC124143.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBb0053D02, complete sequence Length = 157106 Score = 272 bits (137), Expect = 2e-69 Identities = 239/273 (87%) Strand = Plus / Plus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 ||||||||||| ||||| || || |||||||||||||||||||||||||| ||||||| Sbjct: 129865 agatctttgagcgtaaccctacaacgatcaagaactacggcatctggctgcgttaccaga 129924 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 |||| || ||||||||||||||||||||||| ||||| ||||| |||||||| || | || Sbjct: 129925 gcagaacaggttaccacaacatgtacaaggaataccgtgacactactctgaatggtgctg 129984 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 |||||||||||||||| |||||||| || || ||||| ||| | | ||| ||||| |||| Sbjct: 129985 tggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggttcccctgcattcaga 130044 Query: 440 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 499 |||||||||| || || || |||||||||| ||||||||||||||||| |||||||||| Sbjct: 130045 tcatcaagaccgcaacagttcacttcaagctctgcaagagggacaacactaagcagttcc 130104 Query: 500 acaactcgaagatcaagttcccgctggtgtacc 532 |||||||||| |||||||||||||| ||||||| Sbjct: 130105 acaactcgaatatcaagttcccgctcgtgtacc 130137 Score = 204 bits (103), Expect = 3e-49 Identities = 115/119 (96%) Strand = Plus / Plus Query: 81 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 140 |||||| |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 128575 gttccatcagtaccaggtggtgggtcgcgcgctcccgacccccggcgatgagcaccccaa 128634 Query: 141 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 199 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 128635 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 128693 Score = 89.7 bits (45), Expect = 1e-14 Identities = 60/65 (92%) Strand = Plus / Plus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 ||||||||||||||||||| ||||||||||||||| ||| || |||||||||||||||| Sbjct: 128777 ggtacttcctgaggaagctgaagaaggtgaagaagagcaatggacagatgctcgccatca 128836 Query: 257 acgag 261 ||||| Sbjct: 128837 acgag 128841
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5 Length = 29737217 Score = 272 bits (137), Expect = 2e-69 Identities = 239/273 (87%) Strand = Plus / Plus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 ||||||||||| ||||| || || |||||||||||||||||||||||||| ||||||| Sbjct: 27899448 agatctttgagcgtaaccctacaacgatcaagaactacggcatctggctgcgttaccaga 27899507 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 |||| || ||||||||||||||||||||||| ||||| ||||| |||||||| || | || Sbjct: 27899508 gcagaacaggttaccacaacatgtacaaggaataccgtgacactactctgaatggtgctg 27899567 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 |||||||||||||||| |||||||| || || ||||| ||| | | ||| ||||| |||| Sbjct: 27899568 tggagcagatgtacaccgagatggcctctcgtcaccgtgtgaggttcccctgcattcaga 27899627 Query: 440 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 499 |||||||||| || || || |||||||||| ||||||||||||||||| |||||||||| Sbjct: 27899628 tcatcaagaccgcaacagttcacttcaagctctgcaagagggacaacactaagcagttcc 27899687 Query: 500 acaactcgaagatcaagttcccgctggtgtacc 532 |||||||||| |||||||||||||| ||||||| Sbjct: 27899688 acaactcgaatatcaagttcccgctcgtgtacc 27899720 Score = 204 bits (103), Expect = 3e-49 Identities = 115/119 (96%) Strand = Plus / Plus Query: 81 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 140 |||||| |||||||||||||||||||||||||| |||||||| ||||||||||| ||||| Sbjct: 27898158 gttccatcagtaccaggtggtgggtcgcgcgctcccgacccccggcgatgagcaccccaa 27898217 Query: 141 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 199 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 27898218 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 27898276 Score = 89.7 bits (45), Expect = 1e-14 Identities = 60/65 (92%) Strand = Plus / Plus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 ||||||||||||||||||| ||||||||||||||| ||| || |||||||||||||||| Sbjct: 27898360 ggtacttcctgaggaagctgaagaaggtgaagaagagcaatggacagatgctcgccatca 27898419 Query: 257 acgag 261 ||||| Sbjct: 27898420 acgag 27898424
>gb|BT006559.1| Arabidopsis thaliana At2g34480 gene, complete cds Length = 537 Score = 268 bits (135), Expect = 3e-68 Identities = 312/371 (84%) Strand = Plus / Plus Query: 151 atgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggtacttcctgagg 210 |||||||||||||| || |||||||| || |||||||||||||||||||| ||| ||||| Sbjct: 85 atgaagctctgggctacgaacgaggttcgtgccaagtccaagttctggtatttcttgagg 144 Query: 211 aagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaacgagatctttgag 270 ||||||||||||||||||||| || || ||||||||||||||||||||||||| |||| Sbjct: 145 aagctcaagaaggtgaagaagagtaatggacagatgctcgccatcaacgagatctatgag 204 Query: 271 aagaacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggt 330 |||||||| || || |||||||||| ||| || ||| || | |||||||| || || || Sbjct: 205 aagaacccaacaacgatcaagaacttcggtatttggttgaggtaccagagtagaactggg 264 Query: 331 taccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatg 390 |||||||||||||||||||||||||| ||||| ||||| ||||| | ||| ||||||||| Sbjct: 265 taccacaacatgtacaaggagtaccgtgacaccactcttaacggagctgttgagcagatg 324 Query: 391 tacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagact 450 ||||| |||||||| || || ||||| || | | ||| ||||| |||||||||||||| Sbjct: 325 tacactgagatggcatcccgtcaccgtgtcagattcccttgcattcagatcatcaagaca 384 Query: 451 gcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaag 510 || || || ||||||||||||||| || | ||| || |||||||||||| ||| Sbjct: 385 gccactgtcccagccaagctgtgcaagagagagagcactaaacagttccacaacagcaag 444 Query: 511 atcaagttccc 521 ||||||||||| Sbjct: 445 atcaagttccc 455
>gb|AY042803.1| Arabidopsis thaliana Unknown protein mRNA, complete cds Length = 755 Score = 268 bits (135), Expect = 3e-68 Identities = 312/371 (84%) Strand = Plus / Plus Query: 151 atgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggtacttcctgagg 210 |||||||||||||| || |||||||| || |||||||||||||||||||| ||| ||||| Sbjct: 120 atgaagctctgggctacgaacgaggttcgtgccaagtccaagttctggtatttcttgagg 179 Query: 211 aagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaacgagatctttgag 270 ||||||||||||||||||||| || || ||||||||||||||||||||||||| |||| Sbjct: 180 aagctcaagaaggtgaagaagagtaatggacagatgctcgccatcaacgagatctatgag 239 Query: 271 aagaacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggt 330 |||||||| || || |||||||||| ||| || ||| || | |||||||| || || || Sbjct: 240 aagaacccaacaacgatcaagaacttcggtatttggttgaggtaccagagtagaactggg 299 Query: 331 taccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatg 390 |||||||||||||||||||||||||| ||||| ||||| ||||| | ||| ||||||||| Sbjct: 300 taccacaacatgtacaaggagtaccgtgacaccactcttaacggagctgttgagcagatg 359 Query: 391 tacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagact 450 ||||| |||||||| || || ||||| || | | ||| ||||| |||||||||||||| Sbjct: 360 tacactgagatggcatcccgtcaccgtgtcagattcccttgcattcagatcatcaagaca 419 Query: 451 gcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaag 510 || || || ||||||||||||||| || | ||| || |||||||||||| ||| Sbjct: 420 gccactgtcccagccaagctgtgcaagagagagagcactaaacagttccacaacagcaag 479 Query: 511 atcaagttccc 521 ||||||||||| Sbjct: 480 atcaagttccc 490
>dbj|D21301.1|RICSS128 Oryza sativa SS128 mRNA for ribosomal protein L18a, partial sequence Length = 380 Score = 262 bits (132), Expect = 2e-66 Identities = 218/247 (88%) Strand = Plus / Plus Query: 286 atcaagaactacggcatctggctgcgctaccagagcaggaccggttaccacaacatgtac 345 ||||||||||||||||||||| |||| ||||||||||| || |||||||||||||||||| Sbjct: 16 atcaagaactacggcatctggntgcgttaccagagcagaacaggttaccacaacatgtac 75 Query: 346 aaggagtaccgcgacacgactctgaacggcggtgtggagcagatgtacacggagatggcg 405 ||||| ||||| ||||| |||||||| || | |||||||||||||||||| |||||||| Sbjct: 76 aaggaataccgtgacactactctgaatggtgctgtggagcagatgtacaccgagatggcc 135 Query: 406 tcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagactgcgacggtggacttc 465 || || ||||| ||| | | ||| ||||| |||||||||||||| || || || ||||| Sbjct: 136 tctcgtcaccgtgtgaggttcccctgcattcagatcatcaagaccgcaacagttcacttc 195 Query: 466 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctg 525 ||||| ||||||||||||||||| |||||||||||||||||||| |||||||||||||| Sbjct: 196 aagctctgcaagagggacaacactaagcagttccacaactcgaatatcaagttcccgctc 255 Query: 526 gtgtacc 532 ||||||| Sbjct: 256 gtgtacc 262
>gb|DQ245082.1| Zea mays clone 12813 mRNA sequence Length = 774 Score = 260 bits (131), Expect = 7e-66 Identities = 275/323 (85%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||||||| | |||||||| ||||| || || || ||||| |||||| Sbjct: 102 gatgtgcagccaaagatctacaggatgaagctatgggctacaaatgaagtccgagccaag 161 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||||||||||||||||||||||||||| |||||| |||||| || ||| Sbjct: 162 tccaagttctggtacttcctgaggaagctcaagaaggttaagaagagcaacggacaaatg 221 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 || |||||||| ||||| || ||||||| ||| || | |||||||||||||| |||||| Sbjct: 222 cttgccatcaatgagattttcgagaagagccccacgaagatcaagaactacggtatctgg 281 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 ||||| ||||||||||| || || |||||||||||||||||||||| ||| ||||| ||| Sbjct: 282 ctgcgttaccagagcagaactgggtaccacaacatgtacaaggagttccgtgacaccact 341 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 426 || ||||| | ||||||||||||||||| |||||||| || || || | ||| | | | Sbjct: 342 ctcaacggtgcagtggagcagatgtacactgagatggcttctcgccatagagtgaggttc 401 Query: 427 ccgtgcatccagatcatcaagac 449 || ||||| |||||||||||||| Sbjct: 402 ccttgcattcagatcatcaagac 424 Score = 58.0 bits (29), Expect = 5e-05 Identities = 47/53 (88%) Strand = Plus / Plus Query: 469 ctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttccc 521 ||||||||||| || | ||| ||||||||||| ||||| |||||||||||||| Sbjct: 444 ctgtgcaagagagagagcaccaagcagttccataactccaagatcaagttccc 496 Score = 52.0 bits (26), Expect = 0.003 Identities = 41/46 (89%) Strand = Plus / Plus Query: 556 aagctcaagaccacctacaaggccacaaggcccaacctcttcatgt 601 ||||||||||| || ||||||||| ||| ||||||||| ||||||| Sbjct: 531 aagctcaagactacgtacaaggcctcaaagcccaaccttttcatgt 576
>ref|NM_112321.2| Arabidopsis thaliana structural constituent of ribosome (AT3G14600) mRNA, complete cds Length = 853 Score = 256 bits (129), Expect = 1e-64 Identities = 332/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Plus Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| || ||||||||| | |||||||| |||| | || || || ||||||| Sbjct: 136 cgatgagcaccctaagatctacaggatgaagctttggggtagaaatgaagtatgcgccaa 195 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 ||||||||||||||||||| ||||||| || |||||||||||||| |||||| ||||| Sbjct: 196 gtccaagttctggtacttcatgaggaaactgaagaaggtgaagaaaagcaacggacagat 255 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| ||||| Sbjct: 256 gcttgccatcaatgagattttcgagaagaacccaacgaccatcaagaactacgggatctg 315 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 | |||| || |||||| | || || |||||||||||||||||||||||||| ||||| || Sbjct: 316 gttgcgttatcagagccgaactgggtaccacaacatgtacaaggagtaccgtgacacaac 375 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 425 || || || || ||||||||||||||||| |||||||| || || || | ||| | | Sbjct: 376 actcaatggtggagtggagcagatgtacactgagatggcttctcgtcatagagtgaggtt 435 Query: 426 cccgtgcatccagatcatcaagactgcgacggtggacttc-aagctgtgcaagagggaca 484 ||| ||||| |||||||||||||||||||| || || | ||||| |||||||| || | Sbjct: 436 cccttgcattcagatcatcaagactgcgactgt-ccctgcaaagctttgcaagagagaga 494 Query: 485 acacgaagcagttccacaactcgaagatcaagttccc 521 ||| ||||||||||| |||||||||||||||||||| Sbjct: 495 tcaccaagcagttccataactcgaagatcaagttccc 531
>gb|AY097377.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds Length = 537 Score = 256 bits (129), Expect = 1e-64 Identities = 332/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Plus Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| || ||||||||| | |||||||| |||| | || || || ||||||| Sbjct: 60 cgatgagcaccctaagatctacaggatgaagctttggggtagaaatgaagtatgcgccaa 119 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 ||||||||||||||||||| ||||||| || |||||||||||||| |||||| ||||| Sbjct: 120 gtccaagttctggtacttcatgaggaaactgaagaaggtgaagaaaagcaacggacagat 179 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| ||||| Sbjct: 180 gcttgccatcaatgagattttcgagaagaacccaacgaccatcaagaactacgggatctg 239 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 | |||| || |||||| | || || |||||||||||||||||||||||||| ||||| || Sbjct: 240 gttgcgttatcagagccgaactgggtaccacaacatgtacaaggagtaccgtgacacaac 299 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 425 || || || || ||||||||||||||||| |||||||| || || || | ||| | | Sbjct: 300 actcaatggtggagtggagcagatgtacactgagatggcttctcgtcatagagtgaggtt 359 Query: 426 cccgtgcatccagatcatcaagactgcgacggtggacttc-aagctgtgcaagagggaca 484 ||| ||||| |||||||||||||||||||| || || | ||||| |||||||| || | Sbjct: 360 cccttgcattcagatcatcaagactgcgactgt-ccctgcaaagctttgcaagagagaga 418 Query: 485 acacgaagcagttccacaactcgaagatcaagttccc 521 ||| ||||||||||| |||||||||||||||||||| Sbjct: 419 tcaccaagcagttccataactcgaagatcaagttccc 455
>gb|AY072540.1| Arabidopsis thaliana AT3g14600/MIE1_10 mRNA, complete cds Length = 829 Score = 256 bits (129), Expect = 1e-64 Identities = 332/397 (83%), Gaps = 2/397 (0%) Strand = Plus / Plus Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| || ||||||||| | |||||||| |||| | || || || ||||||| Sbjct: 111 cgatgagcaccctaagatctacaggatgaagctttggggtagaaatgaagtatgcgccaa 170 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 ||||||||||||||||||| ||||||| || |||||||||||||| |||||| ||||| Sbjct: 171 gtccaagttctggtacttcatgaggaaactgaagaaggtgaagaaaagcaacggacagat 230 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||| |||||||| ||||| || ||||||||||| || ||||||||||||||||| ||||| Sbjct: 231 gcttgccatcaatgagattttcgagaagaacccaacgaccatcaagaactacgggatctg 290 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 | |||| || |||||| | || || |||||||||||||||||||||||||| ||||| || Sbjct: 291 gttgcgttatcagagccgaactgggtaccacaacatgtacaaggagtaccgtgacacaac 350 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 425 || || || || ||||||||||||||||| |||||||| || || || | ||| | | Sbjct: 351 actcaatggtggagtggagcagatgtacactgagatggcttctcgtcatagagtgaggtt 410 Query: 426 cccgtgcatccagatcatcaagactgcgacggtggacttc-aagctgtgcaagagggaca 484 ||| ||||| |||||||||||||||||||| || || | ||||| |||||||| || | Sbjct: 411 cccttgcattcagatcatcaagactgcgactgt-ccctgcaaagctttgcaagagagaga 469 Query: 485 acacgaagcagttccacaactcgaagatcaagttccc 521 ||| ||||||||||| |||||||||||||||||||| Sbjct: 470 tcaccaagcagttccataactcgaagatcaagttccc 506
>emb|BX819594.1|CNS0A9TR Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB92ZG02 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 711 Score = 242 bits (122), Expect = 2e-60 Identities = 326/394 (82%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 97 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 156 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||| ||| |||||||||||||||||||||||||| || || ||||| Sbjct: 157 tccaagttctggtatttcttgaggaagctcaagaaggtgaagaagagtaatggaaagatg 216 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 ||||||||||||||||||| |||||||||||| || || |||||||||| ||| || ||| Sbjct: 217 ctcgccatcaacgagatctatgagaagaacccaacaacgatcaagaacttcggtatttgg 276 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | |||||||| || || || |||||||||||||||||||||||||| |||| ||| Sbjct: 277 ttgaggtaccagagtagaactgggtaccacaacatgtacaaggagtaccgttacaccact 336 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttcc 426 || ||||| | ||| ||||||||||| || |||||||| || || |||| || | | | Sbjct: 337 cttaacggtgctgttgagcagatgtatactgagatggcatcccgtcaccttgtaagattc 396 Query: 427 ccgtgcatccagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaac 486 || ||||| |||||||||||||| || || || ||||||||||||||| || | | Sbjct: 397 ccttgcattcagatcatcaagacagcaactgtcccagccaagctgtgcaagagagagagc 456 Query: 487 acgaagcagttccacaactcgaagatcaagttcc 520 || || |||||||||||| ||||||||||||| Sbjct: 457 actaaacagttccacaacagcaagatcaagttcc 490
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1 Length = 43261740 Score = 228 bits (115), Expect = 2e-56 Identities = 223/259 (86%) Strand = Plus / Minus Query: 274 aacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggttac 333 ||||| ||||| ||||||||||| |||||||||||||| ||||||||||| ||||||||| Sbjct: 27260428 aacccaaccacgatcaagaactatggcatctggctgcgttaccagagcagaaccggttac 27260369 Query: 334 cacaacatgtacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatgtac 393 ||||||||||||||||||||||| ||||| || |||| || | ||||| ||||||||| Sbjct: 27260368 cacaacatgtacaaggagtaccgtgacactacattgaatggtgccgtggaacagatgtac 27260309 Query: 394 acggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagactgcg 453 || |||||||| || || ||||| ||| | | ||| |||||||||||||||||||| || Sbjct: 27260308 accgagatggcttctcgccaccgtgtgagattcccttgcatccagatcatcaagaccgcc 27260249 Query: 454 acggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaagatc 513 || || |||||||||| ||||||||||||||||| ||||||||||||||| || ||| Sbjct: 27260248 actgtccacttcaagctctgcaagagggacaacaccaagcagttccacaacgggagcatc 27260189 Query: 514 aagttcccgctggtgtacc 532 |||||||| || ||||||| Sbjct: 27260188 aagttcccccttgtgtacc 27260170 Score = 182 bits (92), Expect = 1e-42 Identities = 227/272 (83%) Strand = Plus / Minus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 |||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||||| Sbjct: 31553090 agatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttaccaga 31553031 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 | ||||| || |||||||||||||||||||||||||| || || || || || || | | Sbjct: 31553030 gtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgccg 31552971 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 31552970 ttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattcaga 31552911 Query: 440 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 499 ||||||||||||| || || |||| || || |||||| | |||||||| |||||||||| Sbjct: 31552910 tcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagttcc 31552851 Query: 500 acaactcgaagatcaagttcccgctggtgtac 531 |||| || | ||||||||||| ||||||||| Sbjct: 31552850 acaagtcagatatcaagttcccactggtgtac 31552819 Score = 172 bits (87), Expect = 1e-39 Identities = 111/119 (93%) Strand = Plus / Minus Query: 81 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 140 |||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| Sbjct: 27261519 gttccatcagtaccaggtggtggggcgcgcgctgccgacccccggcgatgagcaccccaa 27261460 Query: 141 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 199 ||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||| Sbjct: 27261459 gatctaccggatgaagctctgggccaccaatgaggtccgcgccaagagcaagttctggt 27261401 Score = 149 bits (75), Expect = 2e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 81 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 140 |||||||||||||||||||||||| | | |||||||| ||| ||| ||||| ||||| Sbjct: 31553859 gttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccccaa 31553800 Query: 141 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 199 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 31553799 gatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctggt 31553741 Score = 105 bits (53), Expect = 2e-19 Identities = 62/65 (95%) Strand = Plus / Minus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 27261300 ggtacttcctgaggaagctgaagaaggtgaagaagagcaacggccagatgctcgccatca 27261241 Query: 257 acgag 261 ||||| Sbjct: 27261240 acgag 27261236 Score = 58.0 bits (29), Expect = 5e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 |||||||||| | ||||| ||||||||||||||| |||||| ||||| || ||||||| Sbjct: 31553647 ggtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatca 31553588 Query: 257 acgag 261 ||||| Sbjct: 31553587 acgag 31553583
>dbj|AP003760.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:OSJNBb0063G05 Length = 182681 Score = 228 bits (115), Expect = 2e-56 Identities = 223/259 (86%) Strand = Plus / Minus Query: 274 aacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggttac 333 ||||| ||||| ||||||||||| |||||||||||||| ||||||||||| ||||||||| Sbjct: 40945 aacccaaccacgatcaagaactatggcatctggctgcgttaccagagcagaaccggttac 40886 Query: 334 cacaacatgtacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatgtac 393 ||||||||||||||||||||||| ||||| || |||| || | ||||| ||||||||| Sbjct: 40885 cacaacatgtacaaggagtaccgtgacactacattgaatggtgccgtggaacagatgtac 40826 Query: 394 acggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagactgcg 453 || |||||||| || || ||||| ||| | | ||| |||||||||||||||||||| || Sbjct: 40825 accgagatggcttctcgccaccgtgtgagattcccttgcatccagatcatcaagaccgcc 40766 Query: 454 acggtggacttcaagctgtgcaagagggacaacacgaagcagttccacaactcgaagatc 513 || || |||||||||| ||||||||||||||||| ||||||||||||||| || ||| Sbjct: 40765 actgtccacttcaagctctgcaagagggacaacaccaagcagttccacaacgggagcatc 40706 Query: 514 aagttcccgctggtgtacc 532 |||||||| || ||||||| Sbjct: 40705 aagttcccccttgtgtacc 40687 Score = 172 bits (87), Expect = 1e-39 Identities = 111/119 (93%) Strand = Plus / Minus Query: 81 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 140 |||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| ||||| Sbjct: 42036 gttccatcagtaccaggtggtggggcgcgcgctgccgacccccggcgatgagcaccccaa 41977 Query: 141 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 199 ||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||||| Sbjct: 41976 gatctaccggatgaagctctgggccaccaatgaggtccgcgccaagagcaagttctggt 41918 Score = 105 bits (53), Expect = 2e-19 Identities = 62/65 (95%) Strand = Plus / Minus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 ||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||| Sbjct: 41817 ggtacttcctgaggaagctgaagaaggtgaagaagagcaacggccagatgctcgccatca 41758 Query: 257 acgag 261 ||||| Sbjct: 41757 acgag 41753
>gb|AY088351.1| Arabidopsis thaliana clone 5961 mRNA, complete sequence Length = 767 Score = 222 bits (112), Expect = 1e-54 Identities = 288/344 (83%), Gaps = 2/344 (0%) Strand = Plus / Plus Query: 179 gcgccaagtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacg 238 |||||||||||||||||||||||||| |||| || || |||||||||||||| ||||| Sbjct: 189 gcgccaagtccaagttctggtacttcatgagaaaactgaagaaggtgaagaaaagcaacg 248 Query: 239 gccagatgctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacg 298 | |||||||| |||||||| ||||| || ||||||||||| || || |||||||| |||| Sbjct: 249 ggcagatgcttgccatcaatgagattttcgagaagaacccaacgacaatcaagaattacg 308 Query: 299 gcatctggctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcg 358 | |||||| |||| || |||||| | || || |||||||||||||||||||||||||| | Sbjct: 309 ggatctggttgcgttatcagagccgaactgggtaccacaacatgtacaaggagtaccgtg 368 Query: 359 acacgactctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcg 418 |||| || || || || || ||||||||||||||||| ||||| || || || || | | Sbjct: 369 acacaacactcaatggtggagtggagcagatgtacactgagattgcttctcgtcatagag 428 Query: 419 tgcgttccccgtgcatccagatcatcaagactgcgacggtggacttc-aagctgtgcaag 477 || | | ||| ||||| |||||||||||||||||||| || || | ||||| |||||| Sbjct: 429 tgaggttcccttgcattcagatcatcaagactgcgactgt-ccctgcaaagctttgcaag 487 Query: 478 agggacaacacgaagcagttccacaactcgaagatcaagttccc 521 || || | ||| ||||||||||| |||||||||||||||||||| Sbjct: 488 agagagatcaccaagcagttccataactcgaagatcaagttccc 531
>gb|AY389632.1| Hyacinthus orientalis ribosomal protein L18A (RPL18) mRNA, complete cds Length = 710 Score = 214 bits (108), Expect = 4e-52 Identities = 403/501 (80%), Gaps = 2/501 (0%) Strand = Plus / Plus Query: 79 aggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagccc 138 ||||| || ||||| ||||| ||||| || || ||||| ||||| ||||||||| || Sbjct: 19 aggtttcatcagtatcaggttgtgggccgggcactgccaaccccctccgatgagcacccg 78 Query: 139 aagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctgg 198 ||||||| |||||||||||| ||||| |||||||| || || |||||||||||||| ||| Sbjct: 79 aagatcttccgcatgaagctttgggcaaccaacgaagttcgggccaagtccaagttttgg 138 Query: 199 tacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatcaac 258 || |||||||||||||| ||||| ||||||||| || ||||| | || || |||||| Sbjct: 139 tatttcctgaggaagctgaagaaagtgaagaagagtaatggccaagttcttgctatcaac 198 Query: 259 gagatctttgagaagaacccgaccaccatca-agaactacggcatctggctgcgctacca 317 ||||| |||||||||||||| |||| || | ||||||||||||| |||||| | ||||| Sbjct: 199 gagatatttgagaagaaccccaccaaaataatagaactacggcatatggctgaggtacca 258 Query: 318 gagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcgg 377 |||||| ||||| || || ||||||||||||||||| | ||||| || ||||| || || Sbjct: 259 gagcagaaccggctatca-tacatgtacaaggagtacagggacaccaccctgaatggagg 317 Query: 378 tgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatcca 437 ||||||||||||||||| || ||||| || || ||| | || | | ||| |||||||| Sbjct: 318 agtggagcagatgtacactgaaatggcatcacgccacagggttaggttcccatgcatcca 377 Query: 438 gatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagtt 497 |||||||||||| || || | | |||||| |||||| | || | ||| |||||||| Sbjct: 378 gatcatcaagacggccaccatccccgccaagctctgcaagcgcgagagcaccaagcagtt 437 Query: 498 ccacaactcgaagatcaagttcccgctggtgtaccagaaggtgcgnnnnnnnacccgcaa 557 ||| ||||||||||||| ||||| || |||| | ||||||| || ||| | || Sbjct: 438 ccatgactcgaagatcaaattccccctcgtgttcaagaaggtccggccgcccaccaggaa 497 Query: 558 gctcaagaccacctacaaggc 578 |||||||||||||| |||||| Sbjct: 498 gctcaagaccaccttcaaggc 518
>gb|DQ235171.1| Solanum tuberosum clone 155B02 unknown mRNA Length = 722 Score = 196 bits (99), Expect = 8e-47 Identities = 234/279 (83%) Strand = Plus / Plus Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| || ||||| ||||| ||||| |||||||| || || |||||||| ||||| Sbjct: 78 cgatgagcacccaaagatttaccgtatgaaactctgggctacaaatgaggtccgtgccaa 137 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 ||||||||||||||||||| |||||||||| ||||||||||||||| ||| || ||||| Sbjct: 138 gtccaagttctggtacttcttgaggaagctaaagaaggtgaagaagagcaatggtcagat 197 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||| || ||||| ||||| |||||||| |||| || | ||||||||||| || || || Sbjct: 198 gctagctatcaatgagatttttgagaaatacccaacaaaaatcaagaactatggtatttg 257 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 |||||| ||||| || ||||| || || || |||||||||||||||||||| ||||| || Sbjct: 258 gctgcgttaccaaagtaggactgggtatcataacatgtacaaggagtaccgtgacaccac 317 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggc 404 |||| || ||||| || ||||||||||| || ||||| Sbjct: 318 attgaatggtggtgtagaacagatgtacactgaaatggc 356 Score = 48.1 bits (24), Expect = 0.048 Identities = 54/64 (84%) Strand = Plus / Plus Query: 466 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctg 525 ||||| |||||| |||| | ||| ||||||||||| |||| || |||||||||||| || Sbjct: 418 aagctctgcaagcgggagagcacaaagcagttccatgactccaaaatcaagttcccgttg 477 Query: 526 gtgt 529 |||| Sbjct: 478 gtgt 481
>gb|DQ200390.1| Solanum tuberosum clone 067G06 unknown mRNA Length = 779 Score = 186 bits (94), Expect = 8e-44 Identities = 232/278 (83%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||||||| |||||||| || || |||||| | ||||| || || || || || || ||| Sbjct: 79 gatgagcatcccaagatttatcgtatgaagttgtgggctacaaatgaagttcgtgctaag 138 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 ||||| |||||||| ||| |||||||||| ||||||||||||||| |||||| |||||| Sbjct: 139 tccaaattctggtatttcttgaggaagcttaagaaggtgaagaagagcaacggtcagatg 198 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 || || || || |||||||| ||||||||||| || || |||||||| || || || ||| Sbjct: 199 ctggctattaatgagatcttcgagaagaacccaacaacaatcaagaattatggtatttgg 258 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || || ||||| || || || || |||||||||||||||||||||||||| ||||| || Sbjct: 259 ctccgttaccaaagtagaactggataccacaacatgtacaaggagtaccgtgacaccaca 318 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggc 404 |||| || |||||||||||||||||||| |||||||| Sbjct: 319 ttgaatggtggtgtggagcagatgtacactgagatggc 356 Score = 71.9 bits (36), Expect = 3e-09 Identities = 57/64 (89%) Strand = Plus / Plus Query: 466 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctg 525 ||||||||||||||||| | ||| ||||||||||| |||| ||||||||||||||| || Sbjct: 418 aagctgtgcaagagggagagcactaagcagttccatgactccaagatcaagttcccgttg 477 Query: 526 gtgt 529 |||| Sbjct: 478 gtgt 481
>dbj|AP003249.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0435B05 Length = 150997 Score = 182 bits (92), Expect = 1e-42 Identities = 227/272 (83%) Strand = Plus / Minus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 |||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||||| Sbjct: 66113 agatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttaccaga 66054 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 | ||||| || |||||||||||||||||||||||||| || || || || || || | | Sbjct: 66053 gtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgccg 65994 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 65993 ttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattcaga 65934 Query: 440 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 499 ||||||||||||| || || |||| || || |||||| | |||||||| |||||||||| Sbjct: 65933 tcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagttcc 65874 Query: 500 acaactcgaagatcaagttcccgctggtgtac 531 |||| || | ||||||||||| ||||||||| Sbjct: 65873 acaagtcagatatcaagttcccactggtgtac 65842 Score = 149 bits (75), Expect = 2e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 81 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 140 |||||||||||||||||||||||| | | |||||||| ||| ||| ||||| ||||| Sbjct: 66882 gttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccccaa 66823 Query: 141 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 199 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 66822 gatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctggt 66764 Score = 58.0 bits (29), Expect = 5e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 |||||||||| | ||||| ||||||||||||||| |||||| ||||| || ||||||| Sbjct: 66670 ggtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatca 66611 Query: 257 acgag 261 ||||| Sbjct: 66610 acgag 66606
>dbj|AP003237.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0046E05 Length = 162776 Score = 182 bits (92), Expect = 1e-42 Identities = 227/272 (83%) Strand = Plus / Minus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 |||| |||||||||||||| || || ||||||||||| |||||||||||||| ||||||| Sbjct: 147154 agatttttgagaagaacccaacaactatcaagaactatggcatctggctgcgttaccaga 147095 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 | ||||| || |||||||||||||||||||||||||| || || || || || || | | Sbjct: 147094 gtaggactggctaccacaacatgtacaaggagtaccgtgataccaccctcaatggtgccg 147035 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 147034 ttgagcagatgtacactgagatggcttcccgccaccgtgtcagattcccttgcattcaga 146975 Query: 440 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 499 ||||||||||||| || || |||| || || |||||| | |||||||| |||||||||| Sbjct: 146974 tcatcaagactgctactgtccactttaaactctgcaagcgtgacaacactaagcagttcc 146915 Query: 500 acaactcgaagatcaagttcccgctggtgtac 531 |||| || | ||||||||||| ||||||||| Sbjct: 146914 acaagtcagatatcaagttcccactggtgtac 146883 Score = 149 bits (75), Expect = 2e-32 Identities = 108/119 (90%) Strand = Plus / Minus Query: 81 gttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagcccaa 140 |||||||||||||||||||||||| | | |||||||| ||| ||| ||||| ||||| Sbjct: 147923 gttccaccagtaccaggtggtggggaggggcctgccgacgccgaccgacgagcaccccaa 147864 Query: 141 gatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 199 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct: 147863 gatctaccgcatgaagctctgggctaccaacgaggtccgcgccaagtccaagttctggt 147805 Score = 58.0 bits (29), Expect = 5e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 |||||||||| | ||||| ||||||||||||||| |||||| ||||| || ||||||| Sbjct: 147711 ggtacttcctccgcaagctgaagaaggtgaagaagagcaacgggcagatccttgccatca 147652 Query: 257 acgag 261 ||||| Sbjct: 147651 acgag 147647
>gb|DQ235168.1| Solanum tuberosum clone 154B10 unknown mRNA Length = 904 Score = 180 bits (91), Expect = 5e-42 Identities = 232/279 (83%) Strand = Plus / Plus Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 |||||| || || |||||||| |||||||| || ||||| ||||| |||||||| || || Sbjct: 105 cgatgaacacccaaagatctatcgcatgaaactttgggctaccaatgaggtccgtgcgaa 164 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 ||||||||||||||||| |||||||||| |||||||| |||||| |||||| ||||| Sbjct: 165 atccaagttctggtactttttgaggaagctgaagaaggttaagaagagcaacgggcagat 224 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||| || || || ||||||||||||||| |||| || | ||||||||||||||||| || Sbjct: 225 gcttgctattaatgagatctttgagaagtaccctactaaaatcaagaactacggcatttg 284 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 | |||| || ||||| | || || |||||||||||||||||||||||||| || || || Sbjct: 285 gttgcgttatcagagtcgcactgggtaccacaacatgtacaaggagtaccgtgataccac 344 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggc 404 |||| || | ||| || ||||||||||| |||||||| Sbjct: 345 attgaatggagctgtagaacagatgtacacagagatggc 383 Score = 50.1 bits (25), Expect = 0.012 Identities = 46/53 (86%) Strand = Plus / Plus Query: 469 ctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttccc 521 |||||||||||||| | ||| ||||||||||| |||| || ||||||||||| Sbjct: 448 ctgtgcaagagggagagcaccaagcagttccatgactccaaaatcaagttccc 500
>ref|NM_179398.1| Arabidopsis thaliana structural constituent of ribosome (AT1G29965) mRNA, complete cds Length = 774 Score = 176 bits (89), Expect = 8e-41 Identities = 233/281 (82%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 150 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 209 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||||| | | |||| || ||||||||||||||| || || |||||| Sbjct: 210 tccaagttctggtactacttaaggaggcaaaagaaggtgaagaagagtaatggacagatg 269 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 || ||||||||||||||||||||||||||||| || || |||||||| | || |||||| Sbjct: 270 ctagccatcaacgagatctttgagaagaacccaacaacgatcaagaattttggaatctgg 329 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | ||||||||| | || |||||||| ||||||||||| |||||||| ||||| ||| Sbjct: 330 ttgagataccagagccgtacaggttaccataacatgtacaaagagtaccgtgacactact 389 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtc 407 |||| || | |||||||| |||||||| ||||||||||| Sbjct: 390 ttgaatggagcagtggagcaaatgtacactgagatggcgtc 430 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 472 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 527 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 495 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 550
>gb|BT000059.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative (At1g29970) mRNA, complete cds Length = 633 Score = 176 bits (89), Expect = 8e-41 Identities = 233/281 (82%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 61 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 120 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||||| | | |||| || ||||||||||||||| || || |||||| Sbjct: 121 tccaagttctggtactacttaaggaggcaaaagaaggtgaagaagagtaatggacagatg 180 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 || ||||||||||||||||||||||||||||| || || |||||||| | || |||||| Sbjct: 181 ctagccatcaacgagatctttgagaagaacccaacaacgatcaagaattttggaatctgg 240 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | ||||||||| | || |||||||| ||||||||||| |||||||| ||||| ||| Sbjct: 241 ttgagataccagagccgtacaggttaccataacatgtacaaagagtaccgtgacactact 300 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtc 407 |||| || | |||||||| |||||||| ||||||||||| Sbjct: 301 ttgaatggagcagtggagcaaatgtacactgagatggcgtc 341 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 472 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 527 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 406 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 461
>gb|AY128411.1| Arabidopsis thaliana 60S ribosomal protein L18A, putative (At1g29970) mRNA, complete cds Length = 758 Score = 176 bits (89), Expect = 8e-41 Identities = 233/281 (82%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 138 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 197 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||||| | | |||| || ||||||||||||||| || || |||||| Sbjct: 198 tccaagttctggtactacttaaggaggcaaaagaaggtgaagaagagtaatggacagatg 257 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 || ||||||||||||||||||||||||||||| || || |||||||| | || |||||| Sbjct: 258 ctagccatcaacgagatctttgagaagaacccaacaacgatcaagaattttggaatctgg 317 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | ||||||||| | || |||||||| ||||||||||| |||||||| ||||| ||| Sbjct: 318 ttgagataccagagccgtacaggttaccataacatgtacaaagagtaccgtgacactact 377 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtc 407 |||| || | |||||||| |||||||| ||||||||||| Sbjct: 378 ttgaatggagcagtggagcaaatgtacactgagatggcgtc 418 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 472 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 527 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 483 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 538
>emb|BX816320.1|CNS0AD9L Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH40ZG05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1162 Score = 176 bits (89), Expect = 8e-41 Identities = 233/281 (82%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 579 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 638 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||||||||||| | | |||| || ||||||||||||||| || || |||||| Sbjct: 639 tccaagttctggtactacttaaggaggcaaaagaaggtgaagaagagtaatggacagatg 698 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 || ||||||||||||||||||||||||||||| || || |||||||| | || |||||| Sbjct: 699 ctagccatcaacgagatctttgagaagaacccaacaacgatcaagaattttggaatctgg 758 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgact 366 || | ||||||||| | || |||||||| ||||||||||| |||||||| ||||| ||| Sbjct: 759 ttgagataccagagccgtacaggttaccataacatgtacaaagagtaccgtgacactact 818 Query: 367 ctgaacggcggtgtggagcagatgtacacggagatggcgtc 407 |||| || | |||||||| |||||||| ||||||||||| Sbjct: 819 ttgaatggagcagtggagcaaatgtacactgagatggcgtc 859 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Plus Query: 472 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 527 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 924 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 979
>gb|BT014521.1| Lycopersicon esculentum clone 133914F, mRNA sequence Length = 810 Score = 167 bits (84), Expect = 8e-38 Identities = 264/324 (81%) Strand = Plus / Plus Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| || ||||| ||||| ||||| |||||||| || || |||||||| || || Sbjct: 96 cgatgagcatccaaagatttaccgtatgaaactctgggctacgaatgaggtccgtgctaa 155 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 ||||||||| ||||||||| |||||||||| ||||||||||||||| ||| || ||||| Sbjct: 156 gtccaagttttggtacttcttgaggaagctaaagaaggtgaagaagagcaatggtcagat 215 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 ||| || || || ||||| |||||||| |||| || | ||||||||||| || || || Sbjct: 216 gctagctattaatgagatttttgagaaatacccaacaaaaatcaagaactatggtatttg 275 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 |||||| ||||| || ||||| || || || |||||||||||||||||||| || || || Sbjct: 276 gctgcgttaccaaagtaggactgggtatcataacatgtacaaggagtaccgtgatacaac 335 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttc 425 |||| || ||||| || ||||||||||| || ||||| || || ||| | || ||| Sbjct: 336 attgaatggtggtgtagaacagatgtacactgaaatggcttctcgccacagggtccgtca 395 Query: 426 cccgtgcatccagatcatcaagac 449 | |||||||||||||||||||| Sbjct: 396 tcactgcatccagatcatcaagac 419 Score = 56.0 bits (28), Expect = 2e-04 Identities = 55/64 (85%) Strand = Plus / Plus Query: 466 aagctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctg 525 ||||| |||||| |||| | ||| |||||||||||| |||| || |||||||||||| || Sbjct: 436 aagctctgcaagcgggagagcacaaagcagttccacgactccaaaatcaagttcccgttg 495 Query: 526 gtgt 529 |||| Sbjct: 496 gtgt 499
>dbj|AB023038.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MIE1 Length = 84462 Score = 165 bits (83), Expect = 3e-37 Identities = 214/255 (83%), Gaps = 2/255 (0%) Strand = Plus / Plus Query: 268 gagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggacc 327 ||||||||||| || ||||||||||||||||| |||||| |||| || |||||| | || Sbjct: 39558 gagaagaacccaacgaccatcaagaactacgggatctggttgcgttatcagagccgaact 39617 Query: 328 ggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtgtggagcag 387 || |||||||||||||||||||||||||| ||||| || || || || || ||||||||| Sbjct: 39618 gggtaccacaacatgtacaaggagtaccgtgacacaacactcaatggtggagtggagcag 39677 Query: 388 atgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaag 447 |||||||| |||||||| || || || | ||| | | ||| ||||| |||||||||||| Sbjct: 39678 atgtacactgagatggcttctcgtcatagagtgaggttcccttgcattcagatcatcaag 39737 Query: 448 actgcgacggtggacttc-aagctgtgcaagagggacaacacgaagcagttccacaactc 506 |||||||| || || | ||||| |||||||| || | ||| ||||||||||| ||||| Sbjct: 39738 actgcgactgt-ccctgcaaagctttgcaagagagagatcaccaagcagttccataactc 39796 Query: 507 gaagatcaagttccc 521 ||||||||||||||| Sbjct: 39797 gaagatcaagttccc 39811 Score = 58.0 bits (29), Expect = 5e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 |||||||| ||||||| || |||||||||||||| |||||| |||||||| ||||||| Sbjct: 39402 ggtacttcatgaggaaactgaagaaggtgaagaaaagcaacggacagatgcttgccatca 39461 Query: 257 a 257 | Sbjct: 39462 a 39462 Score = 44.1 bits (22), Expect = 0.76 Identities = 61/74 (82%) Strand = Plus / Plus Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| || ||||||||| | |||||||| |||| | || || || ||||||| Sbjct: 39237 cgatgagcaccctaagatctacaggatgaagctttggggtagaaatgaagtatgcgccaa 39296 Query: 186 gtccaagttctggt 199 |||||||||||||| Sbjct: 39297 gtccaagttctggt 39310
>gb|AC189366.1| Brassica rapa subsp. pekinensis clone KBrB046G20, complete sequence Length = 137227 Score = 163 bits (82), Expect = 1e-36 Identities = 163/190 (85%) Strand = Plus / Minus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 |||||||||||||||||||||| || ||||| |||| || ||||||||| | ||||||| Sbjct: 95303 agatctttgagaagaacccgacgacgatcaataactttggaatctggctgaggtaccaga 95244 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 || | || ||||||||||||||||||||||||| ||| ||||| ||| ||||||| | | Sbjct: 95243 gccgtacaggttaccacaacatgtacaaggagttccgtgacactactttgaacggagcag 95184 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 |||||||||||||||| |||||||||||| ||||| | || | | ||| |||||||||| Sbjct: 95183 tggagcagatgtacaccgagatggcgtcgaggcacagagtcaggttcccttgcatccaga 95124 Query: 440 tcatcaagac 449 |||||||||| Sbjct: 95123 tcatcaagac 95114 Score = 67.9 bits (34), Expect = 5e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 151 atgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggta 200 ||||||||||||||||| |||||||| || |||| ||||||||||||||| Sbjct: 95645 atgaagctctgggccacgaacgaggttcgtgccatgtccaagttctggta 95596 Score = 44.1 bits (22), Expect = 0.76 Identities = 40/46 (86%) Strand = Plus / Minus Query: 556 aagctcaagaccacctacaaggccacaaggcccaacctcttcatgt 601 ||||||||||| |||||||||||| | | ||||||| | ||||||| Sbjct: 95007 aagctcaagactacctacaaggcctctaagcccaacttgttcatgt 94962
>gb|AC189655.1| Brassica rapa subsp. pekinensis clone KBrS012M03, complete sequence Length = 107479 Score = 145 bits (73), Expect = 3e-31 Identities = 127/145 (87%) Strand = Plus / Minus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 |||||||||||||||||||||| ||||||||||||| ||| |||||| || | ||||||| Sbjct: 178 agatctttgagaagaacccgacaaccatcaagaacttcggaatctggttgaggtaccaga 119 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 |||| || || |||||||||||||||||||||||||| ||||| || ||||||| | | Sbjct: 118 gcagaactggataccacaacatgtacaaggagtaccgtgacactaccttgaacggagccg 59 Query: 380 tggagcagatgtacacggagatggc 404 | |||||||||||||| |||||||| Sbjct: 58 ttgagcagatgtacactgagatggc 34 Score = 87.7 bits (44), Expect = 6e-14 Identities = 59/64 (92%) Strand = Plus / Minus Query: 136 cccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttc 195 |||||||| ||| | |||||||||||||||||||||||||| || ||||||||||||||| Sbjct: 728 cccaagatttacaggatgaagctctgggccaccaacgaggttcgtgccaagtccaagttc 669 Query: 196 tggt 199 |||| Sbjct: 668 tggt 665 Score = 58.0 bits (29), Expect = 5e-05 Identities = 56/65 (86%) Strand = Plus / Minus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 |||||||| |||||||||| |||||||| |||||| || || |||||||||||||| | Sbjct: 580 ggtacttcttgaggaagctgaagaaggtcaagaagagtaatggtcagatgctcgccatta 521 Query: 257 acgag 261 ||||| Sbjct: 520 acgag 516
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 139 bits (70), Expect = 2e-29 Identities = 214/262 (81%) Strand = Plus / Minus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 |||||| |||||||||||| || || |||||||||| ||| || ||| || | ||||||| Sbjct: 103746 agatctatgagaagaacccaacaacgatcaagaacttcggtatttggttgaggtaccaga 103687 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 | || || || |||||||||||||||||||||||||| ||||| ||||| ||||| | || Sbjct: 103686 gtagaactgggtaccacaacatgtacaaggagtaccgtgacaccactcttaacggagctg 103627 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 103626 ttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattcccttgcattcaga 103567 Query: 440 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 499 |||||||||| || || || ||||||||||||||| || | ||| || ||||||| Sbjct: 103566 tcatcaagacagccactgtcccagccaagctgtgcaagagagagagcactaaacagttcc 103507 Query: 500 acaactcgaagatcaagttccc 521 ||||| |||||||||||||| Sbjct: 103506 acaacagcaagatcaagttccc 103485 Score = 73.8 bits (37), Expect = 8e-10 Identities = 58/65 (89%) Strand = Plus / Minus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 |||| ||| |||||||||||||||||||||||||| || || |||||||||||||||| Sbjct: 104312 ggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatgctcgccatca 104253 Query: 257 acgag 261 ||||| Sbjct: 104252 acgag 104248 Score = 73.8 bits (37), Expect = 8e-10 Identities = 64/73 (87%) Strand = Plus / Minus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 104480 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 104421 Query: 187 tccaagttctggt 199 ||||||||||||| Sbjct: 104420 tccaagttctggt 104408
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 139 bits (70), Expect = 2e-29 Identities = 214/262 (81%) Strand = Plus / Plus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 |||||| |||||||||||| || || |||||||||| ||| || ||| || | ||||||| Sbjct: 70456 agatctatgagaagaacccaacaacgatcaagaacttcggtatttggttgaggtaccaga 70515 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 | || || || |||||||||||||||||||||||||| ||||| ||||| ||||| | || Sbjct: 70516 gtagaactgggtaccacaacatgtacaaggagtaccgtgacaccactcttaacggagctg 70575 Query: 380 tggagcagatgtacacggagatggcgtcgcggcaccgcgtgcgttccccgtgcatccaga 439 | |||||||||||||| |||||||| || || ||||| || | | ||| ||||| |||| Sbjct: 70576 ttgagcagatgtacactgagatggcatcccgtcaccgtgtcagattcccttgcattcaga 70635 Query: 440 tcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcagttcc 499 |||||||||| || || || ||||||||||||||| || | ||| || ||||||| Sbjct: 70636 tcatcaagacagccactgtcccagccaagctgtgcaagagagagagcactaaacagttcc 70695 Query: 500 acaactcgaagatcaagttccc 521 ||||| |||||||||||||| Sbjct: 70696 acaacagcaagatcaagttccc 70717 Score = 73.8 bits (37), Expect = 8e-10 Identities = 64/73 (87%) Strand = Plus / Plus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||| |||||| ||||| ||| | |||||||||||||| || |||||||| || |||||| Sbjct: 69722 gatgtgcagcctaagatttacaggatgaagctctgggctacgaacgaggttcgtgccaag 69781 Query: 187 tccaagttctggt 199 ||||||||||||| Sbjct: 69782 tccaagttctggt 69794 Score = 73.8 bits (37), Expect = 8e-10 Identities = 58/65 (89%) Strand = Plus / Plus Query: 197 ggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgccatca 256 |||| ||| |||||||||||||||||||||||||| || || |||||||||||||||| Sbjct: 69890 ggtatttcttgaggaagctcaagaaggtgaagaagagtaatggacagatgctcgccatca 69949 Query: 257 acgag 261 ||||| Sbjct: 69950 acgag 69954
>gb|DQ226673.1| Boechera divaricarpa isolate SLW-348-443-C10 mRNA sequence Length = 312 Score = 137 bits (69), Expect = 7e-29 Identities = 180/217 (82%) Strand = Plus / Minus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||||||| || ||||||||| | |||||||| |||| ||| || || || |||||||| Sbjct: 217 gatgagcaccctaagatctacaggatgaagctatggggcacaaatgaagtatgcgccaag 158 Query: 187 tccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatg 246 |||||||| ||||| ||| ||||||| || |||||||||||||| ||| || |||||| Sbjct: 157 tccaagttttggtatttcatgaggaaactgaagaaggtgaagaaaagcaatgggcagatg 98 Query: 247 ctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 || |||||||| ||||| || |||||||||||||| || |||||||| || || |||||| Sbjct: 97 cttgccatcaatgagattttcgagaagaacccgacgacaatcaagaattatggtatctgg 38 Query: 307 ctgcgctaccagagcaggaccggttaccacaacatgt 343 ||||| || |||||| | || || ||||| ||||||| Sbjct: 37 ctgcgttatcagagccgaactggataccataacatgt 1
>dbj|AK110262.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-163-B05, full insert sequence Length = 885 Score = 125 bits (63), Expect = 3e-25 Identities = 186/227 (81%) Strand = Plus / Plus Query: 223 gtgaagaaggccaacggccagatgctcgccatcaacgagatctttgagaagaacccgacc 282 ||||||||||||||||||||||| |||| | |||||||| |||||| || || || Sbjct: 205 gtgaagaaggccaacggccagatcatcgcagtgaacgagatttttgagcgcaagcccaca 264 Query: 283 accatcaagaactacggcatctggctgcgctaccagagcaggaccggttaccacaacatg 342 || | ||||||| ||||||||| ||||||||||| | || || |||||||||||| Sbjct: 265 actgtgaagaactttggcatctgggtgcgctaccagtcacgcacaggctaccacaacatg 324 Query: 343 tacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatgtacacggagatg 402 |||||||||||||| ||||| || || ||||| | ||||| |||||||||| |||||| Sbjct: 325 tacaaggagtaccgtgacaccaccctcaacggtgcagtggaccagatgtacagcgagatg 384 Query: 403 gcgtcgcggcaccgcgtgcgttccccgtgcatccagatcatcaagac 449 || || || ||||||||||| | ||| |||||||||||||||||||| Sbjct: 385 gcatcacgccaccgcgtgcgcttcccttgcatccagatcatcaagac 431
>gb|AF334839.1| Castanea sativa ribosomal protein L18a mRNA, complete cds Length = 775 Score = 109 bits (55), Expect = 2e-20 Identities = 223/279 (79%) Strand = Plus / Plus Query: 126 cgatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaa 185 ||||||||| || ||||| || | ||||| || ||||| || || |||||||| ||||| Sbjct: 143 cgatgagcatccaaagatttataggatgaaactttgggctacaaatgaggtccgtgccaa 202 Query: 186 gtccaagttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagat 245 ||| |||||||||||||| |||||||||| ||||| || |||||| ||| || ||||| Sbjct: 203 gtcgaagttctggtactttttgaggaagctgaagaaagttaagaagagcaatgggcagat 262 Query: 246 gctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctg 305 | | || ||||| ||||| ||||||||||| || || | || ||||| || || ||||| Sbjct: 263 gttagctatcaatgagatttttgagaagaatcctacaaagattaagaattatggtatctg 322 Query: 306 gctgcgctaccagagcaggaccggttaccacaacatgtacaaggagtaccgcgacacgac 365 |||||| || || ||| | || || || ||||||||||| |||||||| || ||||| || Sbjct: 323 gctgcggtatcaaagccgaactgggtatcacaacatgtataaggagtatcgagacaccac 382 Query: 366 tctgaacggcggtgtggagcagatgtacacggagatggc 404 ||| || || | |||||| || ||||||| |||||||| Sbjct: 383 tctaaatggtgctgtggaacaaatgtacattgagatggc 421 Score = 48.1 bits (24), Expect = 0.048 Identities = 48/56 (85%) Strand = Plus / Plus Query: 472 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 527 ||||||||||| | | | |||||||||||||| || || ||||||||||| ||||| Sbjct: 489 tgcaagagggagagctctaagcagttccacaattccaaaatcaagttccctctggt 544
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 103 bits (52), Expect = 9e-19 Identities = 124/148 (83%) Strand = Plus / Minus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 ||||||||||||||||||| || || |||||||| | || |||||| || | ||||||| Sbjct: 20677 agatctttgagaagaacccaacaacgatcaagaattttggaatctggttgagataccaga 20618 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 || | || |||||||| ||||||||||| |||||||| ||||| ||| |||| || | | Sbjct: 20617 gccgtacaggttaccataacatgtacaaagagtaccgtgacactactttgaatggagcag 20558 Query: 380 tggagcagatgtacacggagatggcgtc 407 ||||||| |||||||| ||||||||||| Sbjct: 20557 tggagcaaatgtacactgagatggcgtc 20530 Score = 56.0 bits (28), Expect = 2e-04 Identities = 49/56 (87%) Strand = Plus / Minus Query: 472 tgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggt 527 ||||||||||| | |||||||||||| |||||| ||||||||||||||| |||| Sbjct: 20465 tgcaagagggaaagcacgaagcagtttcacaacagcaagatcaagttcccgttggt 20410 Score = 50.1 bits (25), Expect = 0.012 Identities = 61/73 (83%) Strand = Plus / Minus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 |||||||| || ||||| ||| | |||||||| ||||| || |||||||| | ||||| Sbjct: 21075 gatgagcaaccaaagatttacaggatgaagctatgggcaacgaacgaggttcttgccaaa 21016 Query: 187 tccaagttctggt 199 ||||||||||||| Sbjct: 21015 tccaagttctggt 21003 Score = 42.1 bits (21), Expect = 3.0 Identities = 39/45 (86%) Strand = Plus / Minus Query: 217 aagaaggtgaagaaggccaacggccagatgctcgccatcaacgag 261 ||||||||||||||| || || |||||||| |||||||||||| Sbjct: 20890 aagaaggtgaagaagagtaatggacagatgctagccatcaacgag 20846
>gb|BT016634.1| Zea mays clone Contig467 mRNA sequence Length = 859 Score = 95.6 bits (48), Expect = 2e-16 Identities = 118/140 (84%), Gaps = 1/140 (0%) Strand = Plus / Minus Query: 80 ggttccaccagtaccaggtggtgggtcgcgcgctgccgaccccgggcgatgagcagccca 139 ||||||| |||||||||| | ||||||||||||||| ||| | |||||||| |||| Sbjct: 817 ggttccatcagtaccaggcagcgggtcgcgcgctgccagtccccgctgatgagcacccca 758 Query: 140 agatctaccgcatgaagctctgggccaccaacgaggtccgcgccaagtccaagttctggt 199 |||||||||||||| |||| || || |||||||||||| || |||| ||||| |||||| Sbjct: 757 agatctaccgcatggagct-tgcgctaccaacgaggtctgctccaaatccaatctctggt 699 Query: 200 acttcctgaggaagctcaag 219 ||| ||||||||||||||| Sbjct: 698 actatctgaggaagctcaag 679 Score = 85.7 bits (43), Expect = 2e-13 Identities = 103/123 (83%) Strand = Plus / Minus Query: 234 caacggccagatgctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaa 293 |||||| ||||| |||||||| ||||||| |||||| ||||| || || |||||||| Sbjct: 659 caacggtcagattctcgccatagacgagatatttgagtgtaaccctacaacaatcaagaa 600 Query: 294 ctacggcatctggctgcgctaccagagcaggaccggttaccacaacatgtacaaggagta 353 || |||||||||||| | |||||| ||||||| ||||||||| || || |||||||||| Sbjct: 599 ctgtggcatctggctgtgttaccagtgcaggacaggttaccacgacctgcacaaggagta 540 Query: 354 ccg 356 ||| Sbjct: 539 ccg 537 Score = 69.9 bits (35), Expect = 1e-08 Identities = 71/83 (85%) Strand = Plus / Minus Query: 436 cagatcatcaagactgcgacggtggacttcaagctgtgcaagagggacaacacgaagcag 495 |||||||||||||| || || | |||| ||||| ||||||||||||||||| |||||| Sbjct: 459 cagatcatcaagacggcaacaatcaactttaagctttgcaagagggacaacaccaagcag 400 Query: 496 ttccacaactcgaagatcaagtt 518 |||||||| || ||| ||||||| Sbjct: 399 ttccacaattcaaagttcaagtt 377
>emb|BX820914.1|CNS0A9IE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH81ZB06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 705 Score = 87.7 bits (44), Expect = 6e-14 Identities = 99/116 (85%), Gaps = 1/116 (0%) Strand = Plus / Plus Query: 181 gccaagtccaagttctggtacttcctgaggaagctcaagaaggtgaaga-aggccaacgg 239 ||||| ||||| |||||||| ||| ||||||| |||||||||||||||| || || || Sbjct: 101 gccaaatccaatttctggtatttcttgaggaaactcaagaaggtgaagacagagtaatgg 160 Query: 240 ccagatgctcgccatcaacgagatctttgagaagaacccgaccaccatcaagaact 295 |||||||||||||||||| |||||| |||||||||||| || || ||||| |||| Sbjct: 161 acagatgctcgccatcaacaagatctatgagaagaacccaacaacgatcaataact 216 Score = 75.8 bits (38), Expect = 2e-10 Identities = 65/74 (87%) Strand = Plus / Plus Query: 331 taccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatg 390 |||||||||||||||||||||||||| ||||| ||||| ||| | | ||| || |||||| Sbjct: 252 taccacaacatgtacaaggagtaccgtgacaccactcttaacagagctgttgaacagatg 311 Query: 391 tacacggagatggc 404 ||||| |||||||| Sbjct: 312 tacactgagatggc 325
>gb|AF548319.1| Branchiostoma belcheri ribosomal protein L18a mRNA, complete cds Length = 616 Score = 75.8 bits (38), Expect = 2e-10 Identities = 77/90 (85%) Strand = Plus / Plus Query: 271 aagaacccgaccaccatcaagaactacggcatctggctgcgctaccagagcaggaccggt 330 |||||||| || | ||||||||||||||||||||||||||||||| | ||| | ||| Sbjct: 222 aagaaccccacgagcatcaagaactacggcatctggctgcgctacgactccagaagcgga 281 Query: 331 taccacaacatgtacaaggagtaccgcgac 360 |||||||||||||| ||||||||||||| Sbjct: 282 acccacaacatgtacagggagtaccgcgac 311
>gb|AC146330.33| Medicago truncatula clone mth2-7g7, complete sequence Length = 117139 Score = 67.9 bits (34), Expect = 5e-08 Identities = 64/74 (86%) Strand = Plus / Minus Query: 127 gatgagcagcccaagatctaccgcatgaagctctgggccaccaacgaggtccgcgccaag 186 ||||| || |||||||| || |||||||| || ||||| ||||||||||| || ||||| Sbjct: 20650 gatgaacatcccaagatttatcgcatgaaactttgggcaaccaacgaggttcgtgccaaa 20591 Query: 187 tccaagttctggta 200 |||||||||||||| Sbjct: 20590 tccaagttctggta 20577 Score = 65.9 bits (33), Expect = 2e-07 Identities = 102/125 (81%) Strand = Plus / Minus Query: 260 agatctttgagaagaacccgaccaccatcaagaactacggcatctggctgcgctaccaga 319 ||||||||||||| || || |||| || ||||||||||| || |||||||| || |||| Sbjct: 19813 agatctttgagaaaaatcctaccaagattaagaactacggaatttggctgcgttatcaga 19754 Query: 320 gcaggaccggttaccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtg 379 | | || ||||| ||||| ||||||||||| ||||| || || ||||| ||||| | || Sbjct: 19753 gtcgtactggttatcacaatatgtacaaggaataccgtgatactactctaaacggtgctg 19694 Query: 380 tggag 384 ||||| Sbjct: 19693 tggag 19689 Score = 58.0 bits (29), Expect = 5e-05 Identities = 59/69 (85%) Strand = Plus / Minus Query: 469 ctgtgcaagagggacaacacgaagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||| ||||| | ||| |||||||||||||| || || ||||||||||| ||||| Sbjct: 19604 ctgtgcaaaagggagagcactaagcagttccacaattccaaaatcaagttccccttggtg 19545 Query: 529 taccagaag 537 ||| ||||| Sbjct: 19544 tacaagaag 19536
>emb|AJ718289.1| Nicotiana tabacum cDNA-AFLP-fragment BSTT4-43-380, cultivar Bright Yellow 2 Length = 320 Score = 65.9 bits (33), Expect = 2e-07 Identities = 60/69 (86%) Strand = Plus / Plus Query: 336 caacatgtacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatgtacac 395 ||||||||||||||||||||| || || ||| |||| || | |||||| ||||||||||| Sbjct: 41 caacatgtacaaggagtaccgagataccactttgaatggagctgtggaacagatgtacac 100 Query: 396 ggagatggc 404 |||||||| Sbjct: 101 tgagatggc 109
>gb|AC191858.3| Rhesus Macaque BAC CH250-392A15 () complete sequence Length = 185866 Score = 63.9 bits (32), Expect = 8e-07 Identities = 35/36 (97%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 ||||||||||||||||| |||||||||||||||||| Sbjct: 65126 aagcagttccacaactccaagatcaagttcccgctg 65091
>ref|XM_001087364.1| PREDICTED: Macaca mulatta similar to ribosomal protein L18a (LOC700872), mRNA Length = 589 Score = 63.9 bits (32), Expect = 8e-07 Identities = 35/36 (97%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 ||||||||||||||||| |||||||||||||||||| Sbjct: 427 aagcagttccacaactccaagatcaagttcccgctg 462
>ref|XM_505817.1| Yarrowia lipolytica CLIB122, YALI0F24123g predicted mRNA Length = 519 Score = 60.0 bits (30), Expect = 1e-05 Identities = 93/114 (81%) Strand = Plus / Plus Query: 193 ttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgcc 252 |||||||||||||||| ||||||||||||| |||||| ||| ||| |||| | ||| Sbjct: 121 ttctggtacttcctgacccagctcaagaaggtcaagaagtccaccggtgagattgttgcc 180 Query: 253 atcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 |||||| |||||| ||||||| ||| || | ||||||||| |||||||||| Sbjct: 181 atcaacaagatctccgagaagacccccactaaggtcaagaacttcggcatctgg 234 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Plus Query: 334 cacaacatgtacaaggagtaccg 356 ||||||||||||||||||||||| Sbjct: 262 cacaacatgtacaaggagtaccg 284
>emb|CR382132.1| Yarrowia lipolytica chromosome F of strain CLIB122 of Yarrowia lipolytica Length = 4003362 Score = 60.0 bits (30), Expect = 1e-05 Identities = 93/114 (81%) Strand = Plus / Minus Query: 193 ttctggtacttcctgaggaagctcaagaaggtgaagaaggccaacggccagatgctcgcc 252 |||||||||||||||| ||||||||||||| |||||| ||| ||| |||| | ||| Sbjct: 3153903 ttctggtacttcctgacccagctcaagaaggtcaagaagtccaccggtgagattgttgcc 3153844 Query: 253 atcaacgagatctttgagaagaacccgaccaccatcaagaactacggcatctgg 306 |||||| |||||| ||||||| ||| || | ||||||||| |||||||||| Sbjct: 3153843 atcaacaagatctccgagaagacccccactaaggtcaagaacttcggcatctgg 3153790 Score = 46.1 bits (23), Expect = 0.19 Identities = 23/23 (100%) Strand = Plus / Minus Query: 334 cacaacatgtacaaggagtaccg 356 ||||||||||||||||||||||| Sbjct: 3153762 cacaacatgtacaaggagtaccg 3153740
>gb|AY961480.1| Phytophthora infestans clone MY-22-C-06 ribosomal protein L18 mRNA, complete cds Length = 682 Score = 58.0 bits (29), Expect = 5e-05 Identities = 53/61 (86%) Strand = Plus / Plus Query: 333 ccacaacatgtacaaggagtaccgcgacacgactctgaacggcggtgtggagcagatgta 392 |||||||||||||||||||||||| ||| |||||| | ||| ||||||||||||||| Sbjct: 275 ccacaacatgtacaaggagtaccgtgacttgactctctgcagcgctgtggagcagatgta 334 Query: 393 c 393 | Sbjct: 335 c 335
>emb|CT737396.3| Pan troglodytes chromosome X clone CH251-572N17 map Xq28, complete sequence Length = 227066 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 176008 aagcagttccacgactccaagatcaagttcccgctg 176043 Score = 44.1 bits (22), Expect = 0.76 Identities = 25/26 (96%) Strand = Plus / Plus Query: 289 aagaactacggcatctggctgcgcta 314 ||||||| |||||||||||||||||| Sbjct: 175807 aagaacttcggcatctggctgcgcta 175832
>ref|NM_000980.2| Homo sapiens ribosomal protein L18a (RPL18A), mRNA Length = 618 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 462 aagcagttccacgactccaagatcaagttcccgctg 497
>ref|XM_001137701.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a, transcript variant 1 (LOC738693), mRNA Length = 604 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 433 aagcagttccacgactccaagatcaagttcccgctg 468 Score = 42.1 bits (21), Expect = 3.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 290 agaactacggcatctggctgcgcta 314 |||||| |||||||||||||||||| Sbjct: 233 agaacttcggcatctggctgcgcta 257
>ref|XM_001137967.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a, transcript variant 4 (LOC738693), mRNA Length = 657 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 475 aagcagttccacgactccaagatcaagttcccgctg 510 Score = 44.1 bits (22), Expect = 0.76 Identities = 25/26 (96%) Strand = Plus / Plus Query: 289 aagaactacggcatctggctgcgcta 314 ||||||| |||||||||||||||||| Sbjct: 274 aagaacttcggcatctggctgcgcta 299
>ref|XM_001137869.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a, transcript variant 3 (LOC738693), mRNA Length = 655 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 473 aagcagttccacgactccaagatcaagttcccgctg 508 Score = 44.1 bits (22), Expect = 0.76 Identities = 25/26 (96%) Strand = Plus / Plus Query: 289 aagaactacggcatctggctgcgcta 314 ||||||| |||||||||||||||||| Sbjct: 272 aagaacttcggcatctggctgcgcta 297
>ref|XM_001137785.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a, transcript variant 2 (LOC738693), mRNA Length = 656 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 474 aagcagttccacgactccaagatcaagttcccgctg 509 Score = 44.1 bits (22), Expect = 0.76 Identities = 25/26 (96%) Strand = Plus / Plus Query: 289 aagaactacggcatctggctgcgcta 314 ||||||| |||||||||||||||||| Sbjct: 273 aagaacttcggcatctggctgcgcta 298
>ref|XM_001161934.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a (LOC748555), mRNA Length = 679 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 517 aagcagttccacgactccaagatcaagttcccgctg 552
>ref|XM_938382.2| PREDICTED: Homo sapiens similar to ribosomal protein L18a (LOC347544), mRNA Length = 531 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 427 aagcagttccacgactccaagatcaagttcccgctg 462 Score = 44.1 bits (22), Expect = 0.76 Identities = 25/26 (96%) Strand = Plus / Plus Query: 289 aagaactacggcatctggctgcgcta 314 ||||||| |||||||||||||||||| Sbjct: 226 aagaacttcggcatctggctgcgcta 251
>ref|XM_293412.4| PREDICTED: Homo sapiens similar to ribosomal protein L18a (LOC347544), mRNA Length = 531 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 427 aagcagttccacgactccaagatcaagttcccgctg 462 Score = 44.1 bits (22), Expect = 0.76 Identities = 25/26 (96%) Strand = Plus / Plus Query: 289 aagaactacggcatctggctgcgcta 314 ||||||| |||||||||||||||||| Sbjct: 226 aagaacttcggcatctggctgcgcta 251
>ref|XM_945469.2| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 6 (LOC285053), mRNA Length = 600 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 436 aagcagttccacgactccaagatcaagttcccgctg 471
>ref|XM_941835.2| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 4 (LOC285053), mRNA Length = 671 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 482 aagcagttccacgactccaagatcaagttcccgctg 517
>ref|XM_934020.2| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 3 (LOC285053), mRNA Length = 600 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 436 aagcagttccacgactccaagatcaagttcccgctg 471
>ref|XM_208281.7| PREDICTED: Homo sapiens similar to ribosomal protein L18a, transcript variant 1 (LOC285053), mRNA Length = 664 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 482 aagcagttccacgactccaagatcaagttcccgctg 517
>ref|XM_001108577.1| PREDICTED: Macaca mulatta similar to ribosomal protein L18a (LOC717246), mRNA Length = 631 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 463 aagcagttccacgactccaagatcaagttcccgctg 498
>ref|XM_001088127.1| PREDICTED: Macaca mulatta similar to ATP/GTP binding protein 1 (LOC699665), mRNA Length = 3591 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 ||||||||||||||||| |||| ||||||||||||| Sbjct: 543 aagcagttccacaactccaagaacaagttcccgctg 508
>gb|BC098413.1| Homo sapiens cDNA clone IMAGE:6208834, **** WARNING: chimeric clone **** Length = 1360 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 1131 aagcagttccacgactccaagatcaagttcccgctg 1166
>gb|BC062307.1| Homo sapiens cDNA clone IMAGE:3504574, **** WARNING: chimeric clone **** Length = 1785 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 1573 aagcagttccacgactccaagatcaagttcccgctg 1608
>gb|BC071836.1| Homo sapiens cDNA clone IMAGE:6210072, **** WARNING: chimeric clone **** Length = 1360 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 1131 aagcagttccacgactccaagatcaagttcccgctg 1166
>gb|U52111.3| Homo sapiens chromosome X clone Qc-7G6, QLL-F1720, QLL-C1335, Qc-8B7, Qc-11H12, Qc-7F6, QLL-E153, Qc-10E8, Qc-10B7 map q28, complete sequence Length = 247592 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 45797 aagcagttccacgactccaagatcaagttcccgctg 45832 Score = 44.1 bits (22), Expect = 0.76 Identities = 25/26 (96%) Strand = Plus / Plus Query: 289 aagaactacggcatctggctgcgcta 314 ||||||| |||||||||||||||||| Sbjct: 45596 aagaacttcggcatctggctgcgcta 45621
>gb|AC089983.23| Homo sapiens 12 BAC RP11-818F20 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 204505 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 168520 aagcagttccacgactccaagatcaagttcccgctg 168555
>ref|NR_001593.1| Homo sapiens similar to ribosomal protein L18a; 60S ribosomal protein L18a (LOC390354) on chromosome 12 Length = 616 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 466 aagcagttccacgactccaagatcaagttcccgctg 501
>gb|BC066319.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:87208 IMAGE:5286436), complete cds Length = 632 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 466 aagcagttccacgactccaagatcaagttcccgctg 501
>gb|BC007512.2| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:4476 IMAGE:2961519), complete cds Length = 616 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 446 aagcagttccacgactccaagatcaagttcccgctg 481
>dbj|AK222647.1| Homo sapiens mRNA for ribosomal protein L18a variant, clone: CBL08590 Length = 594 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 462 aagcagttccacgactccaagatcaagttcccgctg 497
>emb|CR624588.1| full-length cDNA clone CS0DI021YD01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 612 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 456 aagcagttccacgactccaagatcaagttcccgctg 491
>emb|CR619918.1| full-length cDNA clone CS0DM013YP23 of Fetal liver of Homo sapiens (human) Length = 1921 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 1767 aagcagttccacgactccaagatcaagttcccgctg 1802
>emb|CR619120.1| full-length cDNA clone CS0DI077YH09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1912 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 1767 aagcagttccacgactccaagatcaagttcccgctg 1802
>emb|CR617184.1| full-length cDNA clone CS0DJ005YO06 of T cells (Jurkat cell line) Cot 10-normalized of Homo sapiens (human) Length = 606 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 449 aagcagttccacgactccaagatcaagttcccgctg 484
>emb|CR615832.1| full-length cDNA clone CS0DL001YB06 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human) Length = 602 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 446 aagcagttccacgactccaagatcaagttcccgctg 481
>emb|CR606905.1| full-length cDNA clone CS0DC025YL04 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 604 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 448 aagcagttccacgactccaagatcaagttcccgctg 483
>emb|CR603612.1| full-length cDNA clone CS0DB009YJ04 of Neuroblastoma Cot 10-normalized of Homo sapiens (human) Length = 612 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 456 aagcagttccacgactccaagatcaagttcccgctg 491
>emb|CR600845.1| full-length cDNA clone CS0DA007YA19 of Neuroblastoma of Homo sapiens (human) Length = 605 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 449 aagcagttccacgactccaagatcaagttcccgctg 484
>emb|CR600519.1| full-length cDNA clone CS0DC003YF24 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 605 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 449 aagcagttccacgactccaagatcaagttcccgctg 484
>emb|CR594005.1| full-length cDNA clone CL0BB004ZF10 of Neuroblastoma of Homo sapiens (human) Length = 603 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 448 aagcagttccacgactccaagatcaagttcccgctg 483
>emb|CR592115.1| full-length cDNA clone CS0DI063YB22 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 601 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 447 aagcagttccacgactccaagatcaagttcccgctg 482
>dbj|AB180445.1| Plutella xylostella mRNA for Ribosomal protein L18A, complete cds Length = 564 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 268 gagaagaacccgaccaccatcaagaactacggcatctggctgcgctac 315 ||||||| ||||| || |||||||||| ||||||||||||||||||| Sbjct: 210 gagaagagcccgatcaagatcaagaacttcggcatctggctgcgctac 257
>gb|AC079250.7| Homo sapiens BAC clone RP11-62I18 from 2, complete sequence Length = 82938 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 78672 aagcagttccacgactccaagatcaagttcccgctg 78637
>gb|L05093.1|HUMRIBPROD Homo sapiens ribosomal protein L18a mRNA, complete cds Length = 602 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 446 aagcagttccacgactccaagatcaagttcccgctg 481
>gb|BC071920.1| Homo sapiens ribosomal protein L18a, mRNA (cDNA clone MGC:88602 IMAGE:6293838), complete cds Length = 622 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 446 aagcagttccacgactccaagatcaagttcccgctg 481
>gb|AF045188.1|AF045188 Salmo salar ribosomal protein L18a mRNA, complete cds Length = 607 Score = 56.0 bits (28), Expect = 2e-04 Identities = 31/32 (96%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttccc 521 |||||||||||| ||||||||||||||||||| Sbjct: 443 aagcagttccacgactcgaagatcaagttccc 474
>emb|X80822.1|HSPLORF H.sapiens mRNA for ORF Length = 657 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctg 525 |||||||||||| |||| |||||||||||||||||| Sbjct: 452 aagcagttccacgactccaagatcaagttcccgctg 487
>dbj|AK234580.1| Sus scrofa mRNA, clone:OVR010090E05, expressed in ovary Length = 662 Score = 54.0 bits (27), Expect = 8e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgct 524 |||||||||||| |||| ||||||||||||||||| Sbjct: 467 aagcagttccacgactccaagatcaagttcccgct 501
>dbj|AK231188.1| Sus scrofa mRNA, clone:ITT010012G03, expressed in intestine Length = 656 Score = 54.0 bits (27), Expect = 8e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgct 524 |||||||||||| |||| ||||||||||||||||| Sbjct: 463 aagcagttccacgactccaagatcaagttcccgct 497
>dbj|AK237419.1| Sus scrofa mRNA, clone:SPL010039A05, expressed in spleen Length = 644 Score = 54.0 bits (27), Expect = 8e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgct 524 |||||||||||| |||| ||||||||||||||||| Sbjct: 467 aagcagttccacgactccaagatcaagttcccgct 501
>ref|XR_023170.1| PREDICTED: Pan troglodytes similar to ribosomal protein L18a (LOC469243), partial mRNA Length = 631 Score = 54.0 bits (27), Expect = 8e-04 Identities = 33/35 (94%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgct 524 |||||||||||| |||| ||||||||||||||||| Sbjct: 473 aagcagttccacgactccaagatcaagttcccgct 507
>gb|AY232187.1| Drosophila yakuba clone yak-ad_RpL18A mRNA sequence Length = 240 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 489 gaagcagttccacaactcgaagatcaagttcccgctggt 527 ||||||||||||| | ||||||||||||||||| ||||| Sbjct: 135 gaagcagttccacgattcgaagatcaagttccctctggt 173
>gb|AY231805.1| Drosophila yakuba clone yak-em_RpL18A mRNA sequence Length = 528 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 489 gaagcagttccacaactcgaagatcaagttcccgctggt 527 ||||||||||||| |||| |||||||||||||| ||||| Sbjct: 423 gaagcagttccacgactccaagatcaagttccctctggt 461 Score = 44.1 bits (22), Expect = 0.76 Identities = 25/26 (96%) Strand = Plus / Plus Query: 286 atcaagaactacggcatctggctgcg 311 |||||||||| ||||||||||||||| Sbjct: 220 atcaagaacttcggcatctggctgcg 245
>gb|AY048752.1| Blastocystis hominis RAPD fragment Length = 1132 Score = 54.0 bits (27), Expect = 8e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 334 cacaacatgtacaaggagtaccgcgacacgactct 368 ||||||||||||||||||||||| |||||| |||| Sbjct: 390 cacaacatgtacaaggagtaccgtgacacggctct 356
>emb|BX072011.1|CNS09RQ7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 702 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 472 aagcagttccacaactcgaagatccgattcccgctggtg 434
>emb|BX072010.1|CNS09RQ6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9DB04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 773 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 468 aagcagttccacaactcgaagatccgattcccgctggtg 506
>emb|BX071935.1|CNS09RO3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 452 aagcagttccacaactcgaagatccgattcccgctggtg 414
>emb|BX071934.1|CNS09RO2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC9CF11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 454 aagcagttccacaactcgaagatccgattcccgctggtg 492
>emb|BX071326.1|CNS09R76 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8DC06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 444 aagcagttccacaactcgaagatccgattcccgctggtg 482
>emb|BX071198.1|CNS09R3M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 445 aagcagttccacaactcgaagatccgattcccgctggtg 407
>emb|BX071197.1|CNS09R3L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 946 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 444 aagcagttccacaactcgaagatccgattcccgctggtg 482
>emb|BX071022.1|CNS09QYQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 909 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 460 aagcagttccacaactcgaagatccgattcccgctggtg 422
>emb|BX071021.1|CNS09QYP Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC8BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 885 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 459 aagcagttccacaactcgaagatccgattcccgctggtg 497
>emb|BX070958.1|CNS09QWY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC8BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 458 aagcagttccacaactcgaagatccgattcccgctggtg 420
>emb|BX061453.1|CNS09JKX Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 862 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 343 aagcagttccacaactcgaagatccgattcccgctggtg 305
>emb|BX061452.1|CNS09JKW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42BB07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 846 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 354 aagcagttccacaactcgaagatccgattcccgctggtg 392
>emb|BX061383.1|CNS09JIZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 931 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 435 aagcagttccacaactcgaagatccgattcccgctggtg 473
>emb|BX070094.1|CNS09Q8Y Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC7AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 684 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 441 aagcagttccacaactcgaagatccgattcccgctggtg 479
>emb|BX069977.1|CNS09Q5P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DD10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 489
>emb|BX069941.1|CNS09Q4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 694 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 413
>emb|BX069940.1|CNS09Q4O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6DC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 429 aagcagttccacaactcgaagatccgattcccgctggtg 467
>emb|BX069703.1|CNS09PY3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 950 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 430 aagcagttccacaactcgaagatccgattcccgctggtg 392
>emb|BX069702.1|CNS09PY2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6BH09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 940 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 476
>emb|BX069369.1|CNS09POT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 577 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 475 aagcagttccacaactcgaagatccgattcccgctggtg 437
>emb|BX069368.1|CNS09POS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC6AA09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 465 aagcagttccacaactcgaagatccgattcccgctggtg 503
>emb|BX069214.1|CNS09PKI Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 981 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 479 aagcagttccacaactcgaagatccgattcccgctggtg 441
>emb|BX069213.1|CNS09PKH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53DB06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 972 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 455 aagcagttccacaactcgaagatccgattcccgctggtg 493
>emb|BX068918.1|CNS09PCA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 975 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 481 aagcagttccacaactcgaagatccgattcccgctggtg 443
>emb|BX068917.1|CNS09PC9 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53BE04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 990 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 478 aagcagttccacaactcgaagatccgattcccgctggtg 516
>emb|BX068389.1|CNS09OXL Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52CD01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX068343.1|CNS09OWB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 894 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 425 aagcagttccacaactcgaagatccgattcccgctggtg 387
>emb|BX068342.1|CNS09OWA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BH12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 433 aagcagttccacaactcgaagatccgattcccgctggtg 471
>emb|BX068334.1|CNS09OW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 488
>emb|BX068304.1|CNS09OV8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BG05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 978 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 462 aagcagttccacaactcgaagatccgattcccgctggtg 500
>emb|BX068271.1|CNS09OUB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 538 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 385 aagcagttccacaactcgaagatccgattcccgctggtg 347
>emb|BX068270.1|CNS09OUA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 910 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 445 aagcagttccacaactcgaagatccgattcccgctggtg 483
>emb|BX068265.1|CNS09OU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 790 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 449 aagcagttccacaactcgaagatccgattcccgctggtg 411
>emb|BX068264.1|CNS09OU4 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52BE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 741 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 452 aagcagttccacaactcgaagatccgattcccgctggtg 490
>emb|BX068781.1|CNS09P8H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 514 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 485 aagcagttccacaactcgaagatccgattcccgctggtg 447
>emb|BX068780.1|CNS09P8G Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AG06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 974 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 463 aagcagttccacaactcgaagatccgattcccgctggtg 501
>emb|BX068699.1|CNS09P67 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 473 aagcagttccacaactcgaagatccgattcccgctggtg 435
>emb|BX068698.1|CNS09P66 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC53AC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 966 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 486
>emb|BX068685.1|CNS09P5T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC53AC01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 796 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 309 aagcagttccacaactcgaagatccgattcccgctggtg 271
>emb|BX068632.1|CNS09P4C Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 469 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 439 aagcagttccacaactcgaagatccgattcccgctggtg 401
>emb|BX068631.1|CNS09P4B Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52DH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 962 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX068004.1|CNS09OMW Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 832 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 400
>emb|BX068003.1|CNS09OMV Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC52AA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 822 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 432 aagcagttccacaactcgaagatccgattcccgctggtg 470
>emb|BX067731.1|CNS09OFB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 887 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 460 aagcagttccacaactcgaagatccgattcccgctggtg 422
>emb|BX067730.1|CNS09OFA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC51CB11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 977 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 454 aagcagttccacaactcgaagatccgattcccgctggtg 492
>emb|BX067102.1|CNS09NXU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 564 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 476 aagcagttccacaactcgaagatccgattcccgctggtg 438
>emb|BX067101.1|CNS09NXT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 462 aagcagttccacaactcgaagatccgattcccgctggtg 500
>emb|BX066999.1|CNS09NUZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 468 aagcagttccacaactcgaagatccgattcccgctggtg 430
>emb|BX066998.1|CNS09NUY Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50CA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 869 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX066931.1|CNS09NT3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BF07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 968 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 453 aagcagttccacaactcgaagatccgattcccgctggtg 491
>emb|BX066843.1|CNS09NQN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 804 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 467 aagcagttccacaactcgaagatccgattcccgctggtg 429
>emb|BX066842.1|CNS09NQM Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50BB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 461 aagcagttccacaactcgaagatccgattcccgctggtg 499
>emb|BX066697.1|CNS09NML Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC50AD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 613 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 457 aagcagttccacaactcgaagatccgattcccgctggtg 495
>emb|BX066444.1|CNS09NFK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC5DA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 815 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 486
>emb|BX065769.1|CNS09MWT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 648 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 457 aagcagttccacaactcgaagatccgattcccgctggtg 419
>emb|BX065768.1|CNS09MWS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49DB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 873 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 459 aagcagttccacaactcgaagatccgattcccgctggtg 497
>emb|BX065563.1|CNS09MR3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 853 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 439 aagcagttccacaactcgaagatccgattcccgctggtg 401
>emb|BX065562.1|CNS09MR2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49CA10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 913 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 484 aagcagttccacaactcgaagatccgattcccgctggtg 522
>emb|BX065379.1|CNS09MLZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49BA08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 463 aagcagttccacaactcgaagatccgattcccgctggtg 425
>emb|BX065287.1|CNS09MJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 410
>emb|BX065286.1|CNS09MJE Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC49AD12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 854 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX065104.1|CNS09MEC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 814 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 445 aagcagttccacaactcgaagatccgattcccgctggtg 407
>emb|BX065103.1|CNS09MEB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 943 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 441 aagcagttccacaactcgaagatccgattcccgctggtg 479
>emb|BX065085.1|CNS09MDT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 273 aagcagttccacaactcgaagatccgattcccgctggtg 311
>emb|BX065080.1|CNS09MDO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 895 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 440 aagcagttccacaactcgaagatccgattcccgctggtg 402
>emb|BX065079.1|CNS09MDN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DC07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 443 aagcagttccacaactcgaagatccgattcccgctggtg 481
>emb|BX065033.1|CNS09MCD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 440 aagcagttccacaactcgaagatccgattcccgctggtg 402
>emb|BX065032.1|CNS09MCC Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC48DA05 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 919 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 433 aagcagttccacaactcgaagatccgattcccgctggtg 471
>emb|BX064042.1|CNS09LKU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 463 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 65 aagcagttccacaactcgaagatccgattcccgctggtg 27
>emb|BX064041.1|CNS09LKT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC46AF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 964 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 459 aagcagttccacaactcgaagatccgattcccgctggtg 497
>emb|BX063028.1|CNS09KSO Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 851 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 413
>emb|BX063027.1|CNS09KSN Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44CE06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 904 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 572 aagcagttccacaactcgaagatccgattcccgctggtg 610
>emb|BX063680.1|CNS09LAS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 824 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 323 aagcagttccacaactcgaagatccgattcccgctggtg 361
>emb|BX063679.1|CNS09LAR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 951 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 412
>emb|BX063678.1|CNS09LAQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CF08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 922 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 476
>emb|BX063630.1|CNS09L9E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 555 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 462 aagcagttccacaactcgaagatccgattcccgctggtg 424
>emb|BX063629.1|CNS09L9D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC45CC12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 552 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 489
>emb|BX062931.1|CNS09KPZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BG11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 485 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 460 aagcagttccacaactcgaagatccgattcccgctggtg 422
>emb|BX062913.1|CNS09KPH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 858 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 449 aagcagttccacaactcgaagatccgattcccgctggtg 411
>emb|BX062912.1|CNS09KPG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BG01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 860 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 446 aagcagttccacaactcgaagatccgattcccgctggtg 484
>emb|BX062805.1|CNS09KMH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44BB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 953 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 489
>emb|BX062755.1|CNS09KL3 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 695 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 312 aagcagttccacaactcgaagatccgattcccgctggtg 350
>emb|BX062625.1|CNS09KHH Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 884 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 443 aagcagttccacaactcgaagatccgattcccgctggtg 405
>emb|BX062624.1|CNS09KHG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC44AA02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 890 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX062166.1|CNS09K4Q Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 865 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 455 aagcagttccacaactcgaagatccgattcccgctggtg 417
>emb|BX062165.1|CNS09K4P Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BC10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 816 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 452 aagcagttccacaactcgaagatccgattcccgctggtg 490
>emb|BX062118.1|CNS09K3E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43BA07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 914 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 486
>emb|BX062090.1|CNS09K2M Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC43AH04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 921 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 417 aagcagttccacaactcgaagatccgattcccgctggtg 455
>emb|BX061845.1|CNS09JVT Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 800 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 473 aagcagttccacaactcgaagatccgattcccgctggtg 435
>emb|BX061844.1|CNS09JVS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42DD06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 681 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 437 aagcagttccacaactcgaagatccgattcccgctggtg 475
>emb|BX061292.1|CNS09JGG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 454 aagcagttccacaactcgaagatccgattcccgctggtg 416
>emb|BX061291.1|CNS09JGF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC42AA11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 916 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX061184.1|CNS09JDG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX060940.1|CNS09J6O Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 392 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 386 aagcagttccacaactcgaagatccgattcccgctggtg 348
>emb|BX060939.1|CNS09J6N Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC41CB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 944 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 438 aagcagttccacaactcgaagatccgattcccgctggtg 476
>emb|BX060474.1|CNS09ITQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40DD11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 892 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 463 aagcagttccacaactcgaagatccgattcccgctggtg 501
>emb|BX060315.1|CNS09IPB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 801 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 391 aagcagttccacaactcgaagatccgattcccgctggtg 353
>emb|BX060314.1|CNS09IPA Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40CE08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 596 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 451 aagcagttccacaactcgaagatccgattcccgctggtg 489
>emb|BX060072.1|CNS09IIK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40BC02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 1043 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 698 aagcagttccacaactcgaagatccgattcccgctggtg 736
>emb|BX059980.1|CNS09IG0 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 947 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 464 aagcagttccacaactcgaagatccgattcccgctggtg 426
>emb|BX059979.1|CNS09IFZ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC40AF10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 755 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 456 aagcagttccacaactcgaagatccgattcccgctggtg 494
>emb|BX059598.1|CNS09I5E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 901 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 412
>emb|BX059597.1|CNS09I5D Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4CB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 945 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 454 aagcagttccacaactcgaagatccgattcccgctggtg 492
>emb|BX059276.1|CNS09HWG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 436 aagcagttccacaactcgaagatccgattcccgctggtg 474
>emb|BX059262.1|CNS09HW2 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC4AA12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 949 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 461 aagcagttccacaactcgaagatccgattcccgctggtg 499
>emb|BX059231.1|CNS09HV7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 437 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 57 aagcagttccacaactcgaagatccgattcccgctggtg 19
>emb|BX059230.1|CNS09HV6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39DH06 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 954 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 442 aagcagttccacaactcgaagatccgattcccgctggtg 480
>emb|BX058872.1|CNS09HL8 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 938 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 422 aagcagttccacaactcgaagatccgattcccgctggtg 384
>emb|BX058871.1|CNS09HL7 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BH10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 928 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 425 aagcagttccacaactcgaagatccgattcccgctggtg 463
>emb|BX058808.1|CNS09HJG Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 905 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 434 aagcagttccacaactcgaagatccgattcccgctggtg 396
>emb|BX058807.1|CNS09HJF Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39BE12 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 932 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 424 aagcagttccacaactcgaagatccgattcccgctggtg 462
>emb|BX058560.1|CNS09HCK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 955 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 439 aagcagttccacaactcgaagatccgattcccgctggtg 401
>emb|BX058559.1|CNS09HCJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC39AB03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 690 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 440 aagcagttccacaactcgaagatccgattcccgctggtg 478
>emb|BX058281.1|CNS09H4T Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 976 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 458 aagcagttccacaactcgaagatccgattcccgctggtg 420
>emb|BX058280.1|CNS09H4S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CD07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 958 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 459 aagcagttccacaactcgaagatccgattcccgctggtg 497
>emb|BX058269.1|CNS09H4H Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38CC09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 738 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 388 aagcagttccacaactcgaagatccgattcccgctggtg 426
>emb|BX057958.1|CNS09GVU Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC38AE09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 432 aagcagttccacaactcgaagatccgattcccgctggtg 470
>emb|BX056891.1|CNS09G27 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36CC03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 779 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 453 aagcagttccacaactcgaagatccgattcccgctggtg 491
>emb|BX056753.1|CNS09FYD Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36BC04 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 559 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 455 aagcagttccacaactcgaagatccgattcccgctggtg 417
>emb|BX056602.1|CNS09FU6 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 575 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 65 aagcagttccacaactcgaagatccgattcccgctggtg 27
>emb|BX056601.1|CNS09FU5 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC36AB01 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 925 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 419 aagcagttccacaactcgaagatccgattcccgctggtg 457
>emb|BX056571.1|CNS09FTB Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DH08 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 896 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 386 aagcagttccacaactcgaagatccgattcccgctggtg 424
>emb|BX056553.1|CNS09FST Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 847 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 410
>emb|BX056552.1|CNS09FSS Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DG07 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 739 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 422 aagcagttccacaactcgaagatccgattcccgctggtg 460
>emb|BX056479.1|CNS09FQR Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 833 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 444 aagcagttccacaactcgaagatccgattcccgctggtg 406
>emb|BX056478.1|CNS09FQQ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35DB10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 861 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 432 aagcagttccacaactcgaagatccgattcccgctggtg 470
>emb|BX056309.1|CNS09FM1 Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC35CB09 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 927 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 431 aagcagttccacaactcgaagatccgattcccgctggtg 469
>emb|BX056040.1|CNS09FEK Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 651 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 453 aagcagttccacaactcgaagatccgattcccgctggtg 415
>emb|BX056039.1|CNS09FEJ Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34DG03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 844 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 450 aagcagttccacaactcgaagatccgattcccgctggtg 488
>emb|BX055724.1|CNS09F5S Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 983 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 473 aagcagttccacaactcgaagatccgattcccgctggtg 435
>emb|BX055723.1|CNS09F5R Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BH02 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 934 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 430 aagcagttccacaactcgaagatccgattcccgctggtg 468
>emb|BX055717.1|CNS09F5L Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BG10 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 544 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 471 aagcagttccacaactcgaagatccgattcccgctggtg 433
>emb|BX055643.1|CNS09F3J Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 911 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 474 aagcagttccacaactcgaagatccgattcccgctggtg 436
>emb|BX055642.1|CNS09F3I Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 5-PRIME end of clone FK0AAC34BD03 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 942 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Plus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 448 aagcagttccacaactcgaagatccgattcccgctggtg 486
>emb|BX055566.1|CNS09F1E Single read from an extremity of a full-length cDNA clone made from Anopheles gambiae total adult females. 3-PRIME end of clone FK0AAC34AH11 of strain 6-9 of Anopheles gambiae (African malaria mosquito) Length = 474 Score = 54.0 bits (27), Expect = 8e-04 Identities = 36/39 (92%) Strand = Plus / Minus Query: 490 aagcagttccacaactcgaagatcaagttcccgctggtg 528 |||||||||||||||||||||||| |||||||||||| Sbjct: 445 aagcagttccacaactcgaagatccgattcccgctggtg 407 Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS,environmental samples or phase 0, 1 or 2 HTGS sequences) Posted date: Dec 3, 2006 5:45 PM Number of letters in database: 18,610,659,111 Number of sequences in database: 4,638,285 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Sequences: 4638285 Number of Hits to DB: 120,345,591 Number of extensions: 6317648 Number of successful extensions: 126885 Number of sequences better than 10.0: 615 Number of HSP's gapped: 126845 Number of HSP's successfully gapped: 722 Length of query: 794 Length of database: 18,610,659,111 Length adjustment: 22 Effective length of query: 772 Effective length of database: 18,508,616,841 Effective search space: 14288652201252 Effective search space used: 14288652201252 X1: 11 (21.8 bits) X2: 15 (29.7 bits) X3: 25 (49.6 bits) S1: 14 (28.2 bits)
