>ref|NM_001067715.1| Oryza sativa (japonica cultivar-group) Os08g0193500 (Os08g0193500)
            mRNA, complete cds
          Length = 1344
 Score =  101 bits (51), Expect = 1e-17
 Identities = 147/179 (82%)
 Strand = Plus / Plus

                                                                        
Query: 1050 tgtcagggattggtctgagctcccactcgatgtgctttctgcaatcttcatgaaacttgg 1109
            |||||| |||||||| || ||||||  ||||| ||||||| | || |||||||| |||||
Sbjct: 36   tgtcagagattggtccgatctcccaaccgatgcgctttctaccattttcatgaagcttgg 95

                                                                        
Query: 1110 gaccattgagattcttatgggtgcgggacttgtgtgccgctcatggctggtgacagccaa 1169
            || ||||||| | || |||||||| || ||||||||||  |||||| |||   | || ||
Sbjct: 96   gagcattgaggtcctgatgggtgcaggccttgtgtgccattcatggttggcagctgcgaa 155

                                                                       
Query: 1170 gtcccctgagttgtggcgttttgtggacatgacgcgacagaagctggttttctcaaagg 1228
            ||| |||||| |||||||||  ||||||||||| || || ||| |||||||||||||||
Sbjct: 156  gtcacctgagctgtggcgttccgtggacatgactcgtcataaggtggttttctcaaagg 214



 Score = 99.6 bits (50), Expect = 4e-17
 Identities = 110/130 (84%)
 Strand = Plus / Plus

                                                                        
Query: 1249 atggcaaaggtggccatagatcgctctgatggacagatggaatcattctgggctcagaag 1308
            ||||| |||||||| ||||| |||||| | ||| ||||||| ||||||| ||||||||||
Sbjct: 235  atggcgaaggtggctatagaccgctctcaaggaaagatggagtcattcttggctcagaag 294

                                                                        
Query: 1309 tttgtcactagcgaactcctgaattacattgcaagcagatgcaactcattgaagagcatt 1368
            ||||| |||||||||||| || ||||||||||  ||||    |  || ||||||||||||
Sbjct: 295  tttgttactagcgaactcttggattacattgcttgcagggctagttctttgaagagcatt 354

                      
Query: 1369 cggctcatcg 1378
            ||||||||||
Sbjct: 355  cggctcatcg 364



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 48/53 (90%)
 Strand = Plus / Plus

                                                                 
Query: 1728 cctgaccaacaaaggggtatacgccatccttgaaggctgcccccacctcgagt 1780
            ||||||||||||||||||  | |||||||| || |||||||||||||||||||
Sbjct: 942  cctgaccaacaaaggggttcatgccatcctcgatggctgcccccacctcgagt 994

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8
          Length = 28434780

 Score =  101 bits (51), Expect = 1e-17
 Identities = 147/179 (82%)
 Strand = Plus / Minus

                                                                           
Query: 1050    tgtcagggattggtctgagctcccactcgatgtgctttctgcaatcttcatgaaacttgg 1109
               |||||| |||||||| || ||||||  ||||| ||||||| | || |||||||| |||||
Sbjct: 5447395 tgtcagagattggtccgatctcccaaccgatgcgctttctaccattttcatgaagcttgg 5447336

                                                                           
Query: 1110    gaccattgagattcttatgggtgcgggacttgtgtgccgctcatggctggtgacagccaa 1169
               || ||||||| | || |||||||| || ||||||||||  |||||| |||   | || ||
Sbjct: 5447335 gagcattgaggtcctgatgggtgcaggccttgtgtgccattcatggttggcagctgcgaa 5447276

                                                                          
Query: 1170    gtcccctgagttgtggcgttttgtggacatgacgcgacagaagctggttttctcaaagg 1228
               ||| |||||| |||||||||  ||||||||||| || || ||| |||||||||||||||
Sbjct: 5447275 gtcacctgagctgtggcgttccgtggacatgactcgtcataaggtggttttctcaaagg 5447217



 Score = 99.6 bits (50), Expect = 4e-17
 Identities = 104/122 (85%)
 Strand = Plus / Minus

                                                                           
Query: 1669    gccttcgccatagcagagagcttgcatgagttgcggctccttcagatggcaggctacggc 1728
               ||||| ||||||||||| | | |||| ||| | ||||| ||||||||  ||||  ||  |
Sbjct: 5435537 gcctttgccatagcagaaaacatgcacgagctacggcttcttcagatttcaggtaacaac 5435478

                                                                           
Query: 1729    ctgaccaacaaaggggtatacgccatccttgaaggctgcccccacctcgagttcctcgac 1788
               ||||||||||||||||| |||||||||||||| |||||||||||||| |||| |||||||
Sbjct: 5435477 ctgaccaacaaaggggtgtacgccatccttgatggctgcccccaccttgagtgcctcgac 5435418

                 
Query: 1789    ct 1790
               ||
Sbjct: 5435417 ct 5435416



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                           
Query: 1249    atggcaaaggtggccatagatcgctctgatggacagatggaatcattctgggctcagaag 1308
               ||||| |||||||| ||||| |||||| | ||| ||||||| ||||||| ||||||||||
Sbjct: 5447196 atggcgaaggtggctatagaccgctctcaaggaaagatggagtcattcttggctcagaag 5447137

                                               
Query: 1309    tttgtcactagcgaactcctgaattacattgc 1340
               ||||| |||||||||||| || ||||||||||
Sbjct: 5447136 tttgttactagcgaactcttggattacattgc 5447105



 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 142/174 (81%)
 Strand = Plus / Minus

                                                                           
Query: 1054    agggattggtctgagctcccactcgatgtgctttctgcaatcttcatgaaacttgggacc 1113
               ||||||||||||||||||||| | ||||  |||||||||||||||| |||||||||||| 
Sbjct: 5442223 agggattggtctgagctcccagtggatgcactttctgcaatcttcacgaaacttgggact 5442164

                                                                           
Query: 1114    attgagattcttatgggtgcgggacttgtgtgccgctcatggctggtgacagccaagtcc 1173
                ||||||| || ||||||||  |  ||||||||| ||| ||| |||   |  | ||||| 
Sbjct: 5442163 gttgagatcctaatgggtgcaagctttgtgtgccactcttggttggcagcttcaaagtca 5442104

                                                                     
Query: 1174    cctgagttgtggcgttttgtggacatgacgcgacagaagctggttttctcaaag 1227
               |||||  ||||||| || ||||||||||| || || ||| || |||||||||||
Sbjct: 5442103 cctgaactgtggcggttcgtggacatgacacgccacaaggtgattttctcaaag 5442050



 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                           
Query: 1084    ctttctgcaatcttcatgaaacttgggaccattgagattcttatgggtgcgggacttgtg 1143
               ||||||||| |||||||||||||||||||  |||||||||| ||||||||  |  |||||
Sbjct: 5436502 ctttctgcagtcttcatgaaacttgggactgttgagattctgatgggtgctagctttgtg 5436443

                                                                           
Query: 1144    tgccgctcatggctggtgacagccaagtcccctgagttgtggcgttttgtggacatgacg 1203
               |||| ||||||| ||| | |  | ||||| |||||  ||||||| || ||||||||||| 
Sbjct: 5436442 tgccactcatggttggcggcttcaaagtcacctgaactgtggcgattcgtggacatgaca 5436383

                                        
Query: 1204    cgacagaagctggttttctcaaagg 1228
               || || ||| || ||||||||||||
Sbjct: 5436382 cgccacaaggtgattttctcaaagg 5436358



 Score = 79.8 bits (40), Expect = 4e-11
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                           
Query: 1264    atagatcgctctgatggacagatggaatcattctgggctcagaagtttgtcactagcgaa 1323
               ||||||||||| ||||||||||| || ||||||||||| ||||||||||||||| | |||
Sbjct: 5442013 atagatcgctccgatggacagattgagtcattctgggcccagaagtttgtcactggtgaa 5441954

                               
Query: 1324    ctcctgaattacattg 1339
               ||| || |||| ||||
Sbjct: 5441953 ctcttggattatattg 5441938



 Score = 75.8 bits (38), Expect = 6e-10
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                           
Query: 1669    gccttcgccatagcagagagcttgcatgagttgcggctccttcagatggcaggctacggc 1728
               |||||||| |||||||| | | |||||||||| ||||| || ||||| |||||  |   |
Sbjct: 5440770 gccttcgcgatagcagaaaacatgcatgagttacggcttctgcagattgcaggtcataac 5440711

                                                                           
Query: 1729    ctgaccaacaaaggggtatacgccatccttgaaggctgcccccacctcgagttcctcgac 1788
               |||||| | | ||||||   |||||||||||| ||||||||||||||||||| |||||||
Sbjct: 5440710 ctgaccgagataggggtgcgcgccatccttgatggctgcccccacctcgagtgcctcgac 5440651

                 
Query: 1789    ct 1790
               ||
Sbjct: 5440650 ct 5440649



 Score = 73.8 bits (37), Expect = 2e-09
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                           
Query: 1249    atggcaaaggtggccatagatcgctctgatggacagatggaatcattctgggctcagaag 1308
               |||||||| | ||| ||||| ||||| ||||||| |||||| || |||||||||||||||
Sbjct: 5436337 atggcaaaagcggcaatagaccgctccgatggacggatggagtcgttctgggctcagaag 5436278

                                            
Query: 1309    tttgtcactagcgaactcctgaattacat 1337
               ||||| ||| | |||||| || |||||||
Sbjct: 5436277 tttgttacttgtgaactcttggattacat 5436249



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                    
Query: 1728    cctgaccaacaaaggggtatacgccatccttgaaggctgcccccacctcgagt 1780
               ||||||||||||||||||  | |||||||| || |||||||||||||||||||
Sbjct: 5446078 cctgaccaacaaaggggttcatgccatcctcgatggctgcccccacctcgagt 5446026



 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                           
Query: 1106    ttgggaccattgagattcttatgggtgcgggacttgtgtgccgctcatggctggtgacag 1165
               ||||| ||||||||||||| |||||||| || |||||||||| ||||||| ||| | | |
Sbjct: 5475007 ttggggccattgagattctgatgggtgctggccttgtgtgccactcatggttggaggctg 5474948

                                                       
Query: 1166    ccaagtcccctgagttgtggcgttttgtggacatgacgcg 1205
               |||||  |||||| |||||| | | | | |||||||||||
Sbjct: 5474947 ccaaggtccctgacttgtggagatctctcgacatgacgcg 5474908



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                  
Query: 1507    cgcccagagctgaaacgtctaagagtccatttgcc 1541
               |||||| |||||||||||||| |||||||| ||||
Sbjct: 5435687 cgcccacagctgaaacgtctacgagtccatatgcc 5435653



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                              
Query: 1669    gccttcgccatagcagagagcttgcatgagttgcggctccttcagat 1715
               ||||||||||| ||||||||| |||| ||| ||||  ||||||||||
Sbjct: 5473816 gccttcgccattgcagagagcatgcacgagctgcgtatccttcagat 5473770



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 1357    ttgaagagcattcggctcatcg 1378
               ||||||||||||||||||||||
Sbjct: 5446677 ttgaagagcattcggctcatcg 5446656

>dbj|AP005441.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0056O06
          Length = 151038

 Score =  101 bits (51), Expect = 1e-17
 Identities = 147/179 (82%)
 Strand = Plus / Minus

                                                                          
Query: 1050   tgtcagggattggtctgagctcccactcgatgtgctttctgcaatcttcatgaaacttgg 1109
              |||||| |||||||| || ||||||  ||||| ||||||| | || |||||||| |||||
Sbjct: 117206 tgtcagagattggtccgatctcccaaccgatgcgctttctaccattttcatgaagcttgg 117147

                                                                          
Query: 1110   gaccattgagattcttatgggtgcgggacttgtgtgccgctcatggctggtgacagccaa 1169
              || ||||||| | || |||||||| || ||||||||||  |||||| |||   | || ||
Sbjct: 117146 gagcattgaggtcctgatgggtgcaggccttgtgtgccattcatggttggcagctgcgaa 117087

                                                                         
Query: 1170   gtcccctgagttgtggcgttttgtggacatgacgcgacagaagctggttttctcaaagg 1228
              ||| |||||| |||||||||  ||||||||||| || || ||| |||||||||||||||
Sbjct: 117086 gtcacctgagctgtggcgttccgtggacatgactcgtcataaggtggttttctcaaagg 117028



 Score = 99.6 bits (50), Expect = 4e-17
 Identities = 104/122 (85%)
 Strand = Plus / Minus

                                                                          
Query: 1669   gccttcgccatagcagagagcttgcatgagttgcggctccttcagatggcaggctacggc 1728
              ||||| ||||||||||| | | |||| ||| | ||||| ||||||||  ||||  ||  |
Sbjct: 105348 gcctttgccatagcagaaaacatgcacgagctacggcttcttcagatttcaggtaacaac 105289

                                                                          
Query: 1729   ctgaccaacaaaggggtatacgccatccttgaaggctgcccccacctcgagttcctcgac 1788
              ||||||||||||||||| |||||||||||||| |||||||||||||| |||| |||||||
Sbjct: 105288 ctgaccaacaaaggggtgtacgccatccttgatggctgcccccaccttgagtgcctcgac 105229

                
Query: 1789   ct 1790
              ||
Sbjct: 105228 ct 105227



 Score = 95.6 bits (48), Expect = 6e-16
 Identities = 81/92 (88%)
 Strand = Plus / Minus

                                                                          
Query: 1249   atggcaaaggtggccatagatcgctctgatggacagatggaatcattctgggctcagaag 1308
              ||||| |||||||| ||||| |||||| | ||| ||||||| ||||||| ||||||||||
Sbjct: 117007 atggcgaaggtggctatagaccgctctcaaggaaagatggagtcattcttggctcagaag 116948

                                              
Query: 1309   tttgtcactagcgaactcctgaattacattgc 1340
              ||||| |||||||||||| || ||||||||||
Sbjct: 116947 tttgttactagcgaactcttggattacattgc 116916



 Score = 91.7 bits (46), Expect = 1e-14
 Identities = 142/174 (81%)
 Strand = Plus / Minus

                                                                          
Query: 1054   agggattggtctgagctcccactcgatgtgctttctgcaatcttcatgaaacttgggacc 1113
              ||||||||||||||||||||| | ||||  |||||||||||||||| |||||||||||| 
Sbjct: 112034 agggattggtctgagctcccagtggatgcactttctgcaatcttcacgaaacttgggact 111975

                                                                          
Query: 1114   attgagattcttatgggtgcgggacttgtgtgccgctcatggctggtgacagccaagtcc 1173
               ||||||| || ||||||||  |  ||||||||| ||| ||| |||   |  | ||||| 
Sbjct: 111974 gttgagatcctaatgggtgcaagctttgtgtgccactcttggttggcagcttcaaagtca 111915

                                                                    
Query: 1174   cctgagttgtggcgttttgtggacatgacgcgacagaagctggttttctcaaag 1227
              |||||  ||||||| || ||||||||||| || || ||| || |||||||||||
Sbjct: 111914 cctgaactgtggcggttcgtggacatgacacgccacaaggtgattttctcaaag 111861



 Score = 89.7 bits (45), Expect = 4e-14
 Identities = 120/145 (82%)
 Strand = Plus / Minus

                                                                          
Query: 1084   ctttctgcaatcttcatgaaacttgggaccattgagattcttatgggtgcgggacttgtg 1143
              ||||||||| |||||||||||||||||||  |||||||||| ||||||||  |  |||||
Sbjct: 106313 ctttctgcagtcttcatgaaacttgggactgttgagattctgatgggtgctagctttgtg 106254

                                                                          
Query: 1144   tgccgctcatggctggtgacagccaagtcccctgagttgtggcgttttgtggacatgacg 1203
              |||| ||||||| ||| | |  | ||||| |||||  ||||||| || ||||||||||| 
Sbjct: 106253 tgccactcatggttggcggcttcaaagtcacctgaactgtggcgattcgtggacatgaca 106194

                                       
Query: 1204   cgacagaagctggttttctcaaagg 1228
              || || ||| || ||||||||||||
Sbjct: 106193 cgccacaaggtgattttctcaaagg 106169



 Score = 79.8 bits (40), Expect = 4e-11
 Identities = 67/76 (88%)
 Strand = Plus / Minus

                                                                          
Query: 1264   atagatcgctctgatggacagatggaatcattctgggctcagaagtttgtcactagcgaa 1323
              ||||||||||| ||||||||||| || ||||||||||| ||||||||||||||| | |||
Sbjct: 111824 atagatcgctccgatggacagattgagtcattctgggcccagaagtttgtcactggtgaa 111765

                              
Query: 1324   ctcctgaattacattg 1339
              ||| || |||| ||||
Sbjct: 111764 ctcttggattatattg 111749



 Score = 75.8 bits (38), Expect = 6e-10
 Identities = 101/122 (82%)
 Strand = Plus / Minus

                                                                          
Query: 1669   gccttcgccatagcagagagcttgcatgagttgcggctccttcagatggcaggctacggc 1728
              |||||||| |||||||| | | |||||||||| ||||| || ||||| |||||  |   |
Sbjct: 110581 gccttcgcgatagcagaaaacatgcatgagttacggcttctgcagattgcaggtcataac 110522

                                                                          
Query: 1729   ctgaccaacaaaggggtatacgccatccttgaaggctgcccccacctcgagttcctcgac 1788
              |||||| | | ||||||   |||||||||||| ||||||||||||||||||| |||||||
Sbjct: 110521 ctgaccgagataggggtgcgcgccatccttgatggctgcccccacctcgagtgcctcgac 110462

                
Query: 1789   ct 1790
              ||
Sbjct: 110461 ct 110460



 Score = 73.8 bits (37), Expect = 2e-09
 Identities = 76/89 (85%)
 Strand = Plus / Minus

                                                                          
Query: 1249   atggcaaaggtggccatagatcgctctgatggacagatggaatcattctgggctcagaag 1308
              |||||||| | ||| ||||| ||||| ||||||| |||||| || |||||||||||||||
Sbjct: 106148 atggcaaaagcggcaatagaccgctccgatggacggatggagtcgttctgggctcagaag 106089

                                           
Query: 1309   tttgtcactagcgaactcctgaattacat 1337
              ||||| ||| | |||||| || |||||||
Sbjct: 106088 tttgttacttgtgaactcttggattacat 106060



 Score = 65.9 bits (33), Expect = 6e-07
 Identities = 48/53 (90%)
 Strand = Plus / Minus

                                                                   
Query: 1728   cctgaccaacaaaggggtatacgccatccttgaaggctgcccccacctcgagt 1780
              ||||||||||||||||||  | |||||||| || |||||||||||||||||||
Sbjct: 115889 cctgaccaacaaaggggttcatgccatcctcgatggctgcccccacctcgagt 115837



 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                          
Query: 1106   ttgggaccattgagattcttatgggtgcgggacttgtgtgccgctcatggctggtgacag 1165
              ||||| ||||||||||||| |||||||| || |||||||||| ||||||| ||| | | |
Sbjct: 144818 ttggggccattgagattctgatgggtgctggccttgtgtgccactcatggttggaggctg 144759

                                                      
Query: 1166   ccaagtcccctgagttgtggcgttttgtggacatgacgcg 1205
              |||||  |||||| |||||| | | | | |||||||||||
Sbjct: 144758 ccaaggtccctgacttgtggagatctctcgacatgacgcg 144719



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 32/35 (91%)
 Strand = Plus / Minus

                                                 
Query: 1507   cgcccagagctgaaacgtctaagagtccatttgcc 1541
              |||||| |||||||||||||| |||||||| ||||
Sbjct: 105498 cgcccacagctgaaacgtctacgagtccatatgcc 105464



 Score = 46.1 bits (23), Expect = 0.53
 Identities = 41/47 (87%)
 Strand = Plus / Minus

                                                             
Query: 1669   gccttcgccatagcagagagcttgcatgagttgcggctccttcagat 1715
              ||||||||||| ||||||||| |||| ||| ||||  ||||||||||
Sbjct: 143627 gccttcgccattgcagagagcatgcacgagctgcgtatccttcagat 143581



 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 1357   ttgaagagcattcggctcatcg 1378
              ||||||||||||||||||||||
Sbjct: 116488 ttgaagagcattcggctcatcg 116467

>dbj|AP004746.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
            clone:P0035F08
          Length = 167446

 Score = 63.9 bits (32), Expect = 2e-06
 Identities = 83/100 (83%)
 Strand = Plus / Minus

                                                                        
Query: 1106 ttgggaccattgagattcttatgggtgcgggacttgtgtgccgctcatggctggtgacag 1165
            ||||| ||||||||||||| |||||||| || |||||||||| ||||||| ||| | | |
Sbjct: 1235 ttggggccattgagattctgatgggtgctggccttgtgtgccactcatggttggaggctg 1176

                                                    
Query: 1166 ccaagtcccctgagttgtggcgttttgtggacatgacgcg 1205
            |||||  |||||| |||||| | | | | |||||||||||
Sbjct: 1175 ccaaggtccctgacttgtggagatctctcgacatgacgcg 1136

>emb|AM229678.1| Escherichia coli colibactin polyketide biosynthesis gene cluster and
             flanking regions, strain IHE3034
          Length = 55140

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 36    ccgccgcctccgcttccttagc 57
             ||||||||||||||||||||||
Sbjct: 15915 ccgccgcctccgcttccttagc 15936

>gb|CP000247.1| Escherichia coli 536, complete genome
          Length = 4938920

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 36      ccgccgcctccgcttccttagc 57
               ||||||||||||||||||||||
Sbjct: 2030887 ccgccgcctccgcttccttagc 2030908

>gb|CP000243.1| Escherichia coli UTI89, complete genome
          Length = 5065741

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 36      ccgccgcctccgcttccttagc 57
               ||||||||||||||||||||||
Sbjct: 2129607 ccgccgcctccgcttccttagc 2129628

>gb|AY260902.1| Rhodospirillum centenum che2 gene cluster, complete sequence
          Length = 11332

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 222  ggcgacggcggcatcagggagg 243
            ||||||||||||||||||||||
Sbjct: 1049 ggcgacggcggcatcagggagg 1028

>gb|AC112257.5| Mus musculus BAC clone RP23-43A18 from 16, complete sequence
          Length = 199117

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                            
Query: 989    gtttttaggagttaccttgcacaatggagg 1018
              ||||| ||||||| ||||||||||||||||
Sbjct: 171054 gttttaaggagtttccttgcacaatggagg 171083

>gb|AC009468.3| Homo sapiens BAC clone GS1-278J22 from 7, complete sequence
          Length = 152517

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                       
Query: 604   catcaattgcaaagtttctgagatga 629
             ||||||||||||||||||| ||||||
Sbjct: 48979 catcaattgcaaagtttcttagatga 49004

>gb|AE014075.1| Escherichia coli CFT073, complete genome
          Length = 5231428

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 36      ccgccgcctccgcttccttagc 57
               ||||||||||||||||||||||
Sbjct: 2278433 ccgccgcctccgcttccttagc 2278454

>emb|BX927218.17| Zebrafish DNA sequence from clone DKEY-14O18 in linkage group 19,
              complete sequence
          Length = 208809

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 517    gttgatggatggttggataaat 538
              ||||||||||||||||||||||
Sbjct: 162646 gttgatggatggttggataaat 162625

>gb|AC161815.4| Mus musculus BAC clone RP23-353C21 from chromosome 16, complete
             sequence
          Length = 197690

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                           
Query: 989   gtttttaggagttaccttgcacaatggagg 1018
             ||||| ||||||| ||||||||||||||||
Sbjct: 17057 gttttaaggagtttccttgcacaatggagg 17086

>emb|BX005216.10| Zebrafish DNA sequence from clone CH211-286O21, complete sequence
          Length = 163291

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 513    ctgggttgatggatggttggat 534
              ||||||||||||||||||||||
Sbjct: 160359 ctgggttgatggatggttggat 160380

>emb|CR760815.1| Xenopus tropicalis finished cDNA, clone TTpA006g14
          Length = 1942

 Score = 44.1 bits (22), Expect = 2.1
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 868  agaagccactcctgatgtatta 889
            ||||||||||||||||||||||
Sbjct: 1870 agaagccactcctgatgtatta 1849

>gb|AC183805.2| Pan troglodytes BAC clone CH251-9E14 from chromosome 10, complete
             sequence
          Length = 138735

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1095  cttcatgaaacttgggaccat 1115
             |||||||||||||||||||||
Sbjct: 47624 cttcatgaaacttgggaccat 47604

>gb|AC183592.2| Pan troglodytes BAC clone CH251-733I16 from chromosome 10, complete
             sequence
          Length = 167069

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1095  cttcatgaaacttgggaccat 1115
             |||||||||||||||||||||
Sbjct: 58263 cttcatgaaacttgggaccat 58283

>ref|XM_969181.1| PREDICTED: Tribolium castaneum similar to Probable signal peptidase
            complex subunit 3 (Microsomal signal peptidase 22 kDa
            subunit) (SPase 22 kDa subunit) (SPC22) (LOC663120), mRNA
          Length = 562

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 1384 tattacttttgggataatgggaacg 1408
            ||||||||||||||| |||||||||
Sbjct: 401  tattacttttgggatgatgggaacg 425

>gb|AC109266.24| Mus musculus chromosome 16, clone RP23-176C2, complete sequence
          Length = 171797

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 125   tttagggtttgggttcggttggttg 149
             ||||||||||||||| |||||||||
Sbjct: 56304 tttagggtttgggtttggttggttg 56280

>gb|AY049008.1| Homo sapiens mitochondrial ceramidase gene, complete cds; nuclear gene
             for mitochondrial product
          Length = 61550

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 1095  cttcatgaaacttgggaccat 1115
             |||||||||||||||||||||
Sbjct: 60641 cttcatgaaacttgggaccat 60661

>gb|AC142323.1| Pan troglodytes BAC clone RP43-72N8 from 7, complete sequence
          Length = 190220

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 605   atcaattgcaaagtttctgagatga 629
             |||||||||||||||||| ||||||
Sbjct: 71779 atcaattgcaaagtttcttagatga 71803

>gb|AC098613.2| Homo sapiens chromosome 3 clone RP11-24F11, complete sequence
          Length = 185437

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 514    tgggttgatggatggttggataaat 538
              ||||| |||||||||||||||||||
Sbjct: 180329 tgggtggatggatggttggataaat 180305

>gb|AC104304.2| Homo sapiens chromosome 3 clone RP11-509I21, complete sequence
          Length = 202933

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 514   tgggttgatggatggttggataaat 538
             ||||| |||||||||||||||||||
Sbjct: 56144 tgggtggatggatggttggataaat 56120

>gb|AC069444.17| Homo sapiens 3 BAC RP11-169N13 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 165093

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 514   tgggttgatggatggttggat 534
             |||||||||||||||||||||
Sbjct: 40812 tgggttgatggatggttggat 40832

>emb|AL713986.10| Mouse DNA sequence from clone RP23-142G13 on chromosome X, complete
             sequence
          Length = 204903

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1230  agaaaatgtcttgtgcaaaat 1250
             |||||||||||||||||||||
Sbjct: 48853 agaaaatgtcttgtgcaaaat 48833

>gb|AC105391.1| Homo sapiens BAC clone RP11-311D14 from 4, complete sequence
          Length = 143498

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1210  aagctggttttctcaaaggca 1230
             |||||||||||||||||||||
Sbjct: 44247 aagctggttttctcaaaggca 44227

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3
          Length = 36192742

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                     
Query: 1659     caacgaggaggccttcgccat 1679
                |||||||||||||||||||||
Sbjct: 34592607 caacgaggaggccttcgccat 34592627

>gb|AC096687.5| Oryza sativa chromosome 3 BAC OSJNBa0010E04 genomic sequence, complete
             sequence
          Length = 117505

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1659  caacgaggaggccttcgccat 1679
             |||||||||||||||||||||
Sbjct: 23632 caacgaggaggccttcgccat 23612

>emb|AL954360.3| Human DNA sequence from clone RP11-98I6 on chromosome 10 Contains a novel
              protein similar to KIAA0592, solute carrier family 9 member
              3 (SLC9A3) pseudogene and novel protein similar to
              N-acylsphingosine amidohydrolase (non-lysosomal ceramidase)
              2 (ASAH2), complete sequence
          Length = 163231

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 1095   cttcatgaaacttgggaccat 1115
              |||||||||||||||||||||
Sbjct: 110006 cttcatgaaacttgggaccat 109986

>emb|AL589794.7| Human DNA sequence from clone RP11-564C4 on chromosome 10 Contains the 3'
              end of the gene for apobec-1 complementation factor (ACF)
              (ASP), the gene for a novel protein similar to
              N-acylsphingosine amidohydrolase (non-lysosomal ceramidase)
              2 (ASAH2), the cathepsin L-like 2 (CTSLL2) pseudogene,
              three novel pseudogenes (KIAA1553), a novel gene, a protein
              geranylgeranyltransferase type I beta subunit (PGGT1B)
              pseudogene and a CpG island, complete sequence
          Length = 178899

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 1095   cttcatgaaacttgggaccat 1115
              |||||||||||||||||||||
Sbjct: 114042 cttcatgaaacttgggaccat 114062

>emb|AL450382.7| Human DNA sequence from clone RP11-56A21 on chromosome 10 Contains part
             of gene FLJ10824, a solute carrier family 9
             (sodium/hydrogen exchanger) isoform 5 (SLC9A5) pseudogene,
             the ASAH2 gene for N-acylsphingosine amidohydrolase
             (non-lysosomal ceramidase) 2 and a dynein cytoplasmic
             intermediate polypeptide 2 (DNCI2) pseudogene, complete
             sequence
          Length = 162228

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 1095  cttcatgaaacttgggaccat 1115
             |||||||||||||||||||||
Sbjct: 63288 cttcatgaaacttgggaccat 63268

>emb|AL022238.1|HS1042K10 Human DNA sequence from clone RP5-1042K10 on chromosome 22q13.1-13.2,
            complete sequence
          Length = 184180

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1213 ctggttttctcaaaggcagaa 1233
            |||||||||||||||||||||
Sbjct: 8743 ctggttttctcaaaggcagaa 8763

>emb|BX511128.8| Zebrafish DNA sequence from clone DKEY-56M19 in linkage group 7,
             complete sequence
          Length = 112766

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 610   ttgcaaagtttctgagatgatagtg 634
             ||||||||||| |||||||||||||
Sbjct: 86275 ttgcaaagtttttgagatgatagtg 86251

>gb|AC106772.3| Homo sapiens chromosome 5 clone RP11-310P5, complete sequence
          Length = 161984

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 514   tgggttgatggatggttggataaat 538
             ||||| |||||||||||||||||||
Sbjct: 43030 tgggtggatggatggttggataaat 43006

>gb|AC084611.1|CBRG44D16 Caenorhabditis briggsae cosmid G44D16, complete sequence
          Length = 37062

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 751   aaaaacataaaagagctattt 771
             |||||||||||||||||||||
Sbjct: 23447 aaaaacataaaagagctattt 23427

>emb|BX004979.8| Zebrafish DNA sequence from clone DKEY-121H18 in linkage group 7,
            complete sequence
          Length = 186642

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 610  ttgcaaagtttctgagatgatagtg 634
            ||||||||||| |||||||||||||
Sbjct: 9692 ttgcaaagtttttgagatgatagtg 9716

>gb|U89254.1|BTU89254 Bos taurus retina specific RGS protein (RET-RGS1) mRNA, complete cds
          Length = 2418

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 1897 ctccagaccatcgaggcggat 1917
            |||||||||||||||||||||
Sbjct: 770  ctccagaccatcgaggcggat 790

>emb|AL954166.9| Zebrafish DNA sequence from clone DKEYP-120B11 in linkage group 20,
            complete sequence
          Length = 186299

 Score = 42.1 bits (21), Expect = 8.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 610  ttgcaaagtttctgagatgatagtg 634
            ||||||||||| |||||||||||||
Sbjct: 9692 ttgcaaagtttttgagatgatagtg 9716


  Database: All GenBank+EMBL+DDBJ+PDB sequences (but no EST, STS,
  GSS,environmental samples or phase 0, 1 or 2 HTGS sequences)
    Posted date:  Dec 3, 2006  5:45 PM
  Number of letters in database: 18,610,659,111
  Number of sequences in database:  4,638,285
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Sequences: 4638285
Number of Hits to DB: 336,181,536
Number of extensions: 17318310
Number of successful extensions: 86658
Number of sequences better than 10.0: 38
Number of HSP's gapped: 86654
Number of HSP's successfully gapped: 65
Length of query: 2178
Length of database: 18,610,659,111
Length adjustment: 23
Effective length of query: 2155
Effective length of database: 18,503,978,556
Effective search space: 39876073788180
Effective search space used: 39876073788180
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 25 (49.6 bits)
S1: 15 (30.2 bits)