Clone Name | rbastl56h10 |
---|---|
Clone Library Name | barley_pub |
>ref|XM_643491.1| Entamoeba histolytica HM-1:IMSS coatomer beta subunit (427.t00002) partial mRNA Length = 2079 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Minus Query: 57 caatagctaaactagaaataa 77 ||||||||||||||||||||| Sbjct: 961 caatagctaaactagaaataa 941
>ref|XM_649421.1| Entamoeba histolytica HM-1:IMSS coatmer beta subunit (51.t00032) partial mRNA Length = 2733 Score = 42.1 bits (21), Expect = 0.85 Identities = 21/21 (100%) Strand = Plus / Minus Query: 57 caatagctaaactagaaataa 77 ||||||||||||||||||||| Sbjct: 1615 caatagctaaactagaaataa 1595
>ref|XM_529495.1| PREDICTED: Pan troglodytes LOC451954 (LOC451954), mRNA Length = 973 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 atccaaaaagaattgtgttt 171 |||||||||||||||||||| Sbjct: 519 atccaaaaagaattgtgttt 500
>gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete sequence Length = 136150 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 tgaaatataatagttccaaa 104 |||||||||||||||||||| Sbjct: 34616 tgaaatataatagttccaaa 34635
>gb|AC149290.1| Solanum demissum chromosome 5 clone PGEC093P17 map MAP_LOC, complete sequence Length = 200238 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 tgaaatataatagttccaaa 104 |||||||||||||||||||| Sbjct: 13530 tgaaatataatagttccaaa 13511
>gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 map MAP_LOC, complete sequence Length = 133983 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 85 tgaaatataatagttccaaa 104 |||||||||||||||||||| Sbjct: 84044 tgaaatataatagttccaaa 84025
>gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17, complete sequence Length = 75612 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 tgaaatataatagttccaaa 104 |||||||||||||||||||| Sbjct: 27303 tgaaatataatagttccaaa 27322
>gb|AY730336.1| Solanum tuberosum strain P6/210 clone BAC BA213c14, complete sequence Length = 72352 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 85 tgaaatataatagttccaaa 104 |||||||||||||||||||| Sbjct: 8917 tgaaatataatagttccaaa 8936
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome Length = 5227419 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 atatgaaatataatagttcc 101 |||||||||||||||||||| Sbjct: 4332462 atatgaaatataatagttcc 4332481
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome Length = 5228663 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 atatgaaatataatagttcc 101 |||||||||||||||||||| Sbjct: 4332835 atatgaaatataatagttcc 4332854
>gb|AC122172.30| Medicago truncatula clone mth2-27e7, complete sequence Length = 109532 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 114 atgatgaaacaaaagactag 133 |||||||||||||||||||| Sbjct: 28183 atgatgaaacaaaagactag 28164
>emb|AL611942.12| Human DNA sequence from clone RP11-125H17 on chromosome 1 Contains the PRPF3 gene for PRP3 pre-mRNA processing factor 3 homolog (yeast) and the 5' end of the gene for a novel protein (KIAA0460), complete sequence Length = 151182 Score = 40.1 bits (20), Expect = 3.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 71 gaaataataggatatgaaatataa 94 ||||||||| |||||||||||||| Sbjct: 73626 gaaataataagatatgaaatataa 73649
>emb|AL589943.26| Human DNA sequence from clone RP11-44D23 on chromosome 10, complete sequence Length = 139325 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 gaaataataggatatgaaat 90 |||||||||||||||||||| Sbjct: 36491 gaaataataggatatgaaat 36510
>emb|CR380954.1| Candida glabrata strain CBS138 chromosome H complete sequence Length = 1050361 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 58 aatagctaaactagaaataa 77 |||||||||||||||||||| Sbjct: 353940 aatagctaaactagaaataa 353959
>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24, complete sequence Length = 152545 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 100 ccaaagttaacctaatgatg 119 |||||||||||||||||||| Sbjct: 76189 ccaaagttaacctaatgatg 76170
>gb|AF526145.1| Peromyscus maniculatus microsatellite BW4-245 sequence Length = 472 Score = 40.1 bits (20), Expect = 3.3 Identities = 23/24 (95%) Strand = Plus / Plus Query: 204 atgacatttcacagcccatgaaac 227 ||||||||||||| |||||||||| Sbjct: 191 atgacatttcacaacccatgaaac 214
>gb|AC078778.34| Homo sapiens 12 BAC RP11-968A15 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 141003 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 152 atccaaaaagaattgtgttt 171 |||||||||||||||||||| Sbjct: 95901 atccaaaaagaattgtgttt 95882
>gb|AC034099.16| Mus Musculus Strain C57BL6/J Chromosome 7 BAC, RP23-145I16, complete sequence Length = 229553 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 72 aaataataggatatgaaata 91 |||||||||||||||||||| Sbjct: 140476 aaataataggatatgaaata 140495
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome Length = 5227293 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Plus Query: 82 atatgaaatataatagttcc 101 |||||||||||||||||||| Sbjct: 4332335 atatgaaatataatagttcc 4332354
>emb|AL731864.25| Mouse DNA sequence from clone RP23-342F20 on chromosome 7, complete sequence Length = 148047 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 72 aaataataggatatgaaata 91 |||||||||||||||||||| Sbjct: 90824 aaataataggatatgaaata 90805
>gb|AC092957.6| Homo sapiens 3 BAC RP11-635I10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 161585 Score = 40.1 bits (20), Expect = 3.3 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 gaaacaaaagactaggtaga 138 |||||||||||||||||||| Sbjct: 103999 gaaacaaaagactaggtaga 103980 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,079,874 Number of Sequences: 3902068 Number of extensions: 3079874 Number of successful extensions: 60044 Number of sequences better than 10.0: 21 Number of HSP's better than 10.0 without gapping: 21 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 59968 Number of HSP's gapped (non-prelim): 76 length of query: 258 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 236 effective length of database: 17,147,199,772 effective search space: 4046739146192 effective search space used: 4046739146192 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)