ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbastl56h10
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|XM_643491.1| Entamoeba histolytica HM-1:IMSS coatomer beta s... 42 0.85
2ref|XM_649421.1| Entamoeba histolytica HM-1:IMSS coatmer beta su... 42 0.85
3ref|XM_529495.1| PREDICTED: Pan troglodytes LOC451954 (LOC451954... 40 3.3
4gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 ma... 40 3.3
5gb|AC149290.1| Solanum demissum chromosome 5 clone PGEC093P17 ma... 40 3.3
6gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 ma... 40 3.3
7gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17... 40 3.3
8gb|AY730336.1| Solanum tuberosum strain P6/210 clone BAC BA213c1... 40 3.3
9gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 3.3
10gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 3.3
11gb|AC122172.30| Medicago truncatula clone mth2-27e7, complete se... 40 3.3
12emb|AL611942.12| Human DNA sequence from clone RP11-125H17 on ch... 40 3.3
13emb|AL589943.26| Human DNA sequence from clone RP11-44D23 on chr... 40 3.3
14emb|CR380954.1| Candida glabrata strain CBS138 chromosome H comp... 40 3.3
15emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 ... 40 3.3
16gb|AF526145.1| Peromyscus maniculatus microsatellite BW4-245 seq... 40 3.3
17gb|AC078778.34| Homo sapiens 12 BAC RP11-968A15 (Roswell Park Ca... 40 3.3
18gb|AC034099.16| Mus Musculus Strain C57BL6/J Chromosome 7 BAC, R... 40 3.3
19gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 3.3
20emb|AL731864.25| Mouse DNA sequence from clone RP23-342F20 on ch... 40 3.3
21gb|AC092957.6| Homo sapiens 3 BAC RP11-635I10 (Roswell Park Canc... 40 3.3

>ref|XM_643491.1| Entamoeba histolytica HM-1:IMSS coatomer beta subunit (427.t00002)
           partial mRNA
          Length = 2079

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 57  caatagctaaactagaaataa 77
           |||||||||||||||||||||
Sbjct: 961 caatagctaaactagaaataa 941



to top

>ref|XM_649421.1| Entamoeba histolytica HM-1:IMSS coatmer beta subunit (51.t00032)
            partial mRNA
          Length = 2733

 Score = 42.1 bits (21), Expect = 0.85
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 57   caatagctaaactagaaataa 77
            |||||||||||||||||||||
Sbjct: 1615 caatagctaaactagaaataa 1595



to top

>ref|XM_529495.1| PREDICTED: Pan troglodytes LOC451954 (LOC451954), mRNA
          Length = 973

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 152 atccaaaaagaattgtgttt 171
           ||||||||||||||||||||
Sbjct: 519 atccaaaaagaattgtgttt 500



to top

>gb|AC151815.1| Solanum demissum chromosome 5 clone PGEC472P22 map MAP_LOC, complete
             sequence
          Length = 136150

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    tgaaatataatagttccaaa 104
             ||||||||||||||||||||
Sbjct: 34616 tgaaatataatagttccaaa 34635



to top

>gb|AC149290.1| Solanum demissum chromosome 5 clone PGEC093P17 map MAP_LOC, complete
             sequence
          Length = 200238

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    tgaaatataatagttccaaa 104
             ||||||||||||||||||||
Sbjct: 13530 tgaaatataatagttccaaa 13511



to top

>gb|AC149301.1| Solanum demissum chromosome 5 clone PGEC517A09 map MAP_LOC, complete
             sequence
          Length = 133983

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 85    tgaaatataatagttccaaa 104
             ||||||||||||||||||||
Sbjct: 84044 tgaaatataatagttccaaa 84025



to top

>gb|AY730340.1| Solanum tuberosum strain P6/210 clone BAC BA87d17, complete sequence
          Length = 75612

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 85    tgaaatataatagttccaaa 104
             ||||||||||||||||||||
Sbjct: 27303 tgaaatataatagttccaaa 27322



to top

>gb|AY730336.1| Solanum tuberosum strain P6/210 clone BAC BA213c14, complete sequence
          Length = 72352

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 85   tgaaatataatagttccaaa 104
            ||||||||||||||||||||
Sbjct: 8917 tgaaatataatagttccaaa 8936



to top

>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 82      atatgaaatataatagttcc 101
               ||||||||||||||||||||
Sbjct: 4332462 atatgaaatataatagttcc 4332481



to top

>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 82      atatgaaatataatagttcc 101
               ||||||||||||||||||||
Sbjct: 4332835 atatgaaatataatagttcc 4332854



to top

>gb|AC122172.30| Medicago truncatula clone mth2-27e7, complete sequence
          Length = 109532

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 114   atgatgaaacaaaagactag 133
             ||||||||||||||||||||
Sbjct: 28183 atgatgaaacaaaagactag 28164



to top

>emb|AL611942.12| Human DNA sequence from clone RP11-125H17 on chromosome 1 Contains the
             PRPF3 gene for PRP3 pre-mRNA processing factor 3 homolog
             (yeast) and the 5' end of the gene for a novel protein
             (KIAA0460), complete sequence
          Length = 151182

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 71    gaaataataggatatgaaatataa 94
             ||||||||| ||||||||||||||
Sbjct: 73626 gaaataataagatatgaaatataa 73649



to top

>emb|AL589943.26| Human DNA sequence from clone RP11-44D23 on chromosome 10, complete
             sequence
          Length = 139325

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 71    gaaataataggatatgaaat 90
             ||||||||||||||||||||
Sbjct: 36491 gaaataataggatatgaaat 36510



to top

>emb|CR380954.1| Candida glabrata strain CBS138 chromosome H complete sequence
          Length = 1050361

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 58     aatagctaaactagaaataa 77
              ||||||||||||||||||||
Sbjct: 353940 aatagctaaactagaaataa 353959



to top

>emb|BX294098.11| Zebrafish DNA sequence from clone CH211-254P12 in linkage group 24,
             complete sequence
          Length = 152545

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 100   ccaaagttaacctaatgatg 119
             ||||||||||||||||||||
Sbjct: 76189 ccaaagttaacctaatgatg 76170



to top

>gb|AF526145.1| Peromyscus maniculatus microsatellite BW4-245 sequence
          Length = 472

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 204 atgacatttcacagcccatgaaac 227
           ||||||||||||| ||||||||||
Sbjct: 191 atgacatttcacaacccatgaaac 214



to top

>gb|AC078778.34| Homo sapiens 12 BAC RP11-968A15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 141003

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 152   atccaaaaagaattgtgttt 171
             ||||||||||||||||||||
Sbjct: 95901 atccaaaaagaattgtgttt 95882



to top

>gb|AC034099.16| Mus Musculus Strain C57BL6/J Chromosome 7 BAC, RP23-145I16, complete
              sequence
          Length = 229553

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 72     aaataataggatatgaaata 91
              ||||||||||||||||||||
Sbjct: 140476 aaataataggatatgaaata 140495



to top

>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 82      atatgaaatataatagttcc 101
               ||||||||||||||||||||
Sbjct: 4332335 atatgaaatataatagttcc 4332354



to top

>emb|AL731864.25| Mouse DNA sequence from clone RP23-342F20 on chromosome 7, complete
             sequence
          Length = 148047

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 72    aaataataggatatgaaata 91
             ||||||||||||||||||||
Sbjct: 90824 aaataataggatatgaaata 90805



to top

>gb|AC092957.6| Homo sapiens 3 BAC RP11-635I10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 161585

 Score = 40.1 bits (20), Expect = 3.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 119    gaaacaaaagactaggtaga 138
              ||||||||||||||||||||
Sbjct: 103999 gaaacaaaagactaggtaga 103980


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,079,874
Number of Sequences: 3902068
Number of extensions: 3079874
Number of successful extensions: 60044
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59968
Number of HSP's gapped (non-prelim): 76
length of query: 258
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 236
effective length of database: 17,147,199,772
effective search space: 4046739146192
effective search space used: 4046739146192
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top